ID: 1084746140

View in Genome Browser
Species Human (GRCh38)
Location 11:71171226-71171248
Sequence CAGAGTCCCCGCGATGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084746131_1084746140 25 Left 1084746131 11:71171178-71171200 CCAGGAAATGTATACAGACACAT 0: 1
1: 0
2: 3
3: 22
4: 290
Right 1084746140 11:71171226-71171248 CAGAGTCCCCGCGATGACAGAGG 0: 1
1: 0
2: 2
3: 4
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084746140 Original CRISPR CAGAGTCCCCGCGATGACAG AGG Intronic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
902762091 1:18588224-18588246 CATTGTCCCCGCGGTGACATAGG + Intergenic
903374288 1:22856139-22856161 CAGAGTCCCTGGGAGGAGAGGGG + Intronic
904001535 1:27341727-27341749 CAGAGTCCCTGCTCTGCCAGTGG - Intergenic
904011279 1:27391996-27392018 CAGGGACCCCGGGATGGCAGAGG - Intergenic
912945809 1:114083156-114083178 GTGAGTCCCTGAGATGACAGAGG - Intergenic
918518896 1:185392842-185392864 CTGAGTCCCTGGGATTACAGGGG + Intergenic
918851356 1:189694501-189694523 CAGCCTCCCCTCGATGGCAGAGG + Intergenic
1062985002 10:1760296-1760318 CAGAGTACCTGGGATTACAGTGG + Intergenic
1066431114 10:35352740-35352762 CAGAGTCCCCTGGATGGCAGAGG + Intronic
1070976701 10:80611047-80611069 CTGAGTACCTGGGATGACAGGGG - Intronic
1074687143 10:115971663-115971685 CGGAGTCCAGGCAATGACAGTGG + Intergenic
1074829654 10:117240123-117240145 CAGAGCTCCAGCGATGTCAGAGG + Intergenic
1076228195 10:128797878-128797900 AAAAGTCCCCGTGAGGACAGAGG + Intergenic
1076848829 10:133083013-133083035 CAGAGCCCCCGAGAGGACACAGG - Intronic
1076869662 10:133187168-133187190 CAGCGTCCCCGCGGAGGCAGCGG - Intronic
1079330168 11:19526668-19526690 CAGAGTCCCCAGGATGGCTGGGG + Intronic
1084746140 11:71171226-71171248 CAGAGTCCCCGCGATGACAGAGG + Intronic
1085600836 11:77854783-77854805 CAGAGTCCCCACTGGGACAGTGG - Intronic
1091286730 11:134412196-134412218 CAGAGTCCCCGAGGTGGCGGCGG + Intergenic
1091452710 12:583510-583532 AACAGTCACAGCGATGACAGGGG - Intronic
1094852826 12:34389929-34389951 CAGAGTCCCCCCCCCGACAGGGG + Intergenic
1096588868 12:52644108-52644130 CAGAGCCCCCGCAGAGACAGAGG + Intergenic
1103623712 12:122203915-122203937 CAGGGTCCCCGCGAGGACGCCGG + Intronic
1103874506 12:124116689-124116711 CCGAGTCGCCGGGATTACAGAGG + Intronic
1104809535 12:131611974-131611996 CAGGATCCCCACGATGTCAGCGG - Intergenic
1110797234 13:79653470-79653492 CAAAGTCCCCGCCCTTACAGAGG + Intergenic
1114623555 14:24114096-24114118 GAGAGGCACCGCGAGGACAGAGG + Intronic
1114736596 14:25049518-25049540 CACCGTCCCCGCGATGGCATGGG - Intronic
1117040370 14:51763780-51763802 CACAGTCCCCAAGATGACTGTGG - Intergenic
1118760503 14:68878065-68878087 CAGAGTCACCGCCAGGACAGAGG + Intronic
1118951441 14:70439692-70439714 CAGAGTCCCCGGGTTTAAAGGGG + Intergenic
1119290036 14:73488394-73488416 CAGAGTAGCTGGGATGACAGGGG + Intronic
1122024639 14:98866929-98866951 CACAGTCACTGTGATGACAGTGG - Intergenic
1122059145 14:99124935-99124957 CAGAGTCCCTTCAATGGCAGAGG + Intergenic
1125499153 15:40227552-40227574 CAGAGTCCCAGCGAGTCCAGGGG + Intergenic
1132014780 15:98305835-98305857 CAGAATCCCCCAGATCACAGGGG + Intergenic
1132462821 16:63798-63820 CTGAGTCCCTGCCATGCCAGGGG - Exonic
1134843852 16:17423487-17423509 CACAGTCCCAAGGATGACAGGGG - Intronic
1142009739 16:87707751-87707773 CAGAGGCCCCGGGAAGACTGCGG + Intronic
1142697293 17:1640464-1640486 CAGGGTCACAGCGCTGACAGTGG + Exonic
1144640283 17:16933083-16933105 CAGGGTCTCCACGAGGACAGAGG - Intronic
1147176409 17:38658787-38658809 CAGAGCCCCAGACATGACAGGGG + Intergenic
1150489103 17:65562060-65562082 CCGAGTCCGCCCTATGACAGCGG - Intronic
1151815321 17:76468808-76468830 CCGAGTCCCCGAGCTGTCAGCGG + Exonic
1155073504 18:22336185-22336207 CAGAGTCCCCACCAAGACAGGGG - Intergenic
1157259393 18:46165438-46165460 CAGAGCTCCCAAGATGACAGTGG - Intergenic
1159917822 18:74201996-74202018 CAGAGGCCAGGCGAGGACAGAGG + Intergenic
1162863696 19:13527492-13527514 CAGAGACCACATGATGACAGAGG + Intronic
1163059672 19:14751482-14751504 CGGAGTCCCAGCTGTGACAGTGG - Exonic
1164709566 19:30345790-30345812 CCTAGTCCCCGGGATGACACTGG - Intronic
1165772376 19:38386950-38386972 CAGAGTCCCCGCGGGGGCCGGGG + Exonic
1167539132 19:50074270-50074292 CAGAGGCCCCCAGATGGCAGGGG + Intergenic
925109149 2:1318907-1318929 CTGAGCCCCGGGGATGACAGAGG - Intronic
927562459 2:24083725-24083747 GAGAGTCCCGGAGCTGACAGCGG - Intronic
928404806 2:31006573-31006595 CAAAGTCCCTGCCATGATAGGGG + Intronic
948465386 2:238149494-238149516 CCGAGTCCCCTTGAGGACAGGGG + Intronic
1170800671 20:19587507-19587529 CACAGTCCACGCGATGACTCTGG + Intronic
1171458360 20:25284333-25284355 CACAGCCCCCACCATGACAGAGG - Intronic
1172835484 20:37870419-37870441 CAGAATCCCCGCAAGGACTGGGG - Intronic
1174454653 20:50640601-50640623 CTGTGTCCCCGAGATGACAGAGG - Intronic
1174472147 20:50769121-50769143 CTGTGTCCCCAAGATGACAGAGG + Intergenic
1178261560 21:31104735-31104757 CAGAGCCCCAGCAATGAGAGTGG - Intergenic
1178433149 21:32534248-32534270 CAGAGCCCCCGCTATGACCCGGG + Intergenic
1179025437 21:37675480-37675502 GAGGGTCCCCGCGATGACAGTGG - Intronic
1183517632 22:38276350-38276372 CAGAGGCCCCGGGCTGGCAGGGG + Intergenic
1183605255 22:38864058-38864080 CACAGTGCCTGCGATGCCAGGGG + Exonic
1185344884 22:50306851-50306873 CTGAGACCCCCAGATGACAGGGG + Intronic
949877130 3:8633776-8633798 CAGAGTCCCTGCGATGACGGAGG - Exonic
950012218 3:9731809-9731831 CAGAGGCAGCGCGAGGACAGCGG - Exonic
950097032 3:10336495-10336517 CAGGGTCCCCGGGAGGACACAGG + Intronic
954863278 3:53708028-53708050 CAGAGTCCCCGGGCAGGCAGGGG - Intronic
955314385 3:57923709-57923731 CAGTGTCCAAGCCATGACAGTGG - Intronic
968001316 3:195208820-195208842 CAGAGTCCCCGGGAGGTCACTGG + Intronic
988227380 5:28429675-28429697 CTGAGTACCTGGGATGACAGGGG + Intergenic
990393654 5:55354723-55354745 CAGAGTCCCTGCTAGCACAGAGG - Intronic
997057327 5:130460057-130460079 CAGAGTCCCCACTGTGACATGGG + Intergenic
999124991 5:149240047-149240069 CTGAGTCCCTGAGATGGCAGGGG + Intronic
1002389282 5:178896421-178896443 CAGAATCCCCGGGATGTCCGCGG - Intronic
1006411168 6:33874365-33874387 CAGAGCCGCAGCGAGGACAGAGG + Intergenic
1016994867 6:149954567-149954589 CAAAGTCCCCGCGAGGATGGAGG + Intergenic
1021242502 7:18221229-18221251 CAGAGTAGCCGAGATTACAGGGG + Intronic
1023622449 7:42087140-42087162 CTGAGGCCACGCAATGACAGTGG + Intronic
1027190602 7:75993885-75993907 CAGAGTCCCTCCGAGGCCAGTGG - Intronic
1029850853 7:103460363-103460385 TAGACTCCCCACAATGACAGTGG - Intergenic
1034527656 7:151675815-151675837 CAGAGGTCCCGCCATGGCAGAGG + Intronic
1049163615 8:141112841-141112863 CAGAGTCCCCGGGATGAAGCGGG + Intergenic
1049294794 8:141826719-141826741 CAGAGTCTCACCGATGACATGGG - Intergenic
1049441036 8:142609945-142609967 CAGAGTCCCCCCAAAGTCAGGGG + Intergenic
1053415402 9:37944187-37944209 CAGAGCCCCCTCCATGGCAGGGG - Intronic
1054190809 9:61984701-61984723 CAGACTCACCGCTATGACACAGG - Intergenic
1055030569 9:71768732-71768754 GAGCGTCCCCGCGACAACAGGGG + Exonic
1057330362 9:94108794-94108816 TGGAGTCCCCGGGAGGACAGAGG - Exonic
1060052727 9:120388589-120388611 CATTGTTCCCGTGATGACAGGGG - Intergenic
1062191780 9:135251561-135251583 AAGAGGCCCCGGGATGACACAGG - Intergenic
1062210237 9:135359717-135359739 CAGAGGCCCTGTGAAGACAGAGG + Intergenic
1062634641 9:137484494-137484516 CCGCGTCCCCTCGAAGACAGAGG + Intronic
1203444767 Un_GL000219v1:44901-44923 CAGAGTCCCCGCGCAAACCGGGG - Intergenic
1189630061 X:42943259-42943281 CAGAGTCTCCGCCCTGCCAGTGG - Intergenic
1191898185 X:66015512-66015534 CAGAGTCCCCTCCATGACCAAGG + Intergenic
1192146867 X:68688249-68688271 CAGAGGCCCCAGGATGACATCGG - Intronic
1201539544 Y:15091145-15091167 CAGAGTCCCCAGGTTGAAAGAGG + Intergenic