ID: 1084748159

View in Genome Browser
Species Human (GRCh38)
Location 11:71186446-71186468
Sequence CTCTATCCCCCAACCTATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084748156_1084748159 -1 Left 1084748156 11:71186424-71186446 CCATGTTGGAGACACTGACAACC 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1084748159 11:71186446-71186468 CTCTATCCCCCAACCTATGGAGG 0: 1
1: 0
2: 0
3: 8
4: 93
1084748155_1084748159 7 Left 1084748155 11:71186416-71186438 CCAGGAGTCCATGTTGGAGACAC 0: 1
1: 0
2: 0
3: 16
4: 134
Right 1084748159 11:71186446-71186468 CTCTATCCCCCAACCTATGGAGG 0: 1
1: 0
2: 0
3: 8
4: 93
1084748152_1084748159 27 Left 1084748152 11:71186396-71186418 CCTTAAGGTCTATCAGTCATCCA 0: 1
1: 0
2: 0
3: 10
4: 109
Right 1084748159 11:71186446-71186468 CTCTATCCCCCAACCTATGGAGG 0: 1
1: 0
2: 0
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084748159 Original CRISPR CTCTATCCCCCAACCTATGG AGG Intronic
903775981 1:25794140-25794162 CTCTTTCCCCCAACCAACTGGGG + Intergenic
904044453 1:27601714-27601736 GTCTGTCCCCCAACCTGGGGTGG - Intronic
906001300 1:42428013-42428035 CTCTATCGCCCAGCCTAGAGTGG - Intergenic
907409517 1:54274538-54274560 CTCCTGCCCCCAACCTATGTGGG + Intronic
911126708 1:94347288-94347310 CTGTATCCCCCGTCCTCTGGTGG + Intergenic
912723769 1:112041574-112041596 CTCTCTCCCCCGGCATATGGAGG + Intergenic
913527985 1:119712276-119712298 CTCTACCCCCCAATCTCAGGAGG - Intronic
916649183 1:166819147-166819169 TTCTTTCCCCCAGCTTATGGTGG - Intergenic
919282025 1:195502748-195502770 ATCTAGCCCCCAACCAACGGGGG + Intergenic
920648828 1:207822018-207822040 CTCCCTCCCCCAACCAAAGGCGG + Intergenic
921725549 1:218519503-218519525 CTCTCTCCCCCAACCTCTCCAGG - Intergenic
923183892 1:231550707-231550729 CTCTCTCCTCCAACCAATAGGGG - Intronic
1064143317 10:12807954-12807976 CTGTATTCCCCACCCTAAGGTGG - Intronic
1073799513 10:107026039-107026061 CTCAATCCTGCAACCTATGGTGG - Intronic
1074686300 10:115965234-115965256 CTCTGCCACCCATCCTATGGCGG - Intergenic
1076428377 10:130383488-130383510 CTCCATCCTTCAATCTATGGGGG + Intergenic
1076739777 10:132477488-132477510 CTGGAGCCCCCAACCAATGGGGG - Intergenic
1076830503 10:132992093-132992115 TTCCATCCCCCAAGCAATGGAGG + Intergenic
1077507098 11:2934821-2934843 CCCCATCTCCCAACCTCTGGAGG - Intergenic
1078092857 11:8278081-8278103 CTCTCTCCCTCAATCTCTGGTGG + Intergenic
1083593998 11:63910410-63910432 ATCTGTCCCCCACCCTGTGGAGG - Exonic
1084748159 11:71186446-71186468 CTCTATCCCCCAACCTATGGAGG + Intronic
1088608773 11:111557056-111557078 CTCTTTCCCCCATCCCATCGTGG + Intronic
1092712222 12:11351399-11351421 CTCCATCCCCTGACCTCTGGTGG - Intergenic
1095298935 12:40559684-40559706 CTCTATCTCCCAATCTTTGTGGG - Intronic
1098018155 12:66128190-66128212 CTCAATCTCCCAACCTTAGGGGG - Intronic
1099566381 12:84253112-84253134 CTCTATCCCATAACCTAGTGTGG + Intergenic
1101125771 12:101632448-101632470 CCCTATCCCCAAACCTAAGTGGG - Intronic
1103725980 12:122997572-122997594 CACTGTCCCCCAACCCATGCAGG - Exonic
1104289497 12:127455358-127455380 CTCCAACCCCCAGCCTATGTGGG - Intergenic
1107684913 13:42887097-42887119 CTCAATCCCCCAGCCTGTGTTGG - Exonic
1110713233 13:78672930-78672952 CTCTCTCCCCCAAGCCAGGGTGG + Intergenic
1111758336 13:92428159-92428181 TCCTGGCCCCCAACCTATGGCGG + Intronic
1119530267 14:75355159-75355181 CTCTATCTCCAAACATTTGGTGG - Intergenic
1121063066 14:90934764-90934786 ATTTACCCCCCAACCTTTGGAGG + Intronic
1122577359 14:102750770-102750792 CTCCATCCCCCAACCTGCAGTGG - Intergenic
1131353403 15:91722056-91722078 CCCTACCCCTCAACCTGTGGGGG - Intergenic
1146629588 17:34460229-34460251 CTGGATCCCCCAGCCTAAGGGGG - Intergenic
1149654106 17:58301378-58301400 CTCCATCCCCCACCCTCTGAGGG - Intronic
1149659076 17:58324999-58325021 CCCTGTCCCCCAACCTCAGGAGG - Exonic
1152260311 17:79263178-79263200 CTGCCTCCCCCAACCTTTGGAGG + Intronic
1156048215 18:32901092-32901114 TCCTGTCTCCCAACCTATGGGGG - Intergenic
1156103046 18:33621652-33621674 CTCTCTCCACCAACCCATGGTGG - Intronic
1166816370 19:45548602-45548624 CTCTCTGCCCCACCCTATGCTGG - Intronic
1167132893 19:47599249-47599271 CTCTATCCCCCAAACGCTGCGGG + Intergenic
1168060452 19:53889274-53889296 TTCAATCCCCCAACTTCTGGTGG + Intronic
925181086 2:1817305-1817327 CCCTATCCCCCCACCCATGGGGG - Intronic
927296770 2:21463892-21463914 CTCTAACCCCCAACATGAGGGGG + Intergenic
928785169 2:34875424-34875446 CTGTATCCTCCAACATATTGAGG - Intergenic
934662435 2:96150266-96150288 CTGTGGCCCCCAACCGATGGGGG + Intergenic
934737126 2:96695276-96695298 CGCTGTCCCCCAACCCATGAGGG - Intergenic
935946402 2:108290197-108290219 CCCTCACCCCCACCCTATGGAGG + Intronic
937394186 2:121520293-121520315 CCCTGTCCCCCACCCTAGGGCGG - Intronic
937547652 2:123043464-123043486 CTATAACCACCAACCTATAGTGG - Intergenic
938212280 2:129478628-129478650 GTCTGTCCCCCCACCTTTGGGGG - Intergenic
938994855 2:136667612-136667634 CTCTCTGCACCAACCTATGCTGG + Intergenic
945605079 2:211919034-211919056 CTCCCTCCCCCAGCCCATGGAGG + Intronic
946331313 2:219010614-219010636 CTGTGTCCCCCATCATATGGGGG + Exonic
946337042 2:219044787-219044809 CTCTATCCCCCACCCTAGACTGG - Intergenic
1169064887 20:2689599-2689621 ATCTATCCCCCAATCTATCTTGG + Intergenic
1172946012 20:38690142-38690164 CTCTCTCCCCCAAGCTAAAGAGG + Intergenic
1176055190 20:63141504-63141526 CTCTTTCCCTCAAGCTTTGGTGG + Intergenic
1178488103 21:33031412-33031434 CTCTAACTCCCAACCTCAGGTGG - Intergenic
1178510566 21:33201823-33201845 CCCTATCCCCCAACCCAGAGGGG - Intergenic
1179119283 21:38528053-38528075 CTCTCTCCCCCAGCTTCTGGGGG + Intronic
1179188363 21:39102698-39102720 CTCTGTCACCCAAGCTGTGGGGG - Intergenic
1182990563 22:34763568-34763590 CTCTCTGCCCCAACCTGTGGAGG + Intergenic
952432252 3:33234968-33234990 CCCTGTCCCCCAACCTACGGTGG - Intergenic
952515786 3:34103861-34103883 CTCCATCCCCCAGCCTACTGGGG - Intergenic
952671992 3:35980592-35980614 CTCTGTCACCCAATCTAGGGGGG + Intergenic
953017983 3:39096782-39096804 TTTTATCCTCCAACTTATGGGGG + Exonic
954983409 3:54767328-54767350 CTCTACCCCTCAATCTAGGGAGG + Intronic
956860356 3:73317261-73317283 CTCTGTCCCCCAAGATATGAAGG + Intergenic
958522659 3:95211421-95211443 CTCTATCTCCCAGCCCATGTGGG - Intergenic
966564491 3:181361445-181361467 GTCTATCCCCAAACCTATCGAGG + Intergenic
966679749 3:182629280-182629302 CCTTATCTCCCAAGCTATGGGGG + Intergenic
969217603 4:5734810-5734832 CTCTATCCCCAGCCCCATGGAGG + Intronic
971726494 4:30320023-30320045 CTCTACTCCCCAACTCATGGTGG + Intergenic
975811958 4:78178878-78178900 CTCTATACCTCACCCTATGTAGG - Intronic
983152363 4:164300579-164300601 CTCTGTCACCCAAGCTATAGGGG + Intronic
984177465 4:176437165-176437187 CTCTATGTCCTAACCTTTGGAGG + Intergenic
989456628 5:41651402-41651424 CTCTATCTCACAGCCTATGGTGG - Intergenic
997826796 5:137113732-137113754 CTCCATACCCCCACCTGTGGGGG - Intronic
1002465181 5:179404831-179404853 CTCTGTCCCCCAACCCACTGGGG + Intergenic
1008356486 6:50560207-50560229 CTGTTTCCCCCAACCTCTGTTGG - Intergenic
1023319231 7:38975790-38975812 CTCTGTCCCACAAATTATGGTGG - Intergenic
1026706969 7:72702420-72702442 CTCTATCCCCCAGGCTGGGGTGG + Intronic
1029128455 7:98311949-98311971 CTCTATCCCCTTACCTTTAGGGG - Intronic
1029530569 7:101122463-101122485 CTCTGTCCCCCACCCACTGGTGG - Intergenic
1029656085 7:101925438-101925460 CTCTATCCCCTCACCCCTGGGGG - Intronic
1031448453 7:121883843-121883865 CTCTAACTCCCAACCTCAGGTGG + Intronic
1031480105 7:122268084-122268106 TTCTGTCCCCTAGCCTATGGGGG + Intergenic
1039584276 8:38692836-38692858 CTCCATCCCCAAACCTCTTGCGG + Intergenic
1041444790 8:57939092-57939114 CTTTATCTCCCATTCTATGGAGG + Intergenic
1044371950 8:91422478-91422500 CTCTCTTCAACAACCTATGGGGG + Intergenic
1045602836 8:103737404-103737426 CTCAAACTCCCAACCTCTGGTGG + Intronic
1052225441 9:26079146-26079168 CTGTATCCACAAACCTATTGTGG - Intergenic
1052864574 9:33457208-33457230 CCCCATCTCCCAACCTATGGGGG - Intergenic
1054764250 9:69029930-69029952 CTGTGGCCCCCACCCTATGGTGG - Intergenic
1057382999 9:94585507-94585529 CTCCAGCCCCCAGCCTATGTGGG - Intronic
1188839246 X:34994934-34994956 GTCTCTCCCTCAACATATGGGGG - Intergenic
1194816478 X:98447811-98447833 CTCTAATCCCTAACCTATTGGGG - Intergenic