ID: 1084744864

View in Genome Browser
Species Human (GRCh38)
Location 11:71163327-71163349
Sequence GGCACAGGGTCTGCCTGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 2, 1: 0, 2: 2, 3: 12, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084744864 Original CRISPR GGCACAGGGTCTGCCTGTAA TGG Intronic
901177938 1:7318276-7318298 GGCATTGGGTCAGCCCGTAAAGG + Intronic
901445870 1:9307877-9307899 GGCACAGGGTAAGCCTGGGAGGG - Intronic
901748882 1:11393743-11393765 GGCACTGGGTCTGCCAGCATGGG - Intergenic
902532109 1:17097218-17097240 GGCAGAGGGTGTGCCTGCCACGG - Intronic
902623309 1:17662832-17662854 GGGGAAGGGTCTGCCTGTGATGG + Intronic
903349573 1:22710119-22710141 GGCCTGGGGTCTGCCTGCAAGGG + Intergenic
903660328 1:24973254-24973276 GACTCAGGGTCTGCCTGTGGGGG - Intergenic
906264174 1:44416504-44416526 GGCACAGGGGCAGCCTGAAGAGG - Intronic
907785055 1:57603285-57603307 GGCACAGTGCCTGTCAGTAAGGG + Intronic
915355723 1:155254471-155254493 GGCACAGGCTCAGCCTGGCAGGG + Intronic
915943612 1:160134627-160134649 GGCACAGGGGCTTCCTGCAGAGG - Intronic
918298669 1:183182200-183182222 GGGACAGGGACTGACTGCAATGG - Intergenic
919531739 1:198729697-198729719 GGCACAGACTCTGCCCTTAAAGG + Intronic
924772287 1:247088530-247088552 GGCACAGGGTCTGCCTCCCCTGG + Intergenic
1064120119 10:12611267-12611289 GGCACAGGGCCTGCGTTTAGTGG - Intronic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1067233603 10:44428272-44428294 GGCAGAGGTTCAGCCTCTAATGG - Intergenic
1067744395 10:48924316-48924338 GGCACTGGGTCTGCTTCTAGTGG - Intronic
1069656906 10:70096712-70096734 GGTACAGGGCTTGCCTGTGAGGG + Intronic
1069909593 10:71751281-71751303 GGGACAGGGTCTGCAAGAAAAGG + Exonic
1071508612 10:86247598-86247620 GGCTCTGGGTCTTCCAGTAAGGG + Intronic
1072577052 10:96709903-96709925 GGAACAGGGTCTGCAGGTACTGG + Exonic
1073106080 10:101032681-101032703 GGCACAGTGTGCGCCTGTAAAGG + Intronic
1073497633 10:103908294-103908316 GGCACAGGGTCTGCTGGGAGAGG - Intronic
1073549624 10:104385790-104385812 GGAACATGGTCAGCCTGTACAGG - Intronic
1073877744 10:107945262-107945284 TTCACAGGTTCTGCCTGTAGAGG - Intergenic
1074533225 10:114311015-114311037 GGAAGAGGGTCTCTCTGTAAAGG + Intronic
1079249736 11:18778719-18778741 GGCACATGGCCAGCCTGTACAGG - Intronic
1082180556 11:49112784-49112806 GATACAGAGTCTGCCTATAACGG + Intergenic
1083670116 11:64295134-64295156 GACACAGGGTCTGCCTTGGAGGG + Intronic
1083763822 11:64832836-64832858 GGCACAGGCACTGCCTATGAGGG - Exonic
1084742059 11:71146432-71146454 GGAACTGGGGCTGTCTGTAAAGG - Intronic
1084744864 11:71163327-71163349 GGCACAGGGTCTGCCTGTAATGG + Intronic
1091667986 12:2432965-2432987 GGCACAGGGTTAGTCTCTAAAGG - Intronic
1095097445 12:38156025-38156047 GGCGCAGGGGCTGCCGGGAAGGG - Intergenic
1101408735 12:104452286-104452308 GGCACAAAGCCTGCCTGAAATGG + Intergenic
1101470909 12:104996187-104996209 CTCAGAGGGTCTGCCTGTATTGG - Intronic
1102225917 12:111228079-111228101 TGCACAGGGTCTGCATATAGTGG - Intronic
1103575838 12:121876596-121876618 GACACAGGTTCAGCCTGAAAGGG - Intergenic
1104050312 12:125190121-125190143 GGCACAGGGACCGCCTGTTCAGG + Intronic
1107127287 13:36859294-36859316 GGCAGAGGGTCTGCATGTCCAGG - Intronic
1112565109 13:100545799-100545821 GGAACAGGTTCTGCTTGCAATGG - Intronic
1112688650 13:101863354-101863376 GGCCCTTGGTCTGCCTGCAATGG + Intronic
1112707708 13:102090569-102090591 AGCCCAGGCTCTGACTGTAATGG + Intronic
1113616778 13:111685810-111685832 GGCACAGGCTCTACCTGGGAAGG + Intergenic
1113622308 13:111771081-111771103 GGCACAGGCTCTACCTGGGAAGG + Intergenic
1113886220 13:113659806-113659828 AACACAGGGTCTGGCAGTAAAGG + Intergenic
1115636303 14:35292870-35292892 GGCACAAGGTCTGTTTCTAAAGG + Intronic
1117787808 14:59305281-59305303 GGCACAGTGCCTGCCTGCAGGGG + Intronic
1119866131 14:77976411-77976433 TGCACAGAGTCTGACTGTCATGG + Intergenic
1121230686 14:92355346-92355368 GGCACAGGGTCTGCAGGTCATGG + Intronic
1122237175 14:100338027-100338049 GGCACAGGGTAAGGCAGTAAGGG + Intronic
1122461290 14:101897715-101897737 TGCACTGGGTGTGCCTGTGAGGG - Intronic
1124341782 15:28894543-28894565 GGCAAAGGGCCAGCCTGGAATGG + Intronic
1126864212 15:52920053-52920075 AGCCCAGGGTCTTCCTGGAAAGG - Intergenic
1127830273 15:62744157-62744179 GGCACAGAGTCTGCCTGAAAGGG - Intronic
1129302578 15:74634097-74634119 GGGACAGAGTCTGACTGGAATGG - Intronic
1129603461 15:77013420-77013442 GGCACAGGCCGTGACTGTAAAGG + Intronic
1132607606 16:800103-800125 AGCAGAGGGTCTGCCCGTAGTGG + Intronic
1133479845 16:6159536-6159558 AGCACAGGGTCTGCCCTAAATGG + Intronic
1134200730 16:12196464-12196486 GGCACAGCTTTTACCTGTAAGGG + Intronic
1134515199 16:14881551-14881573 GGCACAGTGTCTTCCTTAAACGG + Exonic
1134666256 16:16021080-16021102 GGCACACGGTGGGCCTGTAGTGG + Intronic
1134702874 16:16280196-16280218 GGCACAGTGTCTTCCTTAAACGG + Exonic
1134964669 16:18431919-18431941 GGCACAGTGTCTTCCTTAAACGG - Exonic
1134968956 16:18514454-18514476 GGCACAGTGTCTTCCTTAAACGG - Intronic
1135186788 16:20322531-20322553 GCCACAGGGTCTTCATGTCAGGG - Intronic
1142302170 16:89265259-89265281 GGCACAGGGTCCCCCTCTCAGGG - Intergenic
1142302215 16:89265381-89265403 GGCACAGGGTCCCCCTCTCAGGG - Intergenic
1143323297 17:6081744-6081766 GTCACCAGGTCTGCCTGAAATGG + Intronic
1143808410 17:9449804-9449826 AGAAGAGGGTCTACCTGTAAAGG + Intronic
1143892807 17:10115496-10115518 GGCACAGCTGCAGCCTGTAAAGG - Intronic
1145900058 17:28484853-28484875 GACCCAGGGTCTGCCTGAAGTGG + Intronic
1147249227 17:39143310-39143332 GACACAGGGTGGGCCTGAAATGG - Intronic
1147555573 17:41476927-41476949 GGCCCAGGGTCTGGCTGAAAAGG - Exonic
1148002865 17:44400155-44400177 GCTTCAGGGTCTGCCTGTAGCGG - Exonic
1150116197 17:62551921-62551943 TGCACAGGGGATGCATGTAAAGG - Intronic
1151815970 17:76471576-76471598 GGAACAGGGTCTGCCTGCGAGGG - Exonic
1152169346 17:78733870-78733892 GGCTTAGTGTCTGCCTGTGAAGG + Intronic
1153664212 18:7353796-7353818 GGGACTGGGTTTGCATGTAAGGG - Intergenic
1154008535 18:10556315-10556337 GCCACAGGATCTGCCTGTCTAGG + Intergenic
1154269568 18:12907367-12907389 GGCACAGCACCTGCCTCTAAAGG + Intronic
1154358746 18:13642075-13642097 GGCTCAGGGACCGCCTGTGACGG - Intronic
1157812022 18:50704049-50704071 GTCACAAGGTCTGCCTGGAAAGG - Intronic
1159215517 18:65386773-65386795 GCCACTGGGCCTGCCTGTGATGG - Intergenic
1159391227 18:67795059-67795081 GCCACAGGGTCTTTTTGTAAAGG + Intergenic
1160750322 19:731069-731091 GGGAGAGGGTGTGCCTGTGAGGG - Intronic
1166705702 19:44906736-44906758 GGCCCAGGGTCTGCCTGAATGGG - Intronic
1167529623 19:50007237-50007259 GGCCCAGGGGCTGCATGTTAAGG - Intronic
1167940204 19:52940577-52940599 GAGACAGGGTCTGGCTGTATCGG - Intronic
925200498 2:1964502-1964524 TAAACAGGGTGTGCCTGTAATGG + Intronic
925750738 2:7089088-7089110 GCCACATGTTCTGCCTGCAAAGG - Intergenic
927506570 2:23618985-23619007 GGACCAGCATCTGCCTGTAAAGG - Intronic
928788645 2:34923121-34923143 GATATAGGGTATGCCTGTAAAGG - Intergenic
929960227 2:46490677-46490699 GGCGCAGAGTCTGCCTGCAGAGG + Intergenic
931773251 2:65517611-65517633 AACACAGTGTCTGCCTGTAGTGG - Intergenic
941253701 2:163200558-163200580 GGCACAAGCTCTGCCTTTCAAGG - Intergenic
942564014 2:177248838-177248860 GGGACATGATCTGCCTGAAAGGG - Intronic
1168802201 20:650816-650838 GGCACAAGGCCTGCCTGGCACGG - Intronic
1169383354 20:5127348-5127370 GGCTCAGGGTCTGACTGAAGTGG + Intronic
1171164329 20:22957171-22957193 GGCAAAGGGGCAGCCTGGAAGGG - Intergenic
1171402115 20:24880477-24880499 GGCACAGGGCCTTTCTTTAAGGG + Intergenic
1171447352 20:25214229-25214251 GGCACAGGGCACGCCTGTCAGGG + Intronic
1173919939 20:46736678-46736700 AACACAGGGTCTGTCTATAAGGG + Intergenic
1174519222 20:51116781-51116803 GGCACAGGTGGTGCATGTAATGG + Intergenic
1175533285 20:59689472-59689494 GCCGCAGGGTCTGCCTGTTGAGG + Intronic
1178365369 21:31985541-31985563 GCCCCAGGGTCTGTCTGAAATGG - Intronic
1179472874 21:41623164-41623186 GGCTCTGGGTCTGCCTGCATCGG - Intergenic
1181425885 22:22838438-22838460 GGCACAGGTTCTGCCTTCCAGGG + Intronic
1181457575 22:23068398-23068420 GGCAGAGGGTCTGCCAGAAAAGG + Intronic
1181459287 22:23076790-23076812 GGCACAGGGGCCACCTGGAAAGG - Intronic
1181775180 22:25154177-25154199 GGCACTGTGTCTGCCTGAACTGG + Intronic
1183384882 22:37509089-37509111 GGCCCAGGGTCTACCTGTATGGG - Intronic
1183951213 22:41354113-41354135 GGCATGGGGTCTGGCTCTAAGGG + Intronic
1184115724 22:42421030-42421052 GTCACAGGGCCAGCCTGTAGAGG - Intronic
1184464017 22:44658625-44658647 GGGGCAGGGTCTGGCTGCAAGGG + Intergenic
1184931997 22:47688182-47688204 GTCACAGAGTCTGCGTTTAAAGG + Intergenic
949738757 3:7205426-7205448 GGAACAGAGTCTGCCTTCAAGGG + Intronic
951095045 3:18619499-18619521 CGCACATGATGTGCCTGTAATGG - Intergenic
952991531 3:38835172-38835194 GGCACAGGGTCTCCCTCACAAGG + Intergenic
955042028 3:55327092-55327114 GTCCCAGTGTCTGCCTGTAGTGG + Intergenic
956546701 3:70411116-70411138 AGCACAGGTACAGCCTGTAAAGG + Intergenic
956792438 3:72690596-72690618 GGCACAGGGTCTGCGGGTCCAGG - Intergenic
960619606 3:119625681-119625703 GGCACAGGGTCAGTCAGCAACGG + Intronic
960627112 3:119691906-119691928 GGGACAGGGTCTCACTGTATTGG - Intergenic
961522272 3:127473652-127473674 GGCTCAGGCCCTGCCTCTAAGGG + Intergenic
968945837 4:3663747-3663769 GACGCAGGCTCTGCCTGGAAGGG - Intergenic
985671740 5:1210333-1210355 GGCACAGGGTGTGGCTGGGATGG - Intronic
985915006 5:2910877-2910899 GGGAATGGGTCTGCCTGTGAGGG - Intergenic
989012160 5:36885406-36885428 GGCCCAGGGTCTGGCAGGAATGG + Intronic
991587968 5:68218750-68218772 GGCACAGGGTTTGCAAGTGAAGG + Intronic
992193857 5:74320524-74320546 GGAACAGGGTCTGCTCGTAAAGG - Intergenic
993997714 5:94742917-94742939 TGCACAGTCCCTGCCTGTAAGGG + Intronic
997550576 5:134748707-134748729 GGGACTGGGACTGCCTGGAAAGG - Intronic
998162498 5:139821532-139821554 GGGACAGGGTCCGGCTGTAGGGG + Intronic
1000793576 5:165636531-165636553 GACACAGAGTCTGCCTGTAAGGG + Intergenic
1001998500 5:176181399-176181421 GGCACTGGGACAGCCTGTCATGG + Intergenic
1003078196 6:3000360-3000382 GGCCCAAGGTCAGTCTGTAAAGG + Intronic
1003643094 6:7892141-7892163 GACCCAGGCTCTGCCTGTCATGG + Intronic
1007803272 6:44416389-44416411 GTCACCAGGGCTGCCTGTAAAGG + Intronic
1010453094 6:76025767-76025789 GGCACAGCCACTGTCTGTAATGG + Intronic
1015294586 6:131576126-131576148 GGGACAGGGTGTGTCAGTAAAGG - Intronic
1018322458 6:162626380-162626402 GGCACAGTGTCTTCCTTTGAGGG - Intronic
1020209821 7:6150281-6150303 GGCAAACGGTCTTCCTGGAAAGG + Exonic
1020405469 7:7828605-7828627 GGCTAAGGGGCTGCCTGTAAAGG + Intronic
1021178990 7:17484399-17484421 TGCACTGGTTCTGCCTTTAAAGG + Intergenic
1021206372 7:17786463-17786485 GTGGCAGGGTCTGGCTGTAAGGG - Intergenic
1022374612 7:29801783-29801805 GGCATAGGGACTGACTGCAAAGG + Intergenic
1022785149 7:33631227-33631249 GGCTGAGGGTCTCCCTGGAACGG - Intergenic
1023347941 7:39290657-39290679 GACACATGGTCTGCCTCTTAAGG - Intronic
1023864697 7:44233211-44233233 GGCACAGGTTCAGGCAGTAAAGG - Intronic
1031030074 7:116724763-116724785 AGCACATTTTCTGCCTGTAAAGG - Intronic
1034484635 7:151351247-151351269 GTCACAGGGTCAGCCTGTGCTGG + Intronic
1047250312 8:123177394-123177416 GGCAGGGGAGCTGCCTGTAAGGG - Intergenic
1049781919 8:144432983-144433005 GGTACAGGGTCTGCCTCCGAGGG - Intronic
1051779535 9:20674035-20674057 GGCACTGGGTCTATCTGTAGTGG + Intronic
1054756625 9:68965311-68965333 GGCAGAGGGTGTCCCTGGAAAGG + Intronic
1058108125 9:100998913-100998935 GACAGAGGGTGTTCCTGTAAAGG - Intergenic
1059169074 9:112107934-112107956 GGTAGAGTGTTTGCCTGTAAGGG - Intronic
1061972926 9:134054471-134054493 GGCCCCGTGTCTACCTGTAAAGG + Intronic
1062425218 9:136503139-136503161 GGAACAGGCTCTGCCTGCAGGGG - Intronic
1062490693 9:136803549-136803571 AGGACAGGGTCTGCCTGTCCCGG - Intronic
1185650181 X:1642001-1642023 GGCACAGCCTCTGTGTGTAATGG + Intronic
1187081287 X:15991049-15991071 GGGACAGGGTTTGCCTGGGAAGG - Intergenic
1187278395 X:17836797-17836819 GTCACAGGGTCTGCCTTTGGGGG - Intronic
1187865333 X:23718525-23718547 GGCACAGGACCTGCCTTTTAGGG - Intronic
1200713507 Y:6511191-6511213 GGCCCAGAGTCTGACTGTATTGG - Intergenic
1201020421 Y:9650850-9650872 GGCCCAGAGTCTGACTGTATTGG + Intergenic
1201148494 Y:11080956-11080978 GGCACAGGGTCTGCCTGTAATGG + Intergenic
1201764326 Y:17564613-17564635 GGCGCAGGGTCTGCCGGGAAGGG + Intergenic
1201837227 Y:18341377-18341399 GGCGCAGGGTCTGCCGGGAAGGG - Intergenic