ID: 1084745366

View in Genome Browser
Species Human (GRCh38)
Location 11:71166771-71166793
Sequence AAAGAAGTGTGGGCCCGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1137
Summary {0: 1, 1: 0, 2: 10, 3: 138, 4: 988}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084745366_1084745370 6 Left 1084745366 11:71166771-71166793 CCACACCGGGCCCACACTTCTTT 0: 1
1: 0
2: 10
3: 138
4: 988
Right 1084745370 11:71166800-71166822 TTTTTTTAATTGATCATTCTTGG 0: 282
1: 647
2: 491
3: 536
4: 1710
1084745366_1084745374 24 Left 1084745366 11:71166771-71166793 CCACACCGGGCCCACACTTCTTT 0: 1
1: 0
2: 10
3: 138
4: 988
Right 1084745374 11:71166818-71166840 CTTGGGTGTTTCTCGCAGAGGGG 0: 953
1: 1179
2: 367
3: 222
4: 191
1084745366_1084745372 22 Left 1084745366 11:71166771-71166793 CCACACCGGGCCCACACTTCTTT 0: 1
1: 0
2: 10
3: 138
4: 988
Right 1084745372 11:71166816-71166838 TTCTTGGGTGTTTCTCGCAGAGG 0: 970
1: 1150
2: 357
3: 202
4: 194
1084745366_1084745371 7 Left 1084745366 11:71166771-71166793 CCACACCGGGCCCACACTTCTTT 0: 1
1: 0
2: 10
3: 138
4: 988
Right 1084745371 11:71166801-71166823 TTTTTTAATTGATCATTCTTGGG 0: 291
1: 733
2: 692
3: 239
4: 1620
1084745366_1084745375 25 Left 1084745366 11:71166771-71166793 CCACACCGGGCCCACACTTCTTT 0: 1
1: 0
2: 10
3: 138
4: 988
Right 1084745375 11:71166819-71166841 TTGGGTGTTTCTCGCAGAGGGGG 0: 938
1: 1178
2: 443
3: 215
4: 206
1084745366_1084745373 23 Left 1084745366 11:71166771-71166793 CCACACCGGGCCCACACTTCTTT 0: 1
1: 0
2: 10
3: 138
4: 988
Right 1084745373 11:71166817-71166839 TCTTGGGTGTTTCTCGCAGAGGG 0: 976
1: 1149
2: 361
3: 194
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084745366 Original CRISPR AAAGAAGTGTGGGCCCGGTG TGG (reversed) Intronic
900248901 1:1655631-1655653 AAAGAACTTTTGGCCGGGTGTGG + Intronic
900265494 1:1755107-1755129 ACAGAAGTGTCGGCCGGGCGCGG - Intronic
900946912 1:5836091-5836113 AAACAGGAGTGGGCCGGGTGCGG - Intergenic
901206001 1:7496251-7496273 AAAGAAGTGTGTGGCTGTTGTGG + Intronic
901304652 1:8223873-8223895 AAAGAAGTATGGGCCTGGAGGGG - Intergenic
901376345 1:8842361-8842383 AAAAAAGTCTTGGCCGGGTGTGG - Intergenic
901382221 1:8882050-8882072 AAAGAAATGGAGGCCGGGTGCGG + Intergenic
901466460 1:9424647-9424669 AAAGAACTGGAGGCCAGGTGTGG + Intergenic
901522544 1:9796384-9796406 AAAGATGGGTGGGCCAGGCGCGG + Intronic
901527413 1:9832453-9832475 AAAAAAGTCTAGGCCAGGTGTGG + Intergenic
901580746 1:10240852-10240874 TAAGAAATGAGGGCCAGGTGTGG - Intronic
901694474 1:10996520-10996542 AAATGAGCGTGGGCCCAGTGCGG + Intergenic
901806622 1:11742818-11742840 AAAGAACTGTGGGCCAGGTCTGG - Intronic
901832698 1:11902928-11902950 AAAAAAGTGTGTGCCAGGCGTGG + Intergenic
902270518 1:15301118-15301140 AAAAAAGTAGGGGCCGGGTGCGG - Intronic
903329734 1:22591097-22591119 ATAGAAGTGAGGGCTGGGTGTGG + Intronic
903632981 1:24790876-24790898 AAAGTAGTATGGGCCGGGCGTGG + Intronic
903817289 1:26073605-26073627 AAAGAAGCGTGGGCCAGGCACGG - Intergenic
903954174 1:27013361-27013383 AAACAACTCTGGGCCCGGCGCGG + Intergenic
903977629 1:27161461-27161483 AAAGCAGTGTGGGCCTGGAATGG - Intronic
904085065 1:27900400-27900422 AAAGAGCTGTTGGCCAGGTGCGG - Intronic
904108907 1:28109569-28109591 AAAGAAGTACTGGCCAGGTGTGG - Intergenic
904249742 1:29214649-29214671 AAAGAAGTTGGGGCCAGGCGTGG - Intronic
904691268 1:32294802-32294824 AAAAAAGTTGGGGCCGGGTGCGG - Intronic
904740944 1:32675477-32675499 AAAGAAGGATGGGCCAGGTGCGG + Intronic
905163330 1:36057028-36057050 AAAGAATAGTAGGCCGGGTGCGG - Exonic
905256026 1:36685222-36685244 AAAAATGTTTGGGCCGGGTGTGG - Intergenic
905415923 1:37804179-37804201 GAAGGAGTGTGGGCCAGGTTTGG - Intronic
905593653 1:39186898-39186920 ACAGAAATGTGGCCCAGGTGTGG - Intronic
905600670 1:39247740-39247762 TTAAAAGTGTGGGCCGGGTGTGG + Intronic
906165650 1:43684212-43684234 AAAGAAGAGGTGGCCGGGTGTGG + Intronic
906181687 1:43825973-43825995 AAAGAATAATGGGCCGGGTGAGG + Intronic
906193888 1:43916867-43916889 TAAGAATTTTGGGCCAGGTGCGG - Intronic
906487944 1:46246248-46246270 AAAGAATTCTGGGCCGGGCGCGG - Intergenic
906548278 1:46638326-46638348 AAAGAAGTTTGGGCCAGGCGTGG + Intronic
907090926 1:51724572-51724594 CAAGAAGAGTGGGCCAGGCGTGG - Intronic
907311696 1:53542506-53542528 AGGGAAGTGTGGGGCGGGTGGGG + Intronic
907368803 1:53984334-53984356 AAAGAACTCTTGGCCGGGTGCGG + Intergenic
907446126 1:54508905-54508927 AAAGAGGTGTGAGCCAGGCGTGG - Intergenic
907593497 1:55698524-55698546 AAAGAAGTTTGGACCAGGTTAGG + Intergenic
907829480 1:58050817-58050839 AAAGCAATGAGGGCCGGGTGCGG - Intronic
907918066 1:58888745-58888767 AAAGGGGTGTGGGCCGGGCGCGG - Intergenic
908186846 1:61660689-61660711 AAAGAGGTTTAGGCCGGGTGCGG + Intergenic
908203394 1:61820630-61820652 AAATAAATGTAGGCCGGGTGTGG - Intronic
908519976 1:64932122-64932144 TAAGAAATCTGGGCCAGGTGTGG + Intronic
909958397 1:81803750-81803772 AAAGAATTGAGGGCGGGGTGGGG - Intronic
910179175 1:84462716-84462738 AAAGAAATGTGGGCCAGGCGCGG - Intergenic
910867612 1:91802649-91802671 AAAGAAGTATGGGCCAGGCATGG - Intronic
911200218 1:95036715-95036737 AAAGAAGCTTGGGCCAGGCGCGG - Intronic
911610838 1:99957820-99957842 AAAGATGAATGGGCCAGGTGTGG - Intergenic
912145995 1:106795186-106795208 AAATAAATGTAGGCCGGGTGTGG + Intergenic
912264288 1:108139900-108139922 AAAAAACTCTGGGCCTGGTGTGG - Intronic
912308195 1:108592847-108592869 TAAGAAGTTTGGGCTGGGTGTGG + Intronic
912403628 1:109417931-109417953 AAAGAAATGTGGGCCAGGAGTGG + Intronic
912792666 1:112667993-112668015 TGAGAAGTGTGGGCCGGGAGTGG + Intronic
913694232 1:121308646-121308668 AAAAAAGTATGGGCCGGGTGCGG + Intronic
913712249 1:121496888-121496910 AAAGCAGTTTAGGCCGGGTGCGG - Intergenic
914143332 1:144971419-144971441 AAAAAAGTATGGGCCGGGTGCGG - Intronic
914922189 1:151854680-151854702 GAAGAGGTGTTGGCCGGGTGCGG - Intergenic
915329447 1:155100988-155101010 AAAGAAATATGGGCCGGGTGTGG - Intergenic
915707945 1:157864232-157864254 TAAGAACTGTGGGCCTGGTGAGG - Intronic
916395938 1:164387257-164387279 CAGGAATTGTGGGCCTGGTGTGG - Intergenic
916680332 1:167098297-167098319 AAAAAAGTTTGGGCCGGGCGTGG - Intronic
916695106 1:167227074-167227096 AAAGAAATCTGGGCCAGGTGTGG - Intronic
916735552 1:167603939-167603961 TAAGAAGTCTGGGCCAGGCGTGG - Intergenic
916867727 1:168878374-168878396 ATAAAAGTGTTGGCCAGGTGTGG - Intergenic
917521740 1:175753473-175753495 AAAGAAAGGTGGGGCAGGTGGGG - Intergenic
917740274 1:177955203-177955225 AGAGAAATGCAGGCCCGGTGCGG + Intronic
917766743 1:178228289-178228311 AAAAAATTGTGGGCCGGGTGCGG + Intronic
917857961 1:179117123-179117145 ACAGAAGTATAGGCCTGGTGTGG - Intronic
917866468 1:179200335-179200357 AAAGCATTGTGGGCCAGGCGCGG - Intronic
918187917 1:182144095-182144117 GGAGAAGTGGGGGCACGGTGAGG - Intergenic
918304820 1:183236231-183236253 AAAAAAGGGGGGGCCAGGTGTGG + Intronic
918503348 1:185223469-185223491 AGAAAAGTGTTGGCCAGGTGCGG - Intronic
919089845 1:192964952-192964974 AAAGAATTTTAGGCCTGGTGTGG + Intergenic
919253617 1:195094025-195094047 TAAGCAGTCTGGGCCAGGTGTGG + Intergenic
919523315 1:198616139-198616161 AAAGAAATGTAGGCCAGTTGTGG - Intergenic
920002702 1:202810823-202810845 AAAGAAGGGCCGGCGCGGTGTGG - Intergenic
920109111 1:203574681-203574703 AAAGACTTGGGGGCCGGGTGTGG - Intergenic
920139572 1:203798388-203798410 AAAGAAGTGTGAGCCGGGGTAGG + Exonic
920481559 1:206327034-206327056 AAAAAAGTATGGGCCGGGTGCGG + Intronic
920642052 1:207762559-207762581 AAAGAAGTGGTGGCCAGGCGCGG + Intronic
920780613 1:208987558-208987580 AAGGAAATGTGGGCCGGGTGCGG - Intergenic
921140863 1:212305019-212305041 AAAAAATTGGGGGCCGGGTGTGG - Intronic
921388776 1:214598639-214598661 AAGTAAGTGGGGGCCGGGTGTGG - Intergenic
921586336 1:216950101-216950123 AAAGAAGTAAGGGCTGGGTGTGG - Intronic
921862500 1:220054446-220054468 AAATCACTTTGGGCCCGGTGTGG + Intergenic
922075938 1:222244635-222244657 ATAGTAGGGTGGGCCGGGTGCGG + Intergenic
922515181 1:226202374-226202396 ATACAAGTATGGGCCAGGTGCGG - Intergenic
922577956 1:226675551-226675573 AAAGAACGCTGGGCCCAGTGAGG + Intronic
922884711 1:229009323-229009345 AAATAAGACTGGGCCAGGTGTGG + Intergenic
923156870 1:231286853-231286875 AAAGTAGTATTGGCCAGGTGCGG + Intergenic
923224063 1:231922985-231923007 AAAGAAGTCTGAGCCAGGCGTGG + Intronic
923316232 1:232783061-232783083 AAAGAAGACTTGGCCAGGTGCGG - Intergenic
923364239 1:233244117-233244139 AATTAAATGTGGGCCTGGTGTGG - Intronic
923503956 1:234589762-234589784 AAAGAAGGGTGTTCCCTGTGTGG - Intergenic
923685706 1:236152014-236152036 AAATGAGTGTGGGCCTGATGGGG - Intronic
924263828 1:242260056-242260078 AGAGAATTGTTGGCCAGGTGGGG + Intronic
924508110 1:244704946-244704968 AAAAAAGTGTGGGCCAGGCGCGG - Intronic
924534949 1:244927594-244927616 AAAGCACTGTGGGCCAGGTGCGG - Intergenic
1063387339 10:5624311-5624333 AAAGAAGTGGGGGCTGGGCGTGG - Intergenic
1063809861 10:9692539-9692561 TTAGAAGTCTGGGCCAGGTGCGG - Intergenic
1064000957 10:11663380-11663402 AAAAAAGTCTGGGCCGGGCGTGG - Intergenic
1064102522 10:12476000-12476022 AGAGAAGTCTAGGCCGGGTGGGG + Intronic
1064269674 10:13853539-13853561 AAAAAAGTGGGGGCCAGGTGTGG + Intronic
1064532413 10:16323783-16323805 AAAGAGGTTTAGGCCAGGTGTGG + Intergenic
1064572123 10:16704618-16704640 ACAGAATTCTGGGCCCTGTGAGG - Intronic
1064773404 10:18749042-18749064 AAAGAATTTTGGGCCAGGTGTGG - Intergenic
1065390380 10:25175971-25175993 GAAGACCTGTGGGGCCGGTGCGG - Exonic
1065523868 10:26597835-26597857 ATAGAAGTGGAGGCCAGGTGCGG + Intergenic
1065765020 10:29020942-29020964 AAAAAAGAATGGGCCAGGTGCGG + Intergenic
1065930042 10:30471324-30471346 AAAGGAGTTTGGGCCGGGCGCGG - Intergenic
1065951928 10:30660076-30660098 AAAGAAACTTGGGCCAGGTGTGG + Intergenic
1066382594 10:34913850-34913872 AAAGAAATGCAGGCCAGGTGTGG + Intergenic
1066396639 10:35030671-35030693 AAAGTAGTGTTGGCCAGGTGTGG - Intronic
1066414985 10:35213557-35213579 AAAGAAATTTAGGCCGGGTGCGG - Intergenic
1066589929 10:36983829-36983851 AAATATTTGTGGGCCAGGTGCGG + Intergenic
1066720970 10:38338416-38338438 AGAGAATTGTTGGCCAGGTGGGG - Intergenic
1067410272 10:46058389-46058411 AAAGCAGTGTTGGCCCGGCGCGG - Intergenic
1068104478 10:52596845-52596867 ACAGAAATGTTGGCCAGGTGCGG + Intergenic
1068299706 10:55122388-55122410 AGAGAAGTGTGGGCAAGATGGGG + Intronic
1068814773 10:61296867-61296889 AATGAAGTTTGGGCTGGGTGTGG + Intergenic
1068964385 10:62896866-62896888 AAAGAAGAGTGTTCCAGGTGGGG - Intronic
1068972062 10:62969458-62969480 AAAGAAAGATGGGCCGGGTGTGG + Intergenic
1069369897 10:67736738-67736760 TAAAAAATGTGGGCCGGGTGTGG - Intergenic
1069398879 10:68020474-68020496 AAAAAAGTTTGGGCCGGGCGCGG + Intronic
1069422288 10:68257751-68257773 AAATCAGAGTGGGCCAGGTGTGG + Intergenic
1069504507 10:68985943-68985965 AAAGAAATATTGGCCAGGTGTGG - Intergenic
1069505719 10:68996268-68996290 AAATAAAGGTGGGCCGGGTGTGG + Intronic
1069759751 10:70800614-70800636 AAAGAACCCTGGGCCAGGTGTGG + Intergenic
1069975630 10:72210448-72210470 AAAGAGGTTTCGGCCAGGTGCGG - Intronic
1070000402 10:72372076-72372098 AAATAAATGTAGGCCAGGTGTGG + Intronic
1070029354 10:72662114-72662136 AGAGCAGTGTAGGCCAGGTGCGG - Intergenic
1070292656 10:75129526-75129548 AAAGAAGTCCAGGCCGGGTGCGG - Intronic
1070360176 10:75680717-75680739 AAAGAAGTCTTGGCTGGGTGCGG + Intronic
1070617320 10:77978950-77978972 AAACAAGCGTGGGCCGGGCGCGG - Intronic
1070830302 10:79414018-79414040 AAAGAAGTGAGAGCTCCGTGGGG + Intronic
1070914892 10:80146946-80146968 AATAAAATGTGGGCCAGGTGTGG - Intergenic
1072250440 10:93578124-93578146 AAAGAAGAGCAGGCCAGGTGTGG + Intronic
1072461492 10:95622825-95622847 AAAAAATTCTGGGCCGGGTGCGG - Intronic
1072919071 10:99560195-99560217 AAATAACTGTGGGGCCGGCGTGG - Intergenic
1073034547 10:100554344-100554366 ATATAAGTGTTGGCCAGGTGTGG + Exonic
1073154481 10:101335631-101335653 AAAGAATTTTGGGCCAGGTGTGG + Intergenic
1073253617 10:102137046-102137068 AAATAAGTGTCGGCCGGGCGTGG + Intronic
1073334598 10:102696552-102696574 AAAAAACTGTTGGCCGGGTGCGG - Intronic
1073386935 10:103133549-103133571 AAAGAGGTTTAGGCCAGGTGTGG - Intronic
1073417612 10:103397065-103397087 AAAGAAGTGATGACCGGGTGGGG - Intronic
1073503689 10:103966126-103966148 TGAGAAGTGGGGGCCCGGCGCGG + Intergenic
1074002165 10:109384138-109384160 AAAGGATTGTGGACCAGGTGTGG - Intergenic
1074024136 10:109616103-109616125 TAAGAAGTGTGGGCCAGGTGTGG - Intergenic
1074110890 10:110422167-110422189 TAAGAAGTGAGTGCCAGGTGCGG + Intergenic
1074443752 10:113501016-113501038 AAAAAAGTTTGGGCCAGGCGTGG + Intergenic
1074538989 10:114349431-114349453 AAAGAAGACTGAGCCAGGTGTGG + Intronic
1075149442 10:119913780-119913802 AAAGTTTTGTGGGCCGGGTGTGG - Intronic
1075228432 10:120650370-120650392 AATTAAATGTGGGCCGGGTGCGG + Intergenic
1075315070 10:121446747-121446769 AAAGAATAGTGGGCCGGGTGTGG + Intergenic
1075372070 10:121945693-121945715 AAACAAATGTGGGCCAGGCGTGG - Intergenic
1075382981 10:122033859-122033881 AAAAAAGAGTGGGCCAAGTGCGG + Intronic
1076083590 10:127605816-127605838 TAAGAATTGTGGGCCGGGTGCGG + Intergenic
1076259341 10:129053343-129053365 AAAAAATTTTGGGCCGGGTGCGG - Intergenic
1076755576 10:132569792-132569814 AAAACAGTGGGGGCCCAGTGCGG - Intronic
1076755604 10:132569940-132569962 AAAACAGTGGGGGCCCAGTGCGG - Intronic
1076771287 10:132666646-132666668 AAAGATGTTTCGGCTCGGTGTGG - Intronic
1077093781 11:790908-790930 AAAGGAGGGTGGGCCCTGAGAGG + Exonic
1077111628 11:864572-864594 GGAGCACTGTGGGCCCGGTGTGG + Intronic
1078138539 11:8672919-8672941 AAAAGAGTATGGGCCAGGTGTGG - Intergenic
1078173783 11:8952699-8952721 AAAAATCTGTGGGCCAGGTGTGG - Intronic
1078641979 11:13105229-13105251 AAAGACGTGTGTGCATGGTGTGG - Intergenic
1078736236 11:14023711-14023733 AAAAAAGACTGGGCCAGGTGCGG + Intronic
1078738857 11:14047947-14047969 TAATAAGGGTGGGCCAGGTGTGG + Intronic
1078924429 11:15861205-15861227 AGAGAGGTTTGGGCCAGGTGTGG - Intergenic
1079054928 11:17197308-17197330 AATGGAGTGGGGGCCAGGTGCGG - Intronic
1079202572 11:18388140-18388162 AAACAAGTGTTGGCCGGGCGCGG + Intergenic
1079217161 11:18524080-18524102 AGAAAACTGTGGGCCTGGTGTGG - Intronic
1079246626 11:18756990-18757012 AATGATGTGTGGGACAGGTGGGG - Intronic
1080295743 11:30725126-30725148 AAAGAAGCCTAGGCCGGGTGTGG + Intergenic
1080812696 11:35721192-35721214 AAAGAATTATAGGCCAGGTGTGG - Intronic
1081943346 11:46964573-46964595 AAAGCACTGTGGGCCAGGCGCGG - Intronic
1082077544 11:47985989-47986011 AAAAATGTCTGGGCCAGGTGCGG - Intronic
1083319343 11:61835680-61835702 AAAGAAGAGGGGGCCGGGTGCGG - Intronic
1083423293 11:62568522-62568544 AAAGAAATGGAGGCCAGGTGTGG - Intronic
1083481773 11:62953040-62953062 AAAGAAATGGGGGCCGGGTGTGG - Intronic
1083676285 11:64327063-64327085 AAAGAAGTGAAGGCCAGGCGTGG + Intergenic
1083905241 11:65664831-65664853 ACAGAATTCTGGGCCAGGTGTGG - Intergenic
1084121183 11:67069979-67070001 AAACAAATCTGGGCCAGGTGTGG - Intronic
1084132385 11:67146281-67146303 AAAGAAATGGGGGCCAGGTGCGG - Intronic
1084184777 11:67465633-67465655 CAAAAAGGGTGGGCCAGGTGTGG + Intronic
1084491117 11:69478962-69478984 AAACAAGTGTGGGCCAGGTGCGG + Intergenic
1084637694 11:70403475-70403497 AAAGAACTCTTGGCCAGGTGAGG - Intronic
1084745366 11:71166771-71166793 AAAGAAGTGTGGGCCCGGTGTGG - Intronic
1084864392 11:72043654-72043676 AGACAACTGTGGGCCAGGTGTGG - Intronic
1085604546 11:77885365-77885387 AAATAAGGGTAGGCCAGGTGTGG - Intronic
1086618982 11:88861771-88861793 TTAGAACTGTGGGCCAGGTGTGG - Intronic
1087055265 11:93929222-93929244 AAAACAGTATGGGCCGGGTGCGG - Intergenic
1087391115 11:97536675-97536697 AAAGAATTTTTGGCCAGGTGTGG - Intergenic
1087406967 11:97742700-97742722 AAAGATATGTTGGCCGGGTGCGG - Intergenic
1087544284 11:99564376-99564398 ACAGAATTGTTGGCCAGGTGTGG - Intronic
1087775633 11:102254114-102254136 AAAAAAATCTGGGCCAGGTGCGG - Intergenic
1088214880 11:107496786-107496808 AAAGAAATAAGGGCCAGGTGAGG - Intergenic
1088635690 11:111818067-111818089 ATAGAAGTGAGGGCCAGGTGTGG - Intronic
1088686386 11:112287607-112287629 AAATAAATGTTGGCCGGGTGCGG + Intergenic
1089051734 11:115551334-115551356 AGAGAGGTCTGGGCCAGGTGTGG - Intergenic
1089514109 11:119020684-119020706 AAAGAACTGTGGGTCGGGTGTGG - Intronic
1090127374 11:124101497-124101519 AAAAAAATGTAGGCCAGGTGTGG + Intergenic
1090802741 11:130183248-130183270 TAAGAAATGTAGGCCGGGTGTGG - Intronic
1091751086 12:3021599-3021621 AAAGAAGTCTGAGCCGGGTGCGG - Intronic
1092524756 12:9302801-9302823 TAAGAAGGGTCGGCCGGGTGTGG + Intergenic
1092542508 12:9429010-9429032 TAAGAAGGGTCGGCCAGGTGTGG - Intergenic
1092797191 12:12124081-12124103 AAAAAAGTATAGGCCAGGTGTGG + Intronic
1093029248 12:14272892-14272914 AATGAAGTCAGGGCCGGGTGCGG - Intergenic
1093439651 12:19179364-19179386 AATGAAGTGTTGGCCGGGCGTGG + Intronic
1093472389 12:19516734-19516756 AAAGCCGTCTTGGCCCGGTGAGG + Intronic
1093716773 12:22391789-22391811 AATGAAGTCTGGGCCGGGCGCGG + Intronic
1093729325 12:22549644-22549666 AAAGCAGTGTGGGCTGGCTGTGG - Intergenic
1094224592 12:28030848-28030870 AGAGAAGTGTTGGCCAGGCGCGG + Intergenic
1094410036 12:30158097-30158119 AAAGCAGTGTGGGCCGGGCGCGG - Intergenic
1094507940 12:31077555-31077577 AAGGACGTGTAGGCCGGGTGCGG + Intronic
1094510503 12:31093423-31093445 TAAGAAGGGTCGGCCGGGTGCGG + Intronic
1094531848 12:31283310-31283332 ATACATGTGTGGGCCGGGTGTGG + Intronic
1094553599 12:31475831-31475853 GAGGAGGTGTGGGCCGGGTGCGG + Intronic
1094611775 12:32001659-32001681 AGAGCTGTGTGGGCCGGGTGCGG - Intergenic
1094708894 12:32941511-32941533 AAAGAATTATGGGCCGGGTGCGG - Intergenic
1095129531 12:38522913-38522935 AAAATAGTGAGGGCCAGGTGTGG + Intergenic
1095460016 12:42433610-42433632 AATACAGTGTGGGCCGGGTGCGG - Intronic
1095567851 12:43647367-43647389 AAAAAAGGCTGGGCCGGGTGCGG - Intergenic
1096072966 12:48786042-48786064 AGAGGAGTGTGGCCCTGGTGGGG - Intronic
1096166703 12:49431536-49431558 AAAGTTCTTTGGGCCCGGTGCGG - Intronic
1096330146 12:50704672-50704694 AAAACAGTTTGGGCCGGGTGTGG + Intronic
1096523330 12:52196366-52196388 AAAAAAGGGGGGGCCAGGTGCGG - Intergenic
1096704232 12:53408614-53408636 AAAGAAGGCTTGGCCGGGTGCGG + Intronic
1096708224 12:53436521-53436543 AAAAAAGTATTGGCCGGGTGCGG - Intergenic
1096905906 12:54935163-54935185 TAAGAAATGTGGGCCGGGCGTGG - Intergenic
1097229863 12:57503828-57503850 AAACAAGTGTGGGCCGGGCGCGG - Intronic
1097511515 12:60547920-60547942 AAAAAATTGGGGGCCGGGTGTGG + Intergenic
1098321117 12:69244512-69244534 AAAAAAGTTTAGGCCCAGTGTGG - Intronic
1098321229 12:69245793-69245815 ATGGAAGTGTAGGCCAGGTGCGG + Intronic
1098340415 12:69445064-69445086 AAGGAACTGTGGGCCGGGCGCGG - Intergenic
1099275590 12:80571426-80571448 AAAGAATTGTAGGCTGGGTGTGG - Intronic
1099979229 12:89579581-89579603 AAAGAACTTTTGGCCGGGTGCGG - Intergenic
1100451692 12:94712710-94712732 AAAGAGGAGGGGGCCAGGTGCGG - Intergenic
1100893360 12:99151235-99151257 AAACAATTGGGGGCCAGGTGTGG + Intronic
1101080728 12:101180842-101180864 AAAGAAGTTTGGGCTGAGTGTGG - Intronic
1101115087 12:101523942-101523964 AAAGAAGTTTGGGCCCGCTGTGG - Intergenic
1101689271 12:107060698-107060720 AAAAAAATTTGGGCCGGGTGTGG + Intronic
1101701445 12:107178093-107178115 AAAGAAGTAGGGGTCCAGTGTGG - Intergenic
1101868448 12:108541826-108541848 AAAAAAGTCTGGGCCGGGCGGGG - Intronic
1101903781 12:108810707-108810729 GAAGGTGTGTGGGCACGGTGAGG - Intronic
1102195542 12:111022690-111022712 AAGGAAGTGTAGGCCTGCTGGGG + Intergenic
1102299868 12:111763468-111763490 AAAGAGGTTTAGGCCAGGTGCGG + Intronic
1102311639 12:111849550-111849572 AAAGAACTCTAGGCCAGGTGCGG - Intronic
1102329324 12:112015195-112015217 AAAAAAGTGTGGGCTGGGTGCGG + Intronic
1102356875 12:112244659-112244681 TAAGAAATTTGGGCCAGGTGTGG - Intronic
1102447139 12:113011854-113011876 AAAGAAGGGTGGACTTGGTGAGG + Intergenic
1102577117 12:113862861-113862883 ACCGAAGTGTGAGCCTGGTGGGG - Intronic
1102665663 12:114570641-114570663 AAACCAGTGTTGGCCAGGTGTGG + Intergenic
1102874806 12:116441300-116441322 AAGGAAGTCAGGGCCAGGTGCGG - Intergenic
1103291134 12:119847272-119847294 GAAGAAGTTCGGGCCAGGTGTGG - Intronic
1103319640 12:120084290-120084312 ATAAAAGTGTTGGCCGGGTGTGG - Intronic
1103355046 12:120313637-120313659 AAAAAAGTTTTGGCCGGGTGTGG - Intergenic
1103659454 12:122501948-122501970 AAAGAAATGTGGGCCGGGGGCGG + Intergenic
1103662552 12:122532921-122532943 AACTATGTGTGAGCCCGGTGTGG + Intronic
1103671472 12:122619700-122619722 AAACAAGTGTTGGCCGGGCGCGG - Intronic
1104886487 12:132112285-132112307 AAAGAAAAGTGGGCTGGGTGCGG + Intronic
1105238101 13:18580141-18580163 AAAGAATTGTAGGCCGGGCGCGG - Intergenic
1105374135 13:19828181-19828203 GCAGAGGTGTGGGCCAGGTGCGG + Intronic
1105744398 13:23363197-23363219 AAATAAATGTAGGCCAGGTGCGG - Intronic
1106621685 13:31376743-31376765 AAAGAAGGGTGCTCCGGGTGAGG + Intergenic
1107081736 13:36382058-36382080 AAAGAAATGCTGGCCCGGCGTGG - Intergenic
1107530761 13:41280223-41280245 AAAGGATTGTGGGCCGGGCGCGG - Intergenic
1107843332 13:44483369-44483391 CAAGAATTATGGGCCGGGTGCGG + Intronic
1107899943 13:45001969-45001991 AAAATGGTGTGGGCCAGGTGTGG - Intronic
1107940093 13:45375705-45375727 AAAGAAATCTGGGCTGGGTGTGG + Intergenic
1108056324 13:46489090-46489112 AACCAACTGTGGGCCGGGTGAGG + Intergenic
1108420102 13:50240065-50240087 AAAAAATAGTGGGCCGGGTGCGG - Intronic
1108518572 13:51224176-51224198 AAAGAATTCTTGGCCAGGTGCGG + Intronic
1108950783 13:56089118-56089140 AAAAAAATGTGGGCCAGGCGCGG + Intergenic
1109123275 13:58485347-58485369 AAAGAACTCTGGGCCGGGCGCGG - Intergenic
1109314629 13:60735586-60735608 TAAGAAGTGTTGGCCGGGCGCGG + Intergenic
1109418012 13:62069792-62069814 TAAGAAATGTGAGCCCGGAGAGG + Intergenic
1110425410 13:75361668-75361690 AAAAAATTGTAGGCCCGGCGCGG - Intronic
1110620762 13:77592853-77592875 TAAGAACTGTGGGCTGGGTGTGG - Intronic
1110814758 13:79848966-79848988 AAAGAATTAAGGGCCGGGTGCGG - Intergenic
1111345488 13:86947490-86947512 AAAGACAAGTGGGCCGGGTGCGG - Intergenic
1111457153 13:88499733-88499755 AAAGAAGGTGGGGCCGGGTGCGG + Intergenic
1111819874 13:93199591-93199613 ATTTAAGTGTGGGCCAGGTGTGG + Intergenic
1112039783 13:95535369-95535391 AGAGTAGTGTGGGCCTGGAGAGG + Intronic
1112800357 13:103103325-103103347 AAGGAAATCTGGGCCGGGTGCGG + Intergenic
1113168211 13:107467748-107467770 CAAGAAGTATTGGCCGGGTGCGG + Intronic
1113192863 13:107770201-107770223 AAACAAAAGTGGGCCCGGCGCGG - Intronic
1113499489 13:110761874-110761896 AAAGAAGTTTAGTCCAGGTGTGG - Intergenic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114005602 14:18310013-18310035 AAAGAGTTTTGGGCCAGGTGTGG + Intergenic
1114219766 14:20685749-20685771 AAAGTTGTGTGGGCCCGGCACGG + Intronic
1114294933 14:21320579-21320601 AAAAAAGAGTGGGCCGGGCGCGG - Intronic
1114509536 14:23246848-23246870 AAAAAATTGTTGGCCGGGTGTGG + Intronic
1114517938 14:23312168-23312190 AAATAGGTCTGGGCCAGGTGCGG + Intronic
1114843456 14:26292569-26292591 AAAGACATATGGGCCGGGTGTGG - Intergenic
1115618100 14:35115450-35115472 AAAAAAATGTTGGCCAGGTGTGG - Intronic
1115988994 14:39132238-39132260 AAAGAAGTCTGAGCCGGGCGTGG + Intronic
1116051983 14:39815010-39815032 ACAGGAGTGTGGGCCCTGTGAGG + Intergenic
1116160019 14:41256424-41256446 GAAGAAGTGTGAGCCAAGTGTGG + Intergenic
1116819448 14:49613514-49613536 AAAAAAGTTTAGGCCAGGTGCGG + Intronic
1116823594 14:49649434-49649456 AAAGAAATATAGGCCGGGTGTGG - Intronic
1116911125 14:50465785-50465807 AAAGAACACTGGGCCGGGTGAGG + Intronic
1117321141 14:54624261-54624283 AAATAAGAGTGGGCCGGGCGCGG - Intronic
1117396971 14:55320459-55320481 AAATAAGTTTTGGCCAGGTGTGG + Intronic
1117477409 14:56110518-56110540 AAAGAAGGAGGGGCCGGGTGCGG + Intergenic
1117733670 14:58748685-58748707 AAAGAAGTTGAGGCCAGGTGCGG - Intergenic
1118027155 14:61781157-61781179 TAAGAATTGTTGGCCGGGTGCGG + Intronic
1118454518 14:65932303-65932325 AAGGAAATGTGGGCCGGGTATGG + Intergenic
1118636296 14:67751534-67751556 AAAGAAGAGTCAGCCGGGTGTGG - Intronic
1118750288 14:68802579-68802601 GAAAAGGTGTTGGCCCGGTGTGG + Intergenic
1118758407 14:68862358-68862380 AAAGATATGTGGGCCGGGCGTGG - Intergenic
1118805600 14:69234055-69234077 AAAGTACTGTGGGCCAGGTATGG - Intronic
1118867575 14:69715550-69715572 AAAGAAGTCTTGGCCAGGCGCGG + Intergenic
1119276026 14:73357110-73357132 TAAAAAGTGTTGGCCGGGTGTGG + Intronic
1119656735 14:76422499-76422521 AAGGAAATGTCGGCCGGGTGTGG - Intronic
1119815212 14:77560295-77560317 AAAAAAATGTGGGCCAGGCGTGG + Intronic
1120065377 14:80034377-80034399 AAAAAACTGTGGGCCGGGCGCGG + Intergenic
1120360810 14:83499526-83499548 ACATAAGTGTGGGCCAGGTGTGG - Intergenic
1120653255 14:87159944-87159966 AAAGAAATGTGGGCCGGGCGCGG - Intergenic
1120998755 14:90436442-90436464 AAAAAAGTCTGGGCCGGGCGCGG + Intergenic
1121198420 14:92096332-92096354 AAAGAAATGTAAGCCGGGTGTGG + Intronic
1121388717 14:93555692-93555714 AAAGAAATCTTGGCCAGGTGTGG - Intronic
1121419314 14:93801382-93801404 AAGGAAGTCTGGGGCTGGTGGGG + Intergenic
1121543431 14:94745765-94745787 AAAAAAGGGGGGGCCGGGTGTGG + Intergenic
1121686202 14:95837115-95837137 AACGCAGTGTGGGCCCGGCGCGG + Intergenic
1121758899 14:96426953-96426975 AAAGAGGTTTAGGCCGGGTGTGG + Intronic
1122204685 14:100142662-100142684 AAACAAGGGTGGGCCGGCTGGGG - Intronic
1122676669 14:103420519-103420541 AAAAAAGTGTTGGCCAGGTGTGG - Intronic
1123013598 14:105362126-105362148 AAAAAAGAATGGGCCAGGTGTGG + Intronic
1123101123 14:105801820-105801842 AAAGCATTCTGGGCCCGGTGGGG + Intergenic
1123415453 15:20091653-20091675 AAGCAGGTGTGGGCCGGGTGCGG + Intergenic
1123524792 15:21098767-21098789 AAGCAGGTGTGGGCCGGGTGCGG + Intergenic
1123762377 15:23442833-23442855 AAACAAGTGAGAGCCAGGTGTGG - Intronic
1123914288 15:25006344-25006366 ATAGAGGTGTGGGCCAGGTGTGG - Intergenic
1124000975 15:25759513-25759535 AGAAAACTGTGGGCCAGGTGTGG + Intronic
1124073755 15:26421612-26421634 AAATAGGTGAGGGGCCGGTGTGG - Intergenic
1124454032 15:29823795-29823817 TAAGAATTGTGGGCCAGGCGTGG + Intronic
1125890517 15:43262164-43262186 AAAGAAGGGTGGGCCAACTGAGG - Intronic
1126120043 15:45243269-45243291 ATAGAACTCTGGGCCAGGTGTGG + Intergenic
1127379987 15:58422473-58422495 AAAGAAATGTTGGCCAGGTGTGG - Intronic
1127767234 15:62198181-62198203 AACTAAGAGTGGGCCAGGTGTGG - Intergenic
1127780054 15:62304857-62304879 AAAGAACTGTTGGCCAGGTGCGG + Intergenic
1127904199 15:63364181-63364203 AAAAAAGTGGGGGGGCGGTGAGG + Intronic
1128015684 15:64343288-64343310 AAAGCAGTGTGTGCTAGGTGGGG - Intronic
1128404257 15:67318934-67318956 AAAGAAATTAGGGCCGGGTGTGG + Intronic
1128871394 15:71158441-71158463 AAACAAGTGTTGGCCAGGCGCGG - Intronic
1128954383 15:71924628-71924650 AAAAAAATGTGGGCCAGGCGTGG + Intronic
1129084249 15:73071804-73071826 AAACAAAAGTGGGCCAGGTGTGG - Intronic
1129787850 15:78321147-78321169 GAAGAGGTGTGGGTCCCGTGAGG + Intergenic
1129811749 15:78516727-78516749 AAAGAGGTTTAGGCCAGGTGTGG + Intronic
1130249367 15:82287185-82287207 AAAGAAGTCTTGGCCAGGTGTGG - Intergenic
1130450703 15:84049025-84049047 AAAGAAGTCTTGGCCACGTGCGG + Intergenic
1131034462 15:89212289-89212311 AAAAATGTGTGGGCTGGGTGCGG + Intronic
1131034639 15:89214168-89214190 AAATTAGTTTGGGCCAGGTGCGG + Intronic
1131280475 15:91017230-91017252 AAAACAGTATGGGCCAGGTGTGG + Intronic
1131518715 15:93097458-93097480 AAAAAAGTGGGGGCCGGGCGAGG - Intergenic
1131769470 15:95719188-95719210 AAAGAAGAATGGGCCCAGTGTGG - Intergenic
1132015234 15:98309464-98309486 AAAGAAGAGGAGGCCGGGTGAGG - Intergenic
1132169661 15:99636627-99636649 AAGAAAGTGTAGGCCTGGTGTGG - Intronic
1132233685 15:100203280-100203302 GAAGGGGTGTGGGCCAGGTGCGG + Intronic
1132350352 15:101135842-101135864 AAAGATGTGTGAGTCCGGAGAGG + Intergenic
1132367968 15:101271385-101271407 AAACAAGGGTGGGCCTTGTGAGG - Exonic
1132528578 16:431663-431685 AAAAAGGTCTGGGCCAGGTGCGG - Intronic
1132948263 16:2544873-2544895 AAAAAATTTTGGGCCAGGTGTGG - Intronic
1133316874 16:4890379-4890401 AAAAAAATGAGGGCTCGGTGAGG - Intronic
1133745214 16:8681279-8681301 AAAGAACTCTGGGCCAGGCGAGG - Intronic
1134314727 16:13108123-13108145 AAAGCAGGGTGGGGCCGGAGGGG - Intronic
1135105030 16:19641917-19641939 AAAGAATTCTGGGCCAGGTGCGG + Intronic
1135107971 16:19667441-19667463 AAATAAGTGTTGGCCCAATGCGG + Intronic
1135126732 16:19816572-19816594 AAAGAAGTGTTGGCCAGGCGCGG - Intronic
1135717916 16:24788936-24788958 AAAGAATTTTGGGCCGGGCGTGG - Intronic
1135746318 16:25019834-25019856 ATGGAAGTGTGGGCCGGGCGTGG + Intergenic
1135780274 16:25293919-25293941 AAAAAAGTGTTGGCCGGGCGCGG + Intergenic
1135886702 16:26316642-26316664 ACAGCAATGTGGGCCCAGTGTGG + Intergenic
1135999378 16:27279761-27279783 AAACAATTCTGGGCCAGGTGCGG - Intronic
1136583159 16:31166663-31166685 AAATATGTGTAGGCCAGGTGCGG + Intergenic
1136857830 16:33675060-33675082 AAAAAAAAGTGGGCCAGGTGTGG - Intergenic
1137305205 16:47192067-47192089 AAATAACTGTGGGCTAGGTGTGG - Intronic
1138117033 16:54369068-54369090 AAAAAATTGGGGGCCAGGTGGGG - Intergenic
1138508411 16:57492194-57492216 AACAAGGTGTGGGCCCGGTGTGG + Intergenic
1138927487 16:61610490-61610512 AAAGATGAGTGGGCCAGGCGTGG + Intergenic
1139235769 16:65337329-65337351 AAAGAAATGCAGGCCAGGTGTGG + Intergenic
1139252929 16:65513531-65513553 CAAGTAGTGTGGGCCCTTTGAGG - Intergenic
1139456143 16:67078948-67078970 AAAAAACTGTGGGCCTGGTGCGG - Intronic
1139544044 16:67640727-67640749 AAAAAAGTTGGGGCCGGGTGTGG - Intergenic
1139669530 16:68483051-68483073 AAAGCAGTGGAGGCCAGGTGTGG - Intergenic
1139765337 16:69223918-69223940 GAAGAACTGTCGGCCGGGTGTGG - Intronic
1139798075 16:69499042-69499064 AAAAAAATGTTGGCCAGGTGTGG + Intergenic
1140099871 16:71906605-71906627 AAAGAATTGCGGGCCAGGTCTGG - Intronic
1140243344 16:73225323-73225345 AAAGATTTGAGGGCCTGGTGTGG + Intergenic
1140284728 16:73591401-73591423 AAAGCAGAGGGGGCCGGGTGCGG + Intergenic
1140293091 16:73682493-73682515 AAAGAAAGGTAGGCCGGGTGCGG + Intergenic
1140536671 16:75715986-75716008 ACAGAAATGTGGGCCAGATGTGG - Intronic
1140886510 16:79249127-79249149 AAAGAAGTTGAGGCCGGGTGCGG + Intergenic
1141111230 16:81272406-81272428 AAAGCAGTCTGGGCCGGGCGCGG - Intronic
1141449621 16:84089255-84089277 AAACAGGTGTGGGCCTGGTTTGG - Intronic
1141504990 16:84471027-84471049 AAAGCACTGTTGGCCGGGTGTGG + Intergenic
1142016091 16:87748476-87748498 ACAGAAGCCTGGGCCGGGTGTGG - Intronic
1142168739 16:88608651-88608673 TAGGAAGTGAGGGCCAGGTGTGG - Intronic
1142171679 16:88625707-88625729 AAAGCTTTGTGGGCCAGGTGCGG + Intronic
1142297709 16:89237213-89237235 AACGAAGTGGTGGCCAGGTGCGG + Intergenic
1142301493 16:89261156-89261178 AAAGAAAAGTCGGCCGGGTGCGG + Intergenic
1203119411 16_KI270728v1_random:1523538-1523560 AAAAAAAAGTGGGCCAGGTGTGG - Intergenic
1142551585 17:743881-743903 AAATGAGTTTGGGCCAGGTGCGG - Intergenic
1143182524 17:4992572-4992594 AAACAAGTATAGGCCGGGTGCGG - Intronic
1143474456 17:7194737-7194759 AAAGCAGTTTGGGCCAGGCGTGG + Intronic
1143626558 17:8113734-8113756 AAAGATGTGTGGGCTGGGCGTGG + Intronic
1143805857 17:9426141-9426163 AAAGAACTGGGGGCCAAGTGTGG + Intronic
1143843739 17:9756134-9756156 AAGGAAGTGGTGGCCGGGTGCGG - Intergenic
1144050904 17:11496447-11496469 ATAGAAGTGGGGGCCGGGTACGG + Intronic
1144251930 17:13426224-13426246 AAAGAATTCTGGGCCGGGCGTGG + Intergenic
1144644395 17:16962214-16962236 AAAGAAAGGTAGGCCAGGTGTGG + Intronic
1145036686 17:19545778-19545800 TAAGAATTGTTGGCCAGGTGTGG - Intronic
1145070460 17:19801281-19801303 AAAGAAGTTGGGGCCGGGCGCGG + Intronic
1145074254 17:19838185-19838207 AAAGAAGTGGGGGTGGGGTGGGG - Intronic
1145745868 17:27319238-27319260 TAAGAAGTTTTGGCCAGGTGTGG - Intergenic
1146040977 17:29454105-29454127 AATGAAGTTGGGGCCAGGTGTGG - Intronic
1146074920 17:29719354-29719376 AGAGGAGTTTGGGCCCGGTGTGG + Intronic
1146270527 17:31482300-31482322 AAAAAATTGGGGGCCAGGTGCGG + Intronic
1146377166 17:32302672-32302694 AAAGACTTTTGGGCCAGGTGGGG - Intronic
1146509817 17:33437153-33437175 AAAGAAGTTGGGGCCGGGCGCGG - Intronic
1146696613 17:34913469-34913491 AAGGAAGTGAAGGCCGGGTGTGG + Intergenic
1146701885 17:34968128-34968150 AAAAAAATTTGGGCCGGGTGTGG - Intronic
1146709439 17:35028042-35028064 AAAGAAGCGTTGGCCAGGTGTGG + Intronic
1146724381 17:35145885-35145907 TAAGAAATGTGGGCCAGGCGCGG + Intergenic
1146729033 17:35178188-35178210 AAAGAAGTGCTGGCTGGGTGCGG - Intronic
1146987023 17:37229777-37229799 AAATAAATGTGGGCCAGGCGTGG + Intronic
1147150975 17:38513547-38513569 TAAGACGTGTTGGCCGGGTGTGG - Intergenic
1147171423 17:38621470-38621492 AAGAAAGAGTGGGCCGGGTGCGG - Intergenic
1147276203 17:39318958-39318980 AAAGAATTCTGAGCCGGGTGTGG + Intronic
1147735843 17:42637616-42637638 AAGCAACTGTGGGCCGGGTGTGG + Intergenic
1148191988 17:45685680-45685702 AAAGAACTGAAGGCCAGGTGCGG - Intergenic
1148487280 17:47998662-47998684 AAAGAAGTGTGGGCCAGGCATGG - Intergenic
1148501383 17:48094136-48094158 AAAGAAGTGTGGGCTTGGTAGGG + Intronic
1148591769 17:48821490-48821512 AAATAAAATTGGGCCCGGTGCGG + Intergenic
1148602735 17:48906804-48906826 AAAGAAGTCTGGGCCGGGCACGG - Intergenic
1148792325 17:50180350-50180372 AAATTAGTGGGGGCTCGGTGTGG - Intergenic
1148954195 17:51339870-51339892 AAAGAAATGTAGGCTGGGTGTGG - Intergenic
1148956548 17:51358643-51358665 AAAATAGAGTGGGCCAGGTGTGG + Intergenic
1149305859 17:55346015-55346037 AAACAAGTGTAGGCCGGGAGTGG + Intergenic
1149322263 17:55493517-55493539 AAAGAAGTTTGGGCTGGATGTGG + Intergenic
1149585438 17:57783167-57783189 AAAATAGTGGGGACCCGGTGGGG - Intergenic
1149672444 17:58426959-58426981 AAAAAAATGTTGGCCAGGTGCGG + Intronic
1149749025 17:59127675-59127697 AAAAAATTGTGGGCTGGGTGTGG - Intronic
1149916188 17:60611707-60611729 AAAGAATTTTGGGCCAGGCGTGG - Intronic
1150152792 17:62824216-62824238 AAAAAAGTGTTGGCCGGGCGTGG - Intergenic
1150267574 17:63841296-63841318 TTAGAAGTGAGGGCCCAGTGGGG + Intronic
1150682048 17:67292194-67292216 AATAGAGTGAGGGCCCGGTGCGG + Intergenic
1150740966 17:67778798-67778820 AAAAAAGGGGGGGCCGGGTGCGG + Intergenic
1150746581 17:67821782-67821804 TAAGCAGTCTTGGCCCGGTGTGG - Intergenic
1151292134 17:73157857-73157879 AAACAATTGTGGGCCCGGCGTGG + Intergenic
1151511070 17:74560543-74560565 AAAAAAATGTAGGCCGGGTGCGG - Intergenic
1151595089 17:75073565-75073587 AAAAAAGTGTCAGCCGGGTGAGG - Intergenic
1152107771 17:78341142-78341164 AAGGAAGTGGGGGCCGGGCGCGG + Intergenic
1152317636 17:79590136-79590158 AAAGAAGTGTGTGGCCTGGGGGG - Intergenic
1153205747 18:2698656-2698678 AAAAAGGTGGGGGCCAGGTGTGG - Intronic
1153423663 18:4937904-4937926 AAATAGGTTTGGGCCGGGTGCGG - Intergenic
1153652199 18:7250709-7250731 GAAGAAATATGGGCCGGGTGCGG - Intergenic
1154223859 18:12482431-12482453 AAATAAATATGGGCCTGGTGCGG - Intronic
1154257139 18:12792569-12792591 AAAACAGTTTGGGCCGGGTGTGG - Exonic
1154531825 18:15353861-15353883 AAAGAGTTTTGGGCCAGGTGCGG - Intergenic
1154950683 18:21206462-21206484 AAAGAAGTTTAGGCCCGGCACGG - Intergenic
1155004174 18:21713319-21713341 AAAGAACTCTGGGCCAGGCGCGG + Intronic
1155262846 18:24061611-24061633 AAAAAAGCGTGGGCTGGGTGTGG + Intronic
1155627387 18:27850502-27850524 AAAGAAGTGGGGGGCGGGGGTGG - Intergenic
1155754824 18:29478662-29478684 TAAGAAGTGTGAGCCGGGCGCGG - Intergenic
1155916392 18:31561706-31561728 AATGAGCTGTGGGCCGGGTGTGG + Intergenic
1156556968 18:38078650-38078672 AAAGAAGGCTGGGCCGGGCGCGG + Intergenic
1156559472 18:38106221-38106243 ACAGAAGTGTGGGCAAGGTCAGG - Intergenic
1157690217 18:49675676-49675698 GAAAAAATGTGGGCCGGGTGCGG + Intergenic
1157765590 18:50294551-50294573 TAAGAAATGTGGGCCAGGTGCGG - Intergenic
1157778887 18:50420203-50420225 AAAGCAGTTTGGGCCGGGCGAGG + Intergenic
1157825541 18:50808845-50808867 AAAGAACTGTCGGCCGGGCGCGG + Intronic
1158263222 18:55632326-55632348 AAAGAACTGTTGGCCGGGCGCGG - Intronic
1158914852 18:62114069-62114091 AAAAAAATGTGGGCCGGGTGCGG + Intronic
1159239397 18:65721724-65721746 AAAGGAGTAGGGGACCGGTGTGG + Intergenic
1159342828 18:67159012-67159034 AAAGAAATCTTGGCCAGGTGCGG - Intergenic
1159362090 18:67418509-67418531 AAAGTAGCGTGGGCCGGGCGCGG + Intergenic
1159702736 18:71649980-71650002 TTAAAAGTGTGGGCCTGGTGCGG + Intergenic
1160275016 18:77423926-77423948 AAATAAATGTCGGCCGGGTGCGG + Intergenic
1160343637 18:78111341-78111363 AAGGAGGTGTGGGCCAGGTAAGG - Intergenic
1160804332 19:985323-985345 ATACAAATGTGGGCCGGGTGTGG - Intronic
1161037713 19:2094878-2094900 AAAGCAGTGTGGGCCGGGCGCGG + Intronic
1161158278 19:2746449-2746471 AAACAAGTGTTAGCCAGGTGTGG - Intergenic
1161727558 19:5938892-5938914 AAACAATTATGGGCCAGGTGCGG + Intronic
1162557931 19:11399274-11399296 AAAAAAGTGTAGGCTGGGTGCGG + Intronic
1162564886 19:11440440-11440462 AAAAAAGTGTGGGCCAGGGGCGG - Intronic
1162641397 19:12013095-12013117 AAAGAAATGTGGGTCAGGTGCGG - Intergenic
1162665364 19:12205850-12205872 AAAGAAGTTTAGGCCGGGTGCGG - Intergenic
1162694584 19:12463635-12463657 AAGGAAATGGGGGCCGGGTGTGG + Exonic
1162709214 19:12579258-12579280 AAAGAACTGGGGGCCGGGTGTGG + Exonic
1162941256 19:14010971-14010993 AAAGAATTCAGGGCCTGGTGCGG - Intergenic
1163011811 19:14431364-14431386 AAAAAAGAGGGGGCCAGGTGTGG - Intergenic
1163012984 19:14436840-14436862 AAAAAAGTATTGGCCAGGTGTGG - Intronic
1163022697 19:14491817-14491839 AAATCAGTGTCGGCCGGGTGTGG + Intronic
1163472104 19:17503639-17503661 AAAAAATTGTTGGCCGGGTGCGG + Intronic
1163529171 19:17839668-17839690 AAAGAAGAGTGGCCCCTGAGTGG + Intronic
1163682466 19:18691044-18691066 AAAGAAGAGTGGGCTGGGAGTGG + Intronic
1163759602 19:19128518-19128540 AAAAAAATGTAGGCCAGGTGTGG - Intronic
1163768298 19:19175798-19175820 AAAGGAGTCTAGGCCGGGTGCGG - Intronic
1163784614 19:19268496-19268518 AAAGAAGGGAGGGCTGGGTGCGG - Intronic
1163848418 19:19650290-19650312 AATGAGGTGAGGGCCTGGTGTGG - Intronic
1164109534 19:22142522-22142544 AAAGAAAAGTTGGCCAGGTGTGG - Intergenic
1164644209 19:29845861-29845883 AGAGAATTGTGGGTCGGGTGGGG - Intergenic
1164779954 19:30884257-30884279 AAAGAAGTGGGGGCCAGGTGTGG - Intergenic
1165083873 19:33329129-33329151 CAAGAAGTAAGGGCCAGGTGTGG - Intergenic
1165580199 19:36855740-36855762 AAAGAAACATGGGCCGGGTGCGG - Intronic
1165616360 19:37205036-37205058 AAATTAGTTTGGGCCTGGTGCGG - Intronic
1165668252 19:37652825-37652847 AGAAAATTGTGGGCCAGGTGCGG + Intronic
1165705355 19:37972410-37972432 TAAGAACTGTGGGCTGGGTGTGG + Intronic
1165840121 19:38783780-38783802 AAAAAAAGGTGGGCCCGCTGGGG + Intergenic
1165866715 19:38943878-38943900 AATGAATTTTGGGCCGGGTGTGG - Intronic
1166443351 19:42835813-42835835 AAAAATGTGTGGGCCAGGTGCGG + Intronic
1166463042 19:43006467-43006489 AAAAATGTGTGGGCTGGGTGTGG + Intronic
1166480325 19:43166554-43166576 AAAAATGTGTGGGCCAGGTGCGG + Exonic
1166490141 19:43252099-43252121 AAAAATGTGTGGGCTGGGTGCGG + Intronic
1166612939 19:44215695-44215717 AAAGAAGATGGGGCCAGGTGCGG + Intronic
1166845504 19:45725447-45725469 AAACACTTGTGGGCCAGGTGCGG + Intronic
1166958877 19:46485948-46485970 AAAGCAGACTGGGCCGGGTGCGG + Intronic
1167227218 19:48254460-48254482 AAAGAAATGCAGGCCTGGTGCGG + Intronic
1167270530 19:48503336-48503358 AAGGTAGAGTGGGCCGGGTGCGG - Intronic
1167279943 19:48561137-48561159 AAATAAATTCGGGCCCGGTGTGG + Intronic
1167869080 19:52352526-52352548 AAGCAAGTTTTGGCCCGGTGCGG - Intronic
1167872222 19:52380188-52380210 AAAGAAGTATGGGCCAGGTACGG - Intronic
1167897988 19:52597549-52597571 TAAGAAGATTGGGCCAGGTGGGG + Intronic
1167950877 19:53026719-53026741 AAAAAAGTGTAGGCCAGGTGTGG + Intergenic
1168209491 19:54879973-54879995 AAAGAAATGTCGGCCGGGCGCGG - Intronic
1168505482 19:56930377-56930399 AAAAAATTGTGGGCTGGGTGTGG - Intergenic
1168612353 19:57811450-57811472 AAAGAAAAGTGGGCTGGGTGCGG - Intronic
1168652925 19:58104406-58104428 AAAAAAGTCTGGGCCGGGTGTGG + Intronic
1202706445 1_KI270713v1_random:27704-27726 AAAAAATTGTTGGCCGGGTGCGG - Intergenic
925115015 2:1371321-1371343 CAAGAACTATGGGCCCGGAGGGG - Intergenic
925932366 2:8719304-8719326 TAAGAAATGAGGGCCGGGTGTGG + Intergenic
926186666 2:10696196-10696218 ATACAAGTGTAGGCCGGGTGCGG - Intergenic
926570787 2:14527678-14527700 AATGTATTGTGGGCCAGGTGTGG - Intergenic
926635578 2:15175253-15175275 AAAGAAGTGTTGGCCGGGCACGG - Intronic
926766644 2:16328083-16328105 AAAGCTCTGTGGGCCGGGTGCGG - Intergenic
926845594 2:17134176-17134198 AAGAAAGTCTGGGCCGGGTGTGG - Intergenic
926947761 2:18206510-18206532 AAAGAAATGAGGGCCAGGCGAGG - Intronic
927137449 2:20107162-20107184 AATGAACTATGGGCCGGGTGCGG + Intergenic
927794501 2:26036368-26036390 AATGAAGTCTGGGCCGGGCGCGG + Intronic
928047674 2:27953580-27953602 AGAGAAGTGTGGGCCCAGTGCGG - Intronic
928675696 2:33648857-33648879 AGAGAAGTTTGGGCTCTGTGTGG + Intergenic
929464527 2:42132843-42132865 AAGGAGGTGTGGGCCTGCTGCGG + Intergenic
929833184 2:45366769-45366791 AAAGAAGAGCAGGCCGGGTGCGG - Intergenic
930125063 2:47789212-47789234 ATAGCAGTATGGGCCGGGTGCGG - Intronic
931421511 2:62132175-62132197 AAAGAAGTCCAGGCCGGGTGTGG - Intronic
931468140 2:62510323-62510345 AAAGAAGTATGGGCCAGGCACGG + Intronic
931548637 2:63416810-63416832 AAAGTATTTTGGGCCAGGTGTGG - Intronic
931996172 2:67841407-67841429 AAGGTAGTATGGGCCAGGTGTGG + Intergenic
932160686 2:69456679-69456701 AAAAAAATGGGGGCCAGGTGTGG - Intergenic
933520662 2:83368150-83368172 AAAGAAGGGTAGGCCGGGCGCGG + Intergenic
933588885 2:84209506-84209528 AAGGAAGTGAGAGCCGGGTGTGG - Intergenic
933615715 2:84480670-84480692 AAAGAAGTCATGGCCAGGTGCGG + Intergenic
934591716 2:95557902-95557924 AAAAAAGAGTAGGCCCGGCGCGG - Intergenic
935190094 2:100770641-100770663 AAAATGGTGTGGGCCAGGTGCGG + Intergenic
935714864 2:105930920-105930942 GAAAAAGTGTGGGTCAGGTGTGG + Intergenic
935997461 2:108789300-108789322 AAGGAACTATGGGCCAGGTGCGG + Intronic
936074807 2:109394974-109394996 AAGGATGTGTGTGGCCGGTGAGG + Intronic
936266443 2:111013232-111013254 AAAAAAATGGGGGCCAGGTGCGG + Intronic
936488109 2:112944431-112944453 AGATAAGTGTTGGCCAGGTGTGG - Intergenic
937423054 2:121774534-121774556 AAAGAAAAGTGGGCCGGGCGCGG + Intergenic
937542567 2:122976848-122976870 AAAAAAAAGTGGGCCAGGTGTGG + Intergenic
938005203 2:127783894-127783916 AAGGAAGTGCTGGCCAGGTGCGG - Intronic
938253987 2:129839774-129839796 AAAGATGTCTGGGCCAGGGGCGG + Intergenic
938264827 2:129920901-129920923 AATAAAATGTGGGCCAGGTGTGG + Intergenic
939824277 2:146996040-146996062 AAAGAGTTGTTGGCCAGGTGCGG + Intergenic
940022276 2:149167924-149167946 AAAGACCTTTGGGCCAGGTGTGG + Intronic
940278422 2:151963775-151963797 AAAGAATGTTGGGCCAGGTGCGG + Intronic
940719231 2:157263115-157263137 AAAGAGGTGTGGGCCGGATGCGG - Intronic
940939632 2:159543822-159543844 AAAGAATTGTTGGCCAGGCGCGG - Intronic
941718336 2:168787017-168787039 AAAGAATTTGGGGCCGGGTGTGG - Intronic
941780054 2:169433875-169433897 GTAGAAGTGTAGGCCCAGTGTGG - Intergenic
942233838 2:173885102-173885124 AAAGATGTATGGGCCAGGCGCGG - Intergenic
942280275 2:174356060-174356082 AAAGAATGATGGGCCAGGTGTGG - Intronic
942903149 2:181146727-181146749 AAAGAAGCTTGGTCCCTGTGTGG - Intergenic
943597591 2:189876756-189876778 AAAAAAAAGTGGGCACGGTGGGG - Intronic
943672170 2:190674758-190674780 AAAGAAATGTGGGCTGGGTATGG + Intronic
943770298 2:191709283-191709305 AAAGAAGTCTGGGTCGGGTGCGG + Intergenic
943959382 2:194242055-194242077 AAAGAATTATAGGCCGGGTGCGG + Intergenic
944302548 2:198140141-198140163 AAAGAAGTATGGGCCAGGCGCGG - Intronic
944452656 2:199858601-199858623 AAAGTTGTGTGGGCCGGGCGCGG - Intergenic
944700702 2:202243497-202243519 AAATAAGTAAGGGCCTGGTGTGG - Intergenic
944761510 2:202820081-202820103 AAAGATGTGTTGGCCGGGCGCGG + Intronic
945766168 2:213980065-213980087 AACTAAGTGTAGGCCAGGTGTGG + Intronic
945876445 2:215282993-215283015 CAAAAAGTGGGGGCCGGGTGCGG + Intergenic
946159243 2:217826052-217826074 AAGGAGGTGGGGGCCCGGTGAGG - Intronic
946198412 2:218053933-218053955 AAAGATGTTTAGGCCAGGTGCGG - Intronic
946237974 2:218336769-218336791 AAAGAATTGAAGGCCAGGTGTGG - Intronic
946663631 2:222027544-222027566 AAAGCAATGTAGGCCGGGTGTGG + Intergenic
947214543 2:227737908-227737930 AAAGAAATGTGGGCTGGGTGGGG + Intergenic
947789519 2:232856220-232856242 AAAGAACTGCAGGCCGGGTGTGG - Intronic
947833219 2:233156583-233156605 AAGGAAGCGTGGGCCAGGCGCGG - Intronic
948627652 2:239279026-239279048 AAAGAAAAGTGGGGCTGGTGTGG + Intronic
949027999 2:241775235-241775257 CAAGAAGTGTGGGCCTGGGCAGG - Intergenic
1168783667 20:518119-518141 AAAGATGAGTGGGCCAGGTGTGG - Intronic
1169070048 20:2720384-2720406 AAAGAAGAATGGGCCGGGGGCGG - Intronic
1169089502 20:2850029-2850051 AAAGAATTATTGGCCTGGTGTGG + Intronic
1169209320 20:3756936-3756958 AAACCAGTGTGGACACGGTGAGG + Intronic
1169280603 20:4263775-4263797 AAAGCAATGTTGGCCAGGTGTGG - Intergenic
1169394998 20:5221354-5221376 CAAGAACTGTGGGCCCTGTGTGG + Intergenic
1170241374 20:14170180-14170202 AAAGAAGTGTTGGCCGGGTGTGG - Intronic
1170535338 20:17335317-17335339 AAAGAAGTCTGAGCCCCCTGAGG - Intronic
1170690653 20:18612322-18612344 AAACATGTGTGGGCCAGGCGCGG - Intronic
1171188284 20:23139094-23139116 AAAGAACTGTGAGGCCTGTGAGG + Intergenic
1172766572 20:37354359-37354381 TAACAAGTGTGCACCCGGTGGGG + Intronic
1172775024 20:37402319-37402341 GAAGAAGTGTGGGGAGGGTGGGG + Intronic
1173342631 20:42166626-42166648 GAAGAAGTCGGGGCCAGGTGCGG + Intronic
1173808606 20:45942262-45942284 AAAAAAGGGTGGGCCGGGTGCGG - Intronic
1173972382 20:47162807-47162829 AAAAAAATGAGGGCCAGGTGTGG - Intronic
1174030332 20:47619352-47619374 AAAGAAATGTAGGCTGGGTGTGG + Intronic
1174068168 20:47880491-47880513 AAAGTAGTTTGGGCCAGGCGCGG - Intergenic
1174622171 20:51884020-51884042 AAGAAAATGTGGGCCAGGTGCGG + Intergenic
1174628510 20:51935851-51935873 AAAAAATTGTGGGCCAGGTGCGG - Intergenic
1174863086 20:54110975-54110997 AAAGAAAGGTGGGCCGGGTGCGG + Intergenic
1175104818 20:56607368-56607390 AAAGAAGACTGGGCCAGGTGCGG + Intergenic
1175120468 20:56712540-56712562 AAAAAATTGGGGGCCCGGTGCGG + Intergenic
1175178256 20:57126814-57126836 AAGGAAGGGTGGGCCTGCTGGGG + Intergenic
1175187955 20:57191405-57191427 AAAGAAATGTAGGCCAGGTGTGG + Intronic
1175313302 20:58026622-58026644 GCAGAAATGTGGGCCCAGTGAGG + Intergenic
1175438984 20:58977506-58977528 GAAGAATTCTGGGCCGGGTGCGG - Intergenic
1176302074 21:5103165-5103187 AAGGAAATGTGGGCCGGGCGTGG + Intergenic
1176765536 21:13014312-13014334 AAAGAGTTTTGGGCCAGGTGCGG + Intergenic
1176782083 21:13208418-13208440 AAAGAATTGTAGGCCGGGCGCGG - Intergenic
1177227744 21:18279622-18279644 AGAGAAATGAGGGCCGGGTGCGG - Intronic
1178096110 21:29217455-29217477 GAGGACGTGTGGGCCGGGTGCGG + Intronic
1178292143 21:31377844-31377866 AAAAAAAAGTGGGCCAGGTGCGG + Intronic
1178395110 21:32236082-32236104 AAAAAAGAGTGGGCCGGGTACGG + Intergenic
1178466465 21:32853051-32853073 AAAGGAATATGGGCCAGGTGCGG - Intergenic
1178671331 21:34594261-34594283 AAAGAAGGGTGGGCCGGGCGCGG + Intronic
1178726030 21:35052444-35052466 AAAGAAGTGAGAGGCCTGTGCGG - Intronic
1179151800 21:38815638-38815660 AAAGAAAAGAGGGCCAGGTGCGG + Intronic
1179218113 21:39384548-39384570 AAAAAATTGTCGGCCAGGTGTGG - Intronic
1179432953 21:41337365-41337387 AAAGATGTGTGGGGGCTGTGGGG + Intronic
1179837417 21:44045844-44045866 AAAAAAATCTTGGCCCGGTGCGG - Intronic
1179854955 21:44158735-44158757 AAGGAAATGTGGGCCGGGCGTGG - Intergenic
1180430111 22:15240799-15240821 AAAGAGTTTTGGGCCAGGTGTGG + Intergenic
1180512728 22:16109116-16109138 AAAGAGTTTTGGGCCAGGTGTGG + Intergenic
1180684872 22:17658108-17658130 AAAGAAATGTCGGCCGGGCGTGG - Intronic
1180890040 22:19280998-19281020 AAAGAGTTGTGGGCCGGGCGCGG + Intronic
1180939589 22:19649694-19649716 ATAGAAGAGTTGGCCAGGTGTGG + Intergenic
1180952857 22:19728575-19728597 AGGGAAGTGGTGGCCCGGTGGGG - Intergenic
1181017402 22:20079267-20079289 AAATAATTTTGGGCCCGGCGCGG + Intergenic
1181287991 22:21768248-21768270 AAAGAATTGTGGGCCAGGTGCGG - Intronic
1181289200 22:21778039-21778061 AAAAAAGTGGGGGCCAGGAGTGG + Intronic
1181628080 22:24134785-24134807 AAACAAGTGTGGGCCGGGCGCGG + Intronic
1181676597 22:24457978-24458000 AAAAAAGTGTTGGCCAGGTGTGG - Intergenic
1181817704 22:25451017-25451039 TAAGAAGTATAGGCCGGGTGCGG - Intergenic
1181922518 22:26331691-26331713 CAAGAAGTCTGGGCCAGGCGTGG + Intronic
1181972403 22:26701256-26701278 AATTAAATGTGGGCCAGGTGTGG - Intergenic
1182008283 22:26979475-26979497 AATGAGGTGTGGGGCTGGTGTGG + Intergenic
1182160668 22:28118106-28118128 AAAGAATTATGGGCCAGGAGCGG + Intronic
1182377657 22:29859574-29859596 AAAGAATAGTGGGCCAGGCGAGG + Intergenic
1182407428 22:30148355-30148377 AAATAAGTGTTTGCCTGGTGTGG + Intronic
1182411252 22:30188843-30188865 AATGAAATTTGGGCCGGGTGCGG + Intergenic
1182468187 22:30531115-30531137 AAGGAACTGTAGGCCAGGTGCGG + Intronic
1182674861 22:32031093-32031115 AAATATGTGTTGGCCAGGTGTGG + Intergenic
1182736934 22:32537447-32537469 AAGGAAGTGCCGGCCGGGTGCGG - Intronic
1182926912 22:34133807-34133829 AAAGATTTGTGGGCCAGGTGTGG + Intergenic
1183550019 22:38476812-38476834 AAAAAAGGGGGGGCCAGGTGTGG - Intronic
1183570020 22:38646073-38646095 AAAGAAATATGGGCTAGGTGCGG - Intronic
1183718271 22:39547024-39547046 GAAGAACTGTGGGCCAGGTTAGG + Intergenic
1183783818 22:40017620-40017642 AAAGAAGCTTGGGCCGGCTGTGG + Intronic
1183887361 22:40895623-40895645 AAAAAAGTCTGGGCCGGGTGCGG - Intronic
1183896826 22:40976067-40976089 GAAGAAGTGAGGGCCGGGTGCGG - Intergenic
1183970806 22:41476115-41476137 AAAGCATTGTGAGCCGGGTGTGG + Intronic
1184144146 22:42598672-42598694 AGAGAAATATGGGCCAGGTGCGG - Intronic
1184181512 22:42831007-42831029 ACAGAAGGGTCGGCCAGGTGTGG + Intronic
1184485432 22:44775738-44775760 AAAGAGTTATGGGCCAGGTGCGG - Intronic
1184496385 22:44844751-44844773 AAAGAAATGTTGGCCAGGTGCGG - Intronic
1184622420 22:45691603-45691625 AAAGCAGTCTGGGCCAGGCGCGG + Intronic
1184710401 22:46246313-46246335 AAAGGTGGGTGGGCCAGGTGGGG - Intronic
1184740206 22:46423680-46423702 TAACAAGTATGGGCCGGGTGCGG + Intronic
1184776005 22:46623252-46623274 CAAGAAGTGGAGGCCTGGTGGGG - Intronic
949561462 3:5206494-5206516 AAAGATCTGGGGGCCAGGTGTGG - Intronic
949658258 3:6247132-6247154 GAATAAATGTGGGCCAGGTGCGG + Intergenic
949704735 3:6803370-6803392 TAAGAAAAGTGGGCCAGGTGCGG - Intronic
949732388 3:7128796-7128818 TAAGAAGTCTGGGTCAGGTGTGG - Intronic
950365115 3:12477670-12477692 AGAGAAGTGAGCGCCAGGTGAGG - Intergenic
950396870 3:12740409-12740431 AAAGCATTCTGGGCCAGGTGTGG + Intronic
950489583 3:13295557-13295579 ACAGCAGGGTGGGCCAGGTGCGG - Intergenic
950749686 3:15118869-15118891 AAAGAATTCTGGGCCGGGCGCGG + Intergenic
950838671 3:15945682-15945704 AAAGAAGTTCTGGCCTGGTGCGG + Intergenic
951556075 3:23921994-23922016 AAGTAAATTTGGGCCCGGTGTGG - Intronic
951615214 3:24534860-24534882 AAAAAAGTCTGGGCCGGGCGCGG + Intergenic
952001579 3:28791842-28791864 AGAGCAGTGAGGGCACGGTGGGG - Intergenic
952277928 3:31895425-31895447 AAAAAAGTCTGGGCTGGGTGCGG - Intronic
952325580 3:32317762-32317784 AAAGAAATAAGGGCCAGGTGTGG + Intronic
952349043 3:32516849-32516871 AATGAAGAGGTGGCCCGGTGTGG + Intergenic
952475080 3:33700553-33700575 AATCAATTGTGGGCCAGGTGCGG + Intronic
952747380 3:36794061-36794083 GAAGACATGTGGGCCGGGTGCGG - Intergenic
953030129 3:39174476-39174498 AAAAAACTGTGGGCCGGGCGCGG + Intergenic
953349545 3:42204870-42204892 TAAGAAGTCTGAGCCAGGTGTGG - Intronic
954061385 3:48070708-48070730 AGGGAACTGTGGGCCAGGTGTGG + Intronic
954331794 3:49895148-49895170 AAAGGTGTGGGGGCCAGGTGGGG - Exonic
954617423 3:51976384-51976406 AAAGATGTGCTGGCCCGGCGCGG + Intronic
955299556 3:57764209-57764231 AAGAAAGAGTGGGCCGGGTGCGG + Intronic
955501107 3:59584024-59584046 AAAGAAATGTAGGCCAGGTACGG + Intergenic
955920072 3:63946347-63946369 AAGGAATTGTGGGCCAGGCGCGG + Intronic
956102547 3:65783830-65783852 AAAAAAGTGCAGGCCAGGTGTGG + Intronic
956652029 3:71513074-71513096 AAAGAGGTATGGGCCAGGTTGGG - Intronic
956746928 3:72317841-72317863 AAAGAAATGTGTGCCCTGTGGGG - Intergenic
956815053 3:72900706-72900728 TAAGAATTGTGGGCTGGGTGTGG - Intronic
956875487 3:73458699-73458721 AAAGAGGTTTGGGCTGGGTGCGG + Intronic
957112303 3:75979237-75979259 AAAGATATGTGGGACTGGTGAGG + Intronic
957200389 3:77127077-77127099 AAAGAAGTTTCGGCCTGGCGTGG - Intronic
957207754 3:77219262-77219284 AAAGAAGTCGAGGCCCAGTGCGG - Intronic
957374442 3:79337442-79337464 AGAGAAGTGAGGGCCAAGTGAGG - Intronic
957612067 3:82480748-82480770 TAAGAAGTCTTGGCCGGGTGTGG - Intergenic
957865812 3:86021288-86021310 AAAGCAGTTTTGGCCAGGTGCGG - Intronic
958008649 3:87846140-87846162 AAAGTAGTATGGGCCGGGTGCGG + Intergenic
958156991 3:89768115-89768137 AAAAAAATATGGGCCGGGTGTGG - Intergenic
958784492 3:98582779-98582801 AAAGTATTGTGGGCCGGGCGTGG - Intronic
958894679 3:99816529-99816551 TAAGAAGTATGGGCCGGGCGCGG - Intergenic
959062394 3:101627683-101627705 AAAGAAGTCTGGGCTGGCTGTGG - Intergenic
959251810 3:103957726-103957748 AATAAAGTATGGGCCAGGTGCGG + Intergenic
959474128 3:106788685-106788707 AGAAAAGTTTGGGCCAGGTGCGG - Intergenic
959616940 3:108359328-108359350 AAATAAATGTTGGCCAGGTGGGG + Intronic
959669129 3:108955020-108955042 AGAGAACTGTAGGCCAGGTGTGG - Intergenic
960034867 3:113092321-113092343 AAAGAAGCAAGGGCCGGGTGCGG - Intergenic
960377182 3:116917701-116917723 AAAGAAAAGTCGGCCAGGTGTGG + Intronic
960641723 3:119831365-119831387 AGAGAAGAGTGGGCCGGGCGCGG + Intronic
961447434 3:126987523-126987545 CAGGAAGTGAGGGCCCGATGTGG + Intergenic
961570881 3:127797911-127797933 AAAGAATTTTGGGCCAGGTACGG - Intronic
962201266 3:133403087-133403109 AAAGGGGTGGGGGCCTGGTGGGG - Intronic
962296664 3:134195654-134195676 AAAGGAGTATTGGCCAGGTGCGG + Intronic
963153348 3:142070195-142070217 AAAGAAGTTTGGGCCAGGTGCGG - Intronic
963621308 3:147609840-147609862 AGAGGAGGGTGGGCCGGGTGCGG - Intergenic
963711271 3:148750547-148750569 AACCAAGTGTGGGCCAGGAGTGG + Intergenic
963813937 3:149809279-149809301 TAAGAAGTCTGGGCCGGGTGCGG + Intronic
964240493 3:154587083-154587105 AAAGAACTCTCGGCCAGGTGTGG - Intergenic
964280479 3:155058970-155058992 AAAGAAGGATTGGCCAGGTGTGG + Intronic
964348742 3:155781785-155781807 AAAAAATAGTGGGCCGGGTGCGG + Intronic
964744605 3:160000677-160000699 AAAGAAGTCTCAGCCAGGTGTGG + Intergenic
965080991 3:164031697-164031719 ACAGAAGTGAGGGCTGGGTGTGG + Intergenic
965168096 3:165222792-165222814 AAATAAATGTGGGCCAGGCGCGG + Intergenic
965481663 3:169226150-169226172 AAAGAAGTGTGAGGCAGGGGTGG - Intronic
965537941 3:169843482-169843504 ACAGAACTGTGAGCCGGGTGAGG + Intronic
966170928 3:177079139-177079161 AAAAAAATGTCGGCCGGGTGCGG + Intronic
966713862 3:182996292-182996314 AAAGAATTGAGGGCCAGGTGCGG - Intergenic
966869213 3:184279017-184279039 AAAGAAGTTTAGGCCAGGTGCGG + Intronic
966899607 3:184470823-184470845 AAAGAATTCTGGGCTGGGTGCGG + Intronic
966993964 3:185262232-185262254 CAAGAAGGGTTGGCCAGGTGCGG + Intronic
967291008 3:187920411-187920433 AAAGAAGGATTGGCCAGGTGCGG + Intergenic
967652837 3:192008123-192008145 AAAGAAATATGGGCCAGGCGCGG + Intergenic
968021626 3:195396495-195396517 AAAGAAGTATGGGCCGGGCACGG + Intronic
968120570 3:196123060-196123082 TAAGAAGTGTGGACTCGGAGGGG - Intergenic
968122768 3:196137442-196137464 AAAGAATTTGGGGCCGGGTGCGG - Intergenic
968843350 4:3024568-3024590 AAAAAATTGTAGGCCAGGTGTGG + Intronic
968844442 4:3032191-3032213 AAAGCAGAATGGGCCGGGTGCGG + Intronic
969038979 4:4279032-4279054 AAAGAAGGCTGGGCCAGGTGCGG + Intronic
969421406 4:7099170-7099192 AAAAAATTGTTGGCCAGGTGCGG + Intergenic
970361952 4:15318730-15318752 ATAGATATGTGGGCCGGGTGTGG - Intergenic
970600414 4:17637315-17637337 AAAGCAGTGGGGGCCGGGCGCGG - Intronic
970975570 4:22039455-22039477 AAAGAATTTTCGGCCAGGTGTGG - Intergenic
971163977 4:24162882-24162904 AAGGAAGTAAGGGCCAGGTGTGG - Intergenic
971320590 4:25602866-25602888 ATAAAAGTATGGGCCAGGTGCGG + Intergenic
972790552 4:42367654-42367676 AAGCCAGTGTGGGCCAGGTGTGG + Intergenic
973137730 4:46728380-46728402 ACAGATGTGTAGGCCAGGTGTGG + Intergenic
973290012 4:48461859-48461881 AAAGAGGTTTAGGCCGGGTGTGG + Intergenic
973891956 4:55376203-55376225 AAAGATATTTGGGCCTGGTGTGG - Intergenic
973947910 4:55978838-55978860 TAAAAAGTCTGGGCCAGGTGTGG - Intronic
974043709 4:56879586-56879608 AAAGAAATGTGGACCGGGCGTGG + Intergenic
974565773 4:63577144-63577166 CAAGAAGTTTGGGCCGGGCGCGG - Intergenic
974708649 4:65558165-65558187 TAAGAATTTTGGGCCAGGTGTGG - Intronic
975128627 4:70810068-70810090 AAAGAATTATTGGCCCCGTGTGG + Intergenic
975165550 4:71174536-71174558 AATGGTGTGTGGGCCAGGTGCGG - Intergenic
975461556 4:74659419-74659441 AAAGGATTGTAGGCCGGGTGTGG + Intergenic
975643734 4:76526075-76526097 AAATAAATGTCGGCCAGGTGCGG + Intronic
975712382 4:77173579-77173601 AAAGAAGGTTGGGCTAGGTGTGG - Intronic
975901220 4:79155292-79155314 AAAAAATTATGGGCCCGGCGCGG - Intergenic
976392182 4:84517026-84517048 AATGATTTGTGGGCCAGGTGCGG - Intergenic
976402398 4:84622296-84622318 AAACAACTGCGGGCCAGGTGCGG + Intronic
976650971 4:87434332-87434354 AAACAAGTGTAGGCCAGGTGTGG - Intronic
977091924 4:92688338-92688360 AAAGAAGAGTTGGCCGGGCGTGG - Intronic
977776906 4:100931581-100931603 CAAGAAGTATTGGCCAGGTGCGG + Intergenic
977801732 4:101242639-101242661 TAAGAAATCTGGGCCAGGTGTGG + Intronic
977806752 4:101308714-101308736 AAATAATTATGGGCCAGGTGTGG - Intronic
978283448 4:107045317-107045339 AAGGAAGTTTGGGCTGGGTGCGG + Intronic
978533806 4:109740001-109740023 AAAGAAGCAGGGGCCTGGTGTGG + Intergenic
978790502 4:112659089-112659111 AACAAAGTGAGGGCCAGGTGTGG - Intergenic
979359105 4:119740864-119740886 AATGCAGTTTCGGCCCGGTGCGG + Intergenic
980830949 4:138128730-138128752 CAACAAGTGTCGGCCGGGTGCGG - Intergenic
980994293 4:139765695-139765717 AATGAAGTATTGGCCAGGTGTGG + Intronic
981475779 4:145185252-145185274 AAAGAATTATGGGCCAGGTGTGG - Intergenic
982004657 4:151052039-151052061 AAAGAAGAGTGGGCCGGGCGTGG + Intergenic
982512690 4:156303505-156303527 AGAGATGTGTGGGGCCGGGGTGG - Intergenic
982896819 4:160941068-160941090 AAAGAATTGTTGGCCAGTTGCGG + Intergenic
983218778 4:165025020-165025042 AATGAACTGTGGGCCGGGCGCGG - Intergenic
983225718 4:165084487-165084509 AAGAAAGTGTGGGCCAGGTGGGG - Intronic
983226725 4:165092410-165092432 ACAGCACTGTGGGCCGGGTGCGG - Intronic
983829849 4:172313115-172313137 AAAGAAGTGTGGGGGTGGGGGGG - Intronic
983840562 4:172452910-172452932 TAAGATGTGAGGGCCAGGTGCGG + Intronic
984117498 4:175700151-175700173 ATAGAGTTGTGGGCCGGGTGTGG - Intronic
984730132 4:183060525-183060547 AATAAAATGTGGGCCGGGTGTGG - Intergenic
984803396 4:183734387-183734409 AAAGAATTCAGGGCCCGGAGTGG - Intergenic
984861634 4:184245671-184245693 AAACCAGAGTGGGCCGGGTGCGG + Intergenic
984889918 4:184482698-184482720 AAGGAAATGTGGGCCGGGCGCGG - Intergenic
984983457 4:185304645-185304667 AAAAAAATTTAGGCCCGGTGTGG - Intronic
984983818 4:185308047-185308069 AGAGAGGTGTGGGCCCGGCGTGG - Intronic
985011702 4:185588957-185588979 AAAGAATTGAGGCCCTGGTGCGG - Intronic
985118136 4:186612097-186612119 AAAAAAGCGTTGGCCGGGTGCGG - Intronic
985262042 4:188123653-188123675 TAAGAATTTTGGGCCGGGTGCGG - Intergenic
985279560 4:188271783-188271805 GAAGAAGGGAGGGCCGGGTGCGG - Intergenic
985358768 4:189149269-189149291 AAAGAATTTTGGGCCAGGCGTGG + Intergenic
985875051 5:2587861-2587883 TCAGAAGTCTGGGCACGGTGTGG - Intergenic
987206387 5:15631403-15631425 GAAGAAGTGTGGGCTGGGCGTGG + Intronic
987387260 5:17341935-17341957 AAATAAGAGTGGGCTGGGTGTGG + Intergenic
987771514 5:22311412-22311434 AAACAATTGTGGGCCGGGCGCGG + Intronic
988279050 5:29121496-29121518 AAATAAGTCTGGGCTTGGTGAGG + Intergenic
988786369 5:34569035-34569057 AAGCCAGTGTGGGCCAGGTGTGG - Intergenic
989161162 5:38393026-38393048 AAGGCATTGTGGGCCAGGTGCGG - Intronic
989161395 5:38394697-38394719 AAAAAAAAGTGGGCCCGGCGCGG - Intronic
989174440 5:38508872-38508894 AAAGAAATTTAGGCCGGGTGTGG - Intronic
989517787 5:42363496-42363518 AAACAAATGTTGGCCGGGTGCGG - Intergenic
989589584 5:43101028-43101050 AAATAATTGAGGGCCGGGTGTGG + Intronic
989595682 5:43154114-43154136 AAAGAAGTGTCAGCATGGTGGGG + Intronic
989604290 5:43229089-43229111 AAAGACTTTTGGGCCAGGTGTGG + Intronic
989650353 5:43681688-43681710 AAAGAAGTTGAGGCCGGGTGCGG - Intronic
989965391 5:50460810-50460832 AAAGCAGTTTAGGCCAGGTGCGG + Intergenic
990147431 5:52778465-52778487 AGAAAATTGTGGGCCGGGTGTGG + Intergenic
990630514 5:57663777-57663799 AAAAAAGTGTGGGGGGGGTGCGG - Intergenic
991348879 5:65700376-65700398 AAAGAAGAATGAGCCGGGTGCGG + Intronic
991389839 5:66130914-66130936 AAACAACTTTGGGCCAGGTGCGG + Intergenic
991665932 5:69000045-69000067 AAAGAAGTATTGGCCAGGTGTGG - Intergenic
992064548 5:73093975-73093997 AGAAAAGTGTCGGCCGGGTGCGG + Intergenic
992285523 5:75231364-75231386 AAGGAATTCTGGGCCAGGTGTGG - Intronic
992813516 5:80413179-80413201 AAAGAAGAGAGGGCTGGGTGCGG + Intronic
992986633 5:82237351-82237373 TAAGAAGTCTTGGCCGGGTGTGG + Intronic
993332640 5:86618696-86618718 AAAAAACTGTGGGCCAGGTGCGG + Intronic
993908176 5:93647514-93647536 AAAAAACTGTGGGCTGGGTGTGG - Intronic
994279368 5:97883396-97883418 AAAGAAATGGGGGCCAGGAGTGG - Intergenic
994579289 5:101618135-101618157 AAAAATGTCTGGGCCAGGTGCGG - Intergenic
994924670 5:106099146-106099168 AAAAAAGTGAGGGCTGGGTGTGG - Intergenic
995048336 5:107673343-107673365 AAAGAAATGAGGGCCGGGGGCGG + Intergenic
995388641 5:111615395-111615417 AAAGAAATGTGGGCCTGGATTGG + Intergenic
995893824 5:116987552-116987574 AGAGAAATGAGGGCCGGGTGTGG + Intergenic
996541827 5:124638238-124638260 AAAAAACTGTTGGCCGGGTGTGG - Intronic
996736282 5:126761625-126761647 AAAGAATTGTTGGCCGGGTGCGG + Intergenic
997811327 5:136973289-136973311 AAAGAGGTATTGGCCAGGTGTGG + Intergenic
998229887 5:140354291-140354313 GAAGGAGTGTGGGCACTGTGAGG + Intergenic
998530093 5:142876483-142876505 AAAAATGTGGGGGCCAGGTGTGG + Intronic
999044803 5:148455509-148455531 AAAGAAGTGTGGGAATGGAGTGG + Intronic
999324573 5:150635751-150635773 AGAAAAGTGTGGGCTGGGTGCGG - Intronic
999414528 5:151383052-151383074 AAAAGACTGTGGGCCGGGTGCGG - Intergenic
1000311402 5:160048443-160048465 AAAGCAGTGCTGGCCGGGTGTGG - Intronic
1000469215 5:161619245-161619267 AAAAGAGTATGGGCCGGGTGCGG + Intronic
1000869096 5:166553008-166553030 AAAGAAGTTGTGGCCAGGTGAGG - Intergenic
1000880049 5:166686973-166686995 AAAGAAGTGGGGGCCGGTGGGGG - Intergenic
1000992848 5:167928601-167928623 AAGAATGTGTGGGCCAGGTGTGG + Intronic
1001107122 5:168863926-168863948 AAGCATGTGTGGGCCAGGTGCGG + Intronic
1001341532 5:170850824-170850846 AAAAAAGAGAGGGCCCGGCGTGG - Intergenic
1001409606 5:171501359-171501381 AATGAAGTTTTGGCCAGGTGCGG + Intergenic
1001732760 5:173972612-173972634 AACAAATTGTGGGCCGGGTGCGG - Intergenic
1002007196 5:176245009-176245031 TAAGAAATGTTGGCCGGGTGCGG - Intronic
1002219184 5:177665613-177665635 TAAGAAATGTTGGCCGGGTGCGG + Intergenic
1002312277 5:178322280-178322302 AAATAGGCGTGGGCCAGGTGCGG - Intronic
1002511842 5:179725389-179725411 AAAAAATTGTTGGCCAGGTGCGG + Intronic
1003132267 6:3404968-3404990 AAAGATTTGTCGGCCAGGTGCGG + Intronic
1003229558 6:4239744-4239766 AAAGAACTGTGGGCCAGGTTGGG - Intergenic
1003481408 6:6536928-6536950 AATGTAGTGTGGGCTGGGTGTGG - Intergenic
1003495341 6:6658624-6658646 AAGAAAATGTGGGCCAGGTGTGG + Intergenic
1003818110 6:9864246-9864268 AAAAAAGAATGGGCCAGGTGCGG + Intronic
1003907106 6:10711797-10711819 AAAGAACTCTTGGCCAGGTGCGG - Intergenic
1003943065 6:11047213-11047235 AAGGAAGTGGTGGCCAGGTGCGG + Intergenic
1003943740 6:11054241-11054263 TAATAAGTGTAGGCCAGGTGCGG + Intergenic
1003950672 6:11112541-11112563 AAAGCAGTTTGGGCCAGGTGTGG - Intronic
1004045748 6:12021174-12021196 TAAGGAGTCTGGGCCGGGTGCGG - Intronic
1004197536 6:13518489-13518511 AAAGAAAAGTCGGCCCGGTGCGG + Intergenic
1004325229 6:14668614-14668636 TAAGAAGTGTTGGCCGGGCGCGG + Intergenic
1004381764 6:15138613-15138635 AAAGGAATCTTGGCCCGGTGTGG - Intergenic
1004488263 6:16088932-16088954 AAAGACGTTTAGGCCAGGTGCGG + Intergenic
1004604932 6:17185075-17185097 AAAGCAGGGTGGGGCCGGGGTGG + Intergenic
1004649280 6:17593005-17593027 TTAGAAATGTGGGCCAGGTGTGG - Intergenic
1004686315 6:17948854-17948876 AAAGATGTTTGGGCCAGGCGAGG - Intronic
1005078626 6:21934042-21934064 AATGAACTGTTGGCCAGGTGCGG - Intergenic
1005623535 6:27642413-27642435 AAATAAAAATGGGCCCGGTGTGG + Intergenic
1005634315 6:27738900-27738922 AAAGAAGAGCGGGCCGGGCGCGG - Intergenic
1005860162 6:29894240-29894262 AAAGATTTGTGGGCCAGGAGTGG - Intergenic
1006002413 6:30975625-30975647 AAAACACTGTGGGCCAGGTGCGG - Intergenic
1006287566 6:33108571-33108593 TCAAAAGTGTGGGCCCAGTGTGG + Intergenic
1006498053 6:34438237-34438259 CAAGAAGTTTGGGCCTGGCGCGG + Intergenic
1006859260 6:37159158-37159180 CAATAAAAGTGGGCCCGGTGCGG + Intergenic
1007042088 6:38732004-38732026 AAAGAAATGTAGGCTGGGTGTGG - Intronic
1007401419 6:41604710-41604732 AAAGATGTCTGGGCCGGGTGCGG + Intergenic
1007472652 6:42100784-42100806 AAAAAATTGGGGGCCGGGTGCGG + Intergenic
1007511037 6:42374513-42374535 ACAGATGTGTGGGCATGGTGAGG - Intronic
1007671331 6:43556836-43556858 AAAGAAATGAAGGCCGGGTGTGG + Intronic
1009417244 6:63429443-63429465 CAAGAAATCTGGGCCAGGTGTGG + Intergenic
1009953286 6:70421172-70421194 AAAGTAGTGTGGGCCAGGCGTGG - Intronic
1010138604 6:72585945-72585967 TAAGAATTTTGGGCCAGGTGTGG - Intergenic
1010212770 6:73375115-73375137 AAAGAAGAGTTGGCTGGGTGTGG - Intronic
1010437988 6:75858313-75858335 AAAAAATTGTTGGCCGGGTGCGG + Intronic
1010764289 6:79760933-79760955 AAAAAATTGTGGGCCAAGTGTGG - Intergenic
1011286340 6:85728269-85728291 AAAGAAATCAGGGCCTGGTGTGG + Intergenic
1011470646 6:87704412-87704434 AAGGAAATTTGGGCCAGGTGCGG + Intergenic
1011585420 6:88919607-88919629 ATAAAATTGTGGGCCAGGTGTGG - Intronic
1011765102 6:90611370-90611392 AAAGAGGTGTGGGCCGGGACGGG - Intergenic
1012572390 6:100745036-100745058 AAGGAAAAGTGGGCCAGGTGCGG + Intronic
1013151917 6:107454336-107454358 AAAGAAGTCTAGACCAGGTGTGG - Intronic
1013480194 6:110546412-110546434 AGAAAAGGGTGGGCCAGGTGTGG - Intergenic
1013995545 6:116303843-116303865 GAAACAGTGGGGGCCCGGTGCGG + Intronic
1014106853 6:117574788-117574810 AAAAAAGAGTAGGCCAGGTGCGG + Intronic
1014254935 6:119151522-119151544 AATGAGCTGTGGGCCAGGTGCGG + Intergenic
1015620538 6:135127369-135127391 AAAGAAATTTAGGCCAGGTGCGG + Intergenic
1015917651 6:138233665-138233687 AAAGAAGTATTGGCCGGGTACGG - Intronic
1015976060 6:138792236-138792258 AAATAACTCTGGGCCAGGTGTGG + Intronic
1016439574 6:144069255-144069277 AAAGAGGTTTAGGCCAGGTGCGG + Intergenic
1016825797 6:148387400-148387422 AAAGAAAGGAGGGCCGGGTGCGG - Intronic
1016898099 6:149074007-149074029 AAAGAAGTGTGGCCTCAGGGGGG - Exonic
1017070331 6:150570371-150570393 AGAGACGTGAGGGCCAGGTGCGG - Intergenic
1017156519 6:151327103-151327125 AAAAAAATGTAGGCCAGGTGCGG - Intronic
1017168115 6:151428822-151428844 TTATAAGTGTGGGCCAGGTGTGG - Intronic
1017437911 6:154435283-154435305 AGAGATTTGTGGGCCGGGTGTGG - Intronic
1017689712 6:156951731-156951753 AATGAAGTGTTGGCCAGGTGCGG - Intronic
1017754199 6:157515753-157515775 AATGAAGGGTGGGCCGGGCGCGG - Intronic
1017857945 6:158367748-158367770 AAAGAATTGTAAGGCCGGTGCGG + Intronic
1017894287 6:158665817-158665839 ACAGAAGTTTGGGCCAAGTGTGG + Intronic
1017897826 6:158696491-158696513 AAATAAGTGTTGGCCAGGTGCGG - Intronic
1017926911 6:158918445-158918467 AAAGAACTGTTGGCCGGGTGCGG - Intergenic
1018322946 6:162633142-162633164 AAAAAAATGTAGGCCGGGTGCGG + Intronic
1018392902 6:163353972-163353994 AATGAGGTGACGGCCCGGTGTGG - Intergenic
1018450097 6:163899846-163899868 AAAGAAGTCTGGGCCGGGCGTGG + Intergenic
1018627781 6:165796374-165796396 AAAGATGTGCAGGCCAGGTGCGG - Intronic
1018705349 6:166460200-166460222 AAATAAGTTTGGGCCCAGAGGGG - Intronic
1019094986 6:169572248-169572270 AAAGAATTCTGGGCCGGGCGTGG + Intronic
1019496703 7:1343971-1343993 AAAGAGGTGTAGGCCGGGTGCGG + Intergenic
1019586517 7:1807326-1807348 AAAAATGTGTGGGCCAGGTGCGG + Intergenic
1020050751 7:5080083-5080105 AAAAAAATGTGGGCCGGGCGCGG + Intergenic
1020253863 7:6490678-6490700 AAAGAAATTTAGGCCGGGTGCGG - Intergenic
1020395630 7:7713988-7714010 AAAAACGTGTGGGGCAGGTGTGG - Intronic
1021002331 7:15347616-15347638 AAAAAAATGTGGGCGCAGTGTGG + Intronic
1021012910 7:15493663-15493685 AAAGAAATGTGGGCCGGGCGCGG - Intronic
1021680102 7:23121589-23121611 CAAGAAATGGGGGCTCGGTGTGG - Intronic
1021795165 7:24247245-24247267 AAAGAAGTTTGGGATGGGTGGGG - Intergenic
1021864459 7:24941107-24941129 AAAGCAATGTTGGCCGGGTGCGG - Intronic
1021887390 7:25153032-25153054 TAAGAAGCATGGGCCAGGTGTGG - Intronic
1022309564 7:29183665-29183687 AAAAAATTCTGGGCCAGGTGTGG - Intronic
1022638597 7:32160549-32160571 AAAGGAATCTGGGCCAGGTGTGG + Intronic
1022732718 7:33045745-33045767 AAAAAAATGAGGGCCGGGTGCGG - Intronic
1022794046 7:33717964-33717986 AAAGAAGTATTGGCCGAGTGCGG - Intergenic
1023105029 7:36755660-36755682 AATTAATTGTGGGCCGGGTGTGG - Intergenic
1023398822 7:39776375-39776397 AAAGAAATGGAGGCCCGGAGTGG - Intergenic
1023484121 7:40666068-40666090 AAAGAAGGGAGGGCTGGGTGCGG + Intronic
1023500825 7:40847703-40847725 AAAGAAATGTGGGCCGGATGTGG - Intronic
1023975115 7:45023215-45023237 AAAGAAGTCTGGGCCGGGCATGG - Intronic
1025066022 7:55856780-55856802 AAACAAGTGCAGGCCAGGTGTGG + Intronic
1025103917 7:56155379-56155401 AAAGACATGGGGGCCAGGTGAGG + Intergenic
1025133823 7:56394115-56394137 AAAGAAATGGAGGCCCGGAGTGG + Intergenic
1025796671 7:64744486-64744508 AAAGAATTCAGGGCCGGGTGTGG + Intergenic
1026078732 7:67198254-67198276 AAGAAAATGTAGGCCCGGTGTGG + Intronic
1026150671 7:67785735-67785757 CACTAAGTGTGGGCCAGGTGTGG - Intergenic
1026499585 7:70932451-70932473 AAATAAAAGTGGGCCGGGTGCGG - Intergenic
1026844307 7:73689335-73689357 AAAAAAGTCTGGGCCGGGTGCGG - Intronic
1026960293 7:74403735-74403757 AAAGGAGTTGGGGCCGGGTGGGG - Intronic
1026962948 7:74420988-74421010 AAATAAATATGGGCCAGGTGCGG + Intergenic
1027045512 7:74988585-74988607 AAAGGAGCGTGGGCCGGGTGCGG - Intronic
1027291861 7:76722683-76722705 TAATAGGTGTGGGCCGGGTGCGG + Intergenic
1027919623 7:84376310-84376332 TAAGAAGTGTTGGCCGGGCGCGG + Intronic
1028404090 7:90457364-90457386 AAAAAAGTGTGGTCCAGGAGAGG + Intronic
1028775427 7:94670478-94670500 AAAGAAGTGGGGCCCAGATGAGG - Intergenic
1029011769 7:97269628-97269650 AAAAAAGTATTGGCCAGGTGTGG - Intergenic
1029060438 7:97792175-97792197 ACAGAAGTGCGGGCTGGGTGCGG - Intergenic
1029387303 7:100251914-100251936 AAAGGAGCCTGGGCCGGGTGCGG + Intronic
1029933299 7:104396451-104396473 AAAGCAGAGTGGGGCCAGTGAGG + Intronic
1030009833 7:105154961-105154983 GAATAAGGGTGGGCCAGGTGCGG - Intronic
1030186291 7:106765409-106765431 AAGGCAATGTGGGCCGGGTGTGG + Intergenic
1030204792 7:106942369-106942391 AAAAAAATGTGGGCCAGGCGTGG - Intergenic
1030234465 7:107243221-107243243 AAAGAAGTCTCGGCCTGGGGCGG + Intronic
1030605465 7:111634449-111634471 CGAGAAGTTTGGGCCAGGTGTGG - Intergenic
1031042941 7:116857693-116857715 AAAGAAGTGTTGGCTGGGCGTGG + Intronic
1031245919 7:119311194-119311216 AAAGAAGACTGGGCCAGGCGCGG + Intergenic
1031248768 7:119351480-119351502 TAACTAGTGTGGGCCAGGTGTGG - Intergenic
1031504077 7:122559478-122559500 TAAGAAGAGAGGGCCAGGTGCGG + Intronic
1031637787 7:124122410-124122432 AAATAAATGTGGGCCGGGTGCGG + Intergenic
1031656307 7:124360443-124360465 AAATAAGTGTGGGCTGGGTGTGG + Intergenic
1031825182 7:126556354-126556376 AAAAAAAAGTGGGCCAGGTGTGG + Intronic
1031970470 7:128061419-128061441 GAAGGAGTGTGGTCCCTGTGTGG + Intronic
1032071998 7:128813688-128813710 AAAGAATTCTAGGCCAGGTGCGG + Intronic
1032123988 7:129177949-129177971 AAAAAATTGTGGGCCAGGTGCGG - Intergenic
1032135271 7:129271070-129271092 AAAAAAGTTTGGGCCGGGCGTGG + Intronic
1032173133 7:129602159-129602181 AAATAAGTATGAGCCGGGTGCGG - Intergenic
1032974049 7:137201186-137201208 ATAGAAATTTGGGCCGGGTGCGG - Intergenic
1033148885 7:138895972-138895994 AGAGAAGTGGGGGCCGGGTGGGG - Intronic
1033190650 7:139275673-139275695 AAAGATCTGTTGGCCAGGTGTGG + Intronic
1033821390 7:145138800-145138822 AAAGATGTGTGGGCCGGGCACGG + Intergenic
1034121416 7:148631454-148631476 AAAGAAGAGGGGGCCAGGTGTGG + Intergenic
1034327328 7:150248370-150248392 AAAAAAGAGTAGGCCGGGTGCGG + Intronic
1034333712 7:150306554-150306576 AAACAACTGTGGGCCGGGTATGG + Intronic
1034624108 7:152479269-152479291 AAAGAAGTCTTGGCCGGGAGTGG - Intergenic
1034624851 7:152484776-152484798 AAAGCAGAGTAGGCCGGGTGCGG - Intergenic
1034664334 7:152803336-152803358 AAACAACTGTGGGCCGGGTATGG - Intronic
1034765881 7:153721079-153721101 AAAAAAGAGTAGGCCGGGTGCGG - Intergenic
1034920173 7:155073028-155073050 TAAGAATTGAGGGCCAGGTGCGG + Intronic
1035065082 7:156098467-156098489 AAAGAAGAGTGAGCCAGATGTGG - Intergenic
1035105688 7:156440243-156440265 AAAGAAGAGGGGGCCCTGTATGG + Intergenic
1035202180 7:157274751-157274773 AAAGAAGTGTGGGCCAGGCGCGG + Intergenic
1035312108 7:157975935-157975957 AAAGCAGTGTGGCCGAGGTGGGG + Intronic
1035904371 8:3493000-3493022 AAAGAGGTGTTGGCTGGGTGCGG + Intronic
1035907647 8:3531149-3531171 AAAGTAGTATGGGCCAGGTGTGG - Intronic
1036809150 8:11855308-11855330 TAAGATCTGTGGGCCTGGTGCGG - Intronic
1036954387 8:13171676-13171698 AAGGAAGTGTGGGCCGGCCGTGG - Intronic
1037382416 8:18300431-18300453 AAAGAAATCTCGGCCGGGTGTGG - Intergenic
1037452339 8:19028283-19028305 AAAAAAGGGTGGGCCGGGGGGGG - Intronic
1037627448 8:20620393-20620415 TAAAAAGTGTTGGCCGGGTGTGG + Intergenic
1037703300 8:21295164-21295186 GAAGAAGTGTGTTCCAGGTGGGG + Intergenic
1038189160 8:25303242-25303264 AAAGGAGCGTGGGCCAGGTGAGG - Intronic
1038533540 8:28337879-28337901 ATGGAAGTGTAGGCCGGGTGCGG - Intronic
1038632261 8:29257043-29257065 AAGGAATTGTAGGCCAGGTGTGG - Intronic
1038805086 8:30783015-30783037 AACAAAGTGTGGGCCAGGTGCGG - Intronic
1038829945 8:31045690-31045712 AAAATAGTGTGTGCCAGGTGAGG - Intronic
1038978009 8:32723389-32723411 AAAGAATTGTGGGTCAGGCGTGG + Intronic
1039927147 8:41945558-41945580 GAAGTACTGTGGGCCGGGTGTGG - Intronic
1039995298 8:42527113-42527135 AAAAAAAAGTGGGCCGGGTGTGG + Intronic
1040602117 8:48895872-48895894 AAATATGAGTGGGCCGGGTGTGG - Intergenic
1042034429 8:64515882-64515904 AAAAAAATTTGGGCCAGGTGTGG - Intergenic
1042194289 8:66219349-66219371 AAATGTGTGTGGGCCCCGTGAGG + Intergenic
1042403303 8:68374203-68374225 AAAGAATTATAGGCCAGGTGTGG - Intronic
1044410926 8:91881775-91881797 AAAGAAATGAGGGCCAGGTACGG + Intergenic
1044680048 8:94768701-94768723 TAAGATGTGTTGGCCAGGTGCGG + Intronic
1044700624 8:94962581-94962603 ACAGAAGTCTGGGCTAGGTGTGG - Intronic
1045025919 8:98086658-98086680 AAGGAAATGTGGGCCGGGTGCGG + Intronic
1045296224 8:100873662-100873684 AAAGAAATGTTGGCCGGGTGCGG + Intergenic
1045563067 8:103284277-103284299 TAAAAAGTTTGGGCCAGGTGTGG - Intergenic
1045735622 8:105293286-105293308 AAAGAAGAGTGGGCCTGGTGCGG + Intronic
1046148404 8:110191584-110191606 AAAGAGGAGGGGGCCAGGTGTGG - Intergenic
1046461484 8:114542744-114542766 AATGAAGGGAGGGCCAGGTGTGG + Intergenic
1046932172 8:119852643-119852665 GAAGAAATTTGGGCCAGGTGTGG - Intronic
1047039231 8:120974301-120974323 AAAGGAGAATGGGCCAGGTGTGG + Intergenic
1047177435 8:122554937-122554959 AAAGAAGCTGGGGCCAGGTGCGG - Intergenic
1047385521 8:124405754-124405776 AAAGAAGATTGGGCCAGGTGCGG - Intergenic
1048780373 8:137992598-137992620 CAAGAAGTTTAGGCCGGGTGTGG - Intergenic
1049156759 8:141072028-141072050 AAATAAGTGTGGGCCAGGCACGG - Intergenic
1049628652 8:143638882-143638904 AAAGAAGTGGGAGAACGGTGGGG - Intronic
1049634584 8:143680604-143680626 AAAGCTGTATGGGCCAGGTGCGG - Intergenic
1050326745 9:4505337-4505359 AAGGAAATATGGGCCGGGTGCGG - Intronic
1050523984 9:6529734-6529756 AAAGAAATATGGGTCGGGTGTGG - Intergenic
1050624863 9:7492629-7492651 TATAAAGTGTGGGCCGGGTGTGG + Intergenic
1050737696 9:8782884-8782906 AAAGAAGTGTAGGCCAGGCGTGG - Intronic
1050753814 9:8974804-8974826 AAAGATATTTGGGCCAGGTGTGG + Intronic
1050762375 9:9088295-9088317 AATGAAATCTGGGCCGGGTGCGG + Intronic
1051271173 9:15356295-15356317 AAAGAATTGTGGGCTGGGCGCGG - Intergenic
1051636186 9:19182942-19182964 AAATAAATTTTGGCCCGGTGCGG + Intergenic
1051720128 9:20028578-20028600 GAAGAAGTGAGGGCAGGGTGGGG - Intergenic
1051969737 9:22874029-22874051 AAGGAAATATGGGCCAGGTGTGG + Intergenic
1052171715 9:25406707-25406729 AAAGAAGAGTGGGCTGGGTGTGG + Intergenic
1052419540 9:28224352-28224374 AAAAAATTCTGGGCCAGGTGCGG - Intronic
1052611645 9:30783559-30783581 AAAGAAGTGTTGGGTCAGTGAGG - Intergenic
1052729371 9:32267085-32267107 AAAGAAGTTTTGGCTGGGTGCGG + Intergenic
1052757622 9:32557146-32557168 AAAAAAGTGGGGGCCAGGCGCGG - Intronic
1052869223 9:33486893-33486915 AAAGAAAAGAGGGCCGGGTGTGG - Intergenic
1052920723 9:33965756-33965778 CAGGGAGTGTGGGCCGGGTGCGG + Intronic
1052934008 9:34078187-34078209 AAAAAATTGGGGGCCGGGTGTGG - Intergenic
1052967780 9:34353962-34353984 AGTGAAGTGTAGGCCCGGCGCGG + Intergenic
1053214597 9:36259950-36259972 AAAGAAATCTGGGCCTGGTGTGG - Intronic
1053243588 9:36516571-36516593 AAAAAAGTCTGGACCGGGTGCGG - Intergenic
1053348460 9:37395446-37395468 AAAGAAGTGTGAGCACGTGGGGG + Intergenic
1053354165 9:37432387-37432409 AAAAAAGAGTGGGCCAGGCGTGG + Intronic
1053709530 9:40791622-40791644 AAAGAGTTTTGGGCCAGGTGCGG - Intergenic
1054419434 9:64912410-64912432 AAAGAGTTTTGGGCCAGGTGCGG - Intergenic
1054718448 9:68580651-68580673 AAAGAGATATGGGCCGGGTGTGG - Intergenic
1055340876 9:75281319-75281341 AAAGAATTGTTGGCCGGGCGCGG - Intergenic
1055944952 9:81685287-81685309 AAGGAAGTGTGGACCTGTTGGGG - Intronic
1055953289 9:81750811-81750833 AAAAAAGGATGGGCCTGGTGCGG - Intergenic
1056214597 9:84395291-84395313 GAAAAAGTTTGGGCCAGGTGTGG - Intergenic
1056399407 9:86212163-86212185 AAAAATGTTTGGGCCGGGTGTGG - Intergenic
1056510762 9:87302850-87302872 AAAGAAGACTTGGCCAGGTGTGG - Intergenic
1056526624 9:87448594-87448616 AAAACAGAGTGGGCCGGGTGTGG + Intergenic
1057029135 9:91760341-91760363 AAACAACTGTGGGCTAGGTGCGG + Intronic
1057062214 9:92015947-92015969 AAAGCAGTGTGGGCCGGGCACGG + Intergenic
1057715403 9:97491220-97491242 ACAGAAATGTGGGCTGGGTGTGG - Intronic
1058436988 9:104971987-104972009 AAACAAGTTTGGGCCAGGTGTGG + Intergenic
1058716017 9:107722544-107722566 AAAGAAGTAGGGGCCAGGAGTGG - Intergenic
1058783678 9:108364989-108365011 AAAGAAGTTTAGGCCGGGCGCGG + Intergenic
1059113212 9:111576798-111576820 AAAGAACTCTTGGCCAGGTGTGG + Intronic
1059175405 9:112165698-112165720 AATGAAGTGTATGCCAGGTGTGG - Intronic
1059677169 9:116550544-116550566 AAAACAGTGTGGGCAAGGTGGGG + Intronic
1060178651 9:121516313-121516335 AAAAGTGTGTGGGCCAGGTGTGG + Intergenic
1060330152 9:122660773-122660795 AAAGAAATGTTGGCCGGGTGCGG + Intergenic
1060514247 9:124256067-124256089 TAAGAAGTTTGGGCCGGGCGCGG - Intergenic
1060655279 9:125368256-125368278 ATTGAAGAGTGGGCCGGGTGCGG - Intergenic
1060791319 9:126487467-126487489 AAACAGGTCTGGGCCAGGTGTGG + Intronic
1060856628 9:126918958-126918980 ATCCATGTGTGGGCCCGGTGCGG - Intronic
1061098594 9:128474670-128474692 AAACATGTCTGGGCCAGGTGCGG + Intronic
1061100341 9:128487235-128487257 AGAGAAGTGTGGGCTGGGTGTGG - Intronic
1061647212 9:132013913-132013935 AAATAATTCTGGGCCGGGTGTGG + Intronic
1062382169 9:136291724-136291746 CAAGGAGTGTGGGGGCGGTGAGG + Intronic
1185559062 X:1044653-1044675 AAAAAAGTTTAGGCCAGGTGCGG - Intergenic
1185661306 X:1731034-1731056 AAAAAAGGGTCGGCCGGGTGCGG + Intergenic
1185906696 X:3940044-3940066 AAATAAGTGTGGGCCGGGCGTGG - Intergenic
1185936343 X:4261442-4261464 AAAGAAATCTGGGCTGGGTGCGG - Intergenic
1186015651 X:5189690-5189712 TTAGAAGAGTGGGCCGGGTGTGG - Intergenic
1186438414 X:9564127-9564149 AAAGATGTTTGGGCCGGGCGTGG + Intronic
1186496021 X:10013931-10013953 AAAGAAGAATGGGCCGGGCGCGG - Intergenic
1186771869 X:12826355-12826377 AAAAAAAAGTGGGCCGGGTGCGG + Intergenic
1186812727 X:13206132-13206154 AAAGAAGTGTGTGCACAGGGTGG - Intergenic
1186983429 X:14984312-14984334 AAAAGAGTGAGGGCCAGGTGCGG + Intergenic
1187051517 X:15701204-15701226 TAAGAAGTCTAGGCCGGGTGCGG + Intronic
1187058114 X:15760042-15760064 AAGAAAGTGTTGGCCGGGTGCGG - Intronic
1187353163 X:18540975-18540997 AAAGAACTGTCGGCCGGGCGTGG - Intronic
1187842251 X:23500732-23500754 AAAGAAAAGTTGGCCAGGTGCGG - Intergenic
1188088148 X:25928301-25928323 TAAGATGTGTAGGCCCGGCGCGG - Intergenic
1188353454 X:29160761-29160783 AAAAAAGTGTGGGCCGGGTTGGG + Intronic
1188396095 X:29685694-29685716 ACAGAAGTATTGGCCAGGTGCGG + Intronic
1188617041 X:32170178-32170200 AAGAAAGAGTGGGCCAGGTGTGG + Intronic
1188660061 X:32748050-32748072 GAAAAAGTGTAGGCCAGGTGTGG + Intronic
1189393803 X:40602358-40602380 AAAGAAGAGGAGGCCGGGTGCGG + Intronic
1189433473 X:40970230-40970252 AAAGATATGTGGGCCAGATGCGG - Intergenic
1189674034 X:43443007-43443029 AAGGCAGTCTGGGCCAGGTGTGG + Intergenic
1190311365 X:49119245-49119267 AAAGAAATTAGGGCCGGGTGTGG - Intronic
1190378908 X:49818811-49818833 AAAGAAAAGTTGGCCAGGTGTGG + Intergenic
1190689596 X:52902348-52902370 GAAGAAATGTGAGCCGGGTGTGG - Intronic
1190696387 X:52953444-52953466 GAAGAAATGTGAGCCGGGTGTGG + Intronic
1190754746 X:53391773-53391795 AAATAAATGTTGGCCAGGTGTGG - Intronic
1190852892 X:54264041-54264063 AAAAAAATTTGGGCCAGGTGTGG + Intronic
1191048681 X:56167417-56167439 AAAGTAATGTGGGCCAGGCGTGG - Intergenic
1192311814 X:70022624-70022646 AAAGAAATGTCGGCCGGGGGTGG - Intronic
1192327067 X:70142040-70142062 AGAGAAGAGTAGGCCAGGTGTGG + Intronic
1192464551 X:71344947-71344969 AAATAATTGTTGGCCGGGTGCGG - Intergenic
1192605000 X:72507137-72507159 AAAGAAATGTTGGCCAGGTGTGG - Intronic
1193123774 X:77850183-77850205 AAGAAAGTGGGGGCCGGGTGAGG + Intronic
1193591724 X:83396555-83396577 AAAGAAGCTTGGGCCGGGCGCGG + Intergenic
1193659661 X:84241612-84241634 AAAAAACTGTGGGCCTGGTGCGG - Intergenic
1194222728 X:91215299-91215321 TAAGAAGTGTCGGCCGGGCGCGG - Intergenic
1195040083 X:101005928-101005950 AAAAGAATGTGGGCCAGGTGCGG + Intergenic
1196263958 X:113619590-113619612 AAAGTACTATGGGCCAGGTGCGG - Intergenic
1196648024 X:118139290-118139312 AAAGAAGAGTTGGCTAGGTGCGG - Intergenic
1196722043 X:118863646-118863668 ATAGAAGTGTTAGCCAGGTGCGG + Intergenic
1197740832 X:129892311-129892333 ATAGAATTCTGGGCCAGGTGTGG - Intergenic
1199636671 X:149819977-149819999 AAAGCAGTTGGGGCCAGGTGCGG + Intergenic
1199835115 X:151582271-151582293 AAAAAAGCGGGGGCCAGGTGCGG - Intronic
1200848911 Y:7862240-7862262 AAAGAAGAGTCAGCCAGGTGTGG + Intergenic
1201665040 Y:16442188-16442210 AAAGAAGAGTGGTCCAGGTGTGG + Intergenic
1201894213 Y:18976563-18976585 AAATAAGTGTGGGCTGGGTGCGG + Intergenic
1202037912 Y:20654182-20654204 AAAGAAGTGGCGGCCGGGCGCGG + Intergenic