ID: 1084746346

View in Genome Browser
Species Human (GRCh38)
Location 11:71172253-71172275
Sequence CGTCAACCTCAAGAATGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084746339_1084746346 15 Left 1084746339 11:71172215-71172237 CCTGACCTCACACAAGGAGAAGG 0: 1
1: 0
2: 2
3: 31
4: 247
Right 1084746346 11:71172253-71172275 CGTCAACCTCAAGAATGCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 77
1084746336_1084746346 27 Left 1084746336 11:71172203-71172225 CCAGCTCTCTTCCCTGACCTCAC 0: 1
1: 0
2: 10
3: 63
4: 600
Right 1084746346 11:71172253-71172275 CGTCAACCTCAAGAATGCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 77
1084746341_1084746346 10 Left 1084746341 11:71172220-71172242 CCTCACACAAGGAGAAGGAGCGT 0: 1
1: 0
2: 1
3: 5
4: 104
Right 1084746346 11:71172253-71172275 CGTCAACCTCAAGAATGCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 77
1084746338_1084746346 16 Left 1084746338 11:71172214-71172236 CCCTGACCTCACACAAGGAGAAG 0: 1
1: 0
2: 7
3: 19
4: 190
Right 1084746346 11:71172253-71172275 CGTCAACCTCAAGAATGCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084746346 Original CRISPR CGTCAACCTCAAGAATGCAG GGG Intronic
902837215 1:19054769-19054791 TGCGAACCTCAAGAATGCACTGG - Intergenic
903843828 1:26264750-26264772 CCTCAACATCAAGAATCCAAAGG - Intronic
909328262 1:74380358-74380380 CTTCAACCACAAGAACGCACTGG - Intronic
910289925 1:85589611-85589633 CCCCAACCCCAAGAATGCTGTGG - Intergenic
914843785 1:151269062-151269084 AGTAGACCTCAAGAGTGCAGAGG - Intergenic
918021136 1:180692281-180692303 GGTTAACCCCAAGAATGAAGTGG + Intronic
921053627 1:211528002-211528024 GGCCAAGCTCAAGAAGGCAGTGG - Intergenic
921109340 1:212017486-212017508 CCTCAAGATCAAGAAAGCAGTGG + Intronic
1072702929 10:97657261-97657283 CATCTACCTCAAGAAGTCAGAGG - Intronic
1073830824 10:107380886-107380908 AGTCACCCTCAACAATGCAGAGG - Intergenic
1076348825 10:129800778-129800800 CCTTAACCTCAAGCAGGCAGGGG + Intergenic
1076827562 10:132976976-132976998 GGTCATCCCCAAGACTGCAGGGG - Intergenic
1084746346 11:71172253-71172275 CGTCAACCTCAAGAATGCAGGGG + Intronic
1088256041 11:107904388-107904410 AGTCATCCACAGGAATGCAGTGG + Intronic
1102182682 12:110924074-110924096 CATCAGCCTCAAGACTGCGGGGG + Intergenic
1109238350 13:59851531-59851553 TGTAAACTTCAAGAAAGCAGAGG + Intronic
1113194721 13:107788678-107788700 GGGCAAGCTCCAGAATGCAGGGG + Intronic
1117567566 14:57010732-57010754 TGTCAACCTCAAAAATCCTGTGG + Intergenic
1131875438 15:96801408-96801430 CGTCAAAATCAAGAATACACAGG + Intergenic
1135991331 16:27220550-27220572 CGTCAACCTGAAGAAAGCAAAGG - Exonic
1138057392 16:53849509-53849531 CCTCACCCTCAAGAATCCATTGG - Intronic
1138358455 16:56405489-56405511 GGTAAACCTCAAGATTGTAGGGG - Intronic
1143373913 17:6456313-6456335 CCCCACCCTCAAGAATCCAGAGG - Intronic
1154409212 18:14127423-14127445 TGTAACCCCCAAGAATGCAGAGG - Intronic
1163396910 19:17069250-17069272 CGGCAGCCTCAAGCATGCATGGG + Intronic
1164753505 19:30672897-30672919 GGACAACCTCAAGAAAGCTGCGG + Intronic
928495542 2:31828366-31828388 CCTCAAACTCAATAATGCTGTGG + Intergenic
1175500196 20:59444650-59444672 CGTCAACCTCAGCAATGCTTAGG - Intergenic
1176162676 20:63656154-63656176 AGTTAATTTCAAGAATGCAGAGG - Intergenic
1176220461 20:63967118-63967140 CCTCAACCTCGGGACTGCAGTGG + Intronic
1176712641 21:10167076-10167098 TGACAAGCTCAAGAATTCAGAGG + Intergenic
1176864008 21:14032466-14032488 TGTAACCCCCAAGAATGCAGAGG + Intergenic
1177681112 21:24372734-24372756 AGTCAAACTCATGAAAGCAGGGG + Intergenic
1179819752 21:43929921-43929943 CATTAACCTCATAAATGCAGCGG + Intronic
1180319585 22:11308088-11308110 CGTGAACCGCTGGAATGCAGGGG + Intergenic
1180796211 22:18607006-18607028 TGCCAACCTCAAGGCTGCAGAGG - Exonic
1181063208 22:20291865-20291887 CGTCAACCACAAAGATGCATGGG + Intergenic
1181225511 22:21388265-21388287 TGCCAACCTCAAGGCTGCAGAGG + Exonic
1181253122 22:21546548-21546570 TGCCAACCTCAAGGCTGCAGAGG - Exonic
955068875 3:55555721-55555743 CGTCAGCTTCATGAAGGCAGGGG - Intronic
960132001 3:114066848-114066870 CTTGAACCTCAAACATGCAGGGG + Intronic
965829166 3:172763979-172764001 CATCAACTCCAAGAAGGCAGGGG - Intronic
968313219 3:197701086-197701108 CGGAAACCTCAAGAAAGCAGAGG - Exonic
968393958 4:215961-215983 TGTAATCCCCAAGAATGCAGAGG + Intergenic
968410990 4:389795-389817 TGTAATCCCCAAGAATGCAGAGG + Intergenic
969668036 4:8573486-8573508 CCTCAGCCTCAAGCAAGCAGTGG + Intronic
970301585 4:14686616-14686638 CATCAACCTTAACCATGCAGGGG - Intergenic
973016565 4:45146792-45146814 TGACAAGCTCAAGAATTCAGAGG - Intergenic
979560421 4:122095624-122095646 TGACAACATCAAGAATGCAAGGG + Intergenic
982855082 4:160371698-160371720 GCTTAACTTCAAGAATGCAGTGG + Intergenic
985916199 5:2920728-2920750 GGTCATCCTGAAGAATGTAGAGG - Intergenic
992508957 5:77414836-77414858 CCTCTAACTCAAGACTGCAGAGG - Intronic
993945572 5:94113626-94113648 TGTCAAAATCAAGAATGAAGAGG + Intergenic
995606930 5:113866902-113866924 CCACAACTTCAAGAAAGCAGGGG - Intergenic
997610689 5:135213590-135213612 CGTCACCCATAAGACTGCAGGGG - Intronic
999598606 5:153234708-153234730 GGTCAACCTCAAATATTCAGTGG + Intergenic
1001671795 5:173479802-173479824 GGTCAATCTCCAGCATGCAGAGG + Intergenic
1017961513 6:159226064-159226086 CCTCAGCCTCAGGAAAGCAGAGG - Intronic
1021935841 7:25630473-25630495 CCTCAACCTCAACCAGGCAGCGG - Intergenic
1027456760 7:78401978-78402000 ATTCAACCTCTAGAGTGCAGAGG + Intronic
1027743735 7:82046364-82046386 CGTCAACTTGAAGAGTGGAGTGG - Intronic
1028963994 7:96781096-96781118 CATCGACCTCAAGAGTGCCGTGG + Intergenic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1031603195 7:123738407-123738429 TGTCAAGCTCAAGATTACAGAGG - Intronic
1033335120 7:140445629-140445651 CCTAAACCTCAAGATTTCAGGGG - Intergenic
1033451555 7:141466505-141466527 CGTCAACCTCAAGGAAACTGTGG - Intronic
1041977044 8:63811421-63811443 CATCAACTTCAAGATTTCAGTGG - Intergenic
1043308348 8:78825355-78825377 AGTTAACCTCAAGCATGGAGTGG - Intergenic
1044511229 8:93081619-93081641 CTTCAACCTGGAGAATGCACTGG + Intergenic
1052727477 9:32246447-32246469 CTGCAACCTGAAGAATGGAGAGG - Intergenic
1053649646 9:40152877-40152899 TGACAAGCTCAAGAATTCAGAGG + Intergenic
1053756105 9:41311070-41311092 TGACAAGCTCAAGAATTCAGAGG - Intergenic
1054330158 9:63744640-63744662 TGACAAGCTCAAGAATTCAGAGG + Intergenic
1054534935 9:66223327-66223349 TGACAAGCTCAAGAATTCAGAGG - Intergenic
1055605181 9:77961926-77961948 CCACCACCTCAAGAATGTAGAGG + Intronic
1055960288 9:81814078-81814100 GCTCAAACTCAAGGATGCAGAGG - Intergenic
1202797388 9_KI270719v1_random:136066-136088 TGACAAGCTCAAGAATTCAGAGG + Intergenic
1203367816 Un_KI270442v1:273838-273860 CGTGAACCGCTGGAATGCAGGGG + Intergenic
1187245726 X:17551453-17551475 CATCAACATCAAGACTGCTGGGG - Intronic
1189049177 X:37626211-37626233 CCTCATCCTCAAGATGGCAGTGG + Intronic
1194257388 X:91651906-91651928 CCTCAAGCTCAATAATTCAGTGG + Intergenic
1200576045 Y:4890852-4890874 CCTCAAGCTCAATAATTCAGTGG + Intergenic