ID: 1084750601

View in Genome Browser
Species Human (GRCh38)
Location 11:71202344-71202366
Sequence CCTGAGCTGCAGAGAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 387}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084750601_1084750610 14 Left 1084750601 11:71202344-71202366 CCAGCCACTCTCTGCAGCTCAGG 0: 1
1: 0
2: 4
3: 35
4: 387
Right 1084750610 11:71202381-71202403 GAACAGCCTACCTGGCGGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 85
1084750601_1084750611 18 Left 1084750601 11:71202344-71202366 CCAGCCACTCTCTGCAGCTCAGG 0: 1
1: 0
2: 4
3: 35
4: 387
Right 1084750611 11:71202385-71202407 AGCCTACCTGGCGGGTGGGCAGG 0: 1
1: 0
2: 2
3: 13
4: 171
1084750601_1084750607 9 Left 1084750601 11:71202344-71202366 CCAGCCACTCTCTGCAGCTCAGG 0: 1
1: 0
2: 4
3: 35
4: 387
Right 1084750607 11:71202376-71202398 CTTAAGAACAGCCTACCTGGCGG 0: 1
1: 0
2: 1
3: 12
4: 91
1084750601_1084750609 13 Left 1084750601 11:71202344-71202366 CCAGCCACTCTCTGCAGCTCAGG 0: 1
1: 0
2: 4
3: 35
4: 387
Right 1084750609 11:71202380-71202402 AGAACAGCCTACCTGGCGGGTGG 0: 1
1: 0
2: 1
3: 5
4: 76
1084750601_1084750608 10 Left 1084750601 11:71202344-71202366 CCAGCCACTCTCTGCAGCTCAGG 0: 1
1: 0
2: 4
3: 35
4: 387
Right 1084750608 11:71202377-71202399 TTAAGAACAGCCTACCTGGCGGG 0: 1
1: 0
2: 3
3: 17
4: 191
1084750601_1084750605 6 Left 1084750601 11:71202344-71202366 CCAGCCACTCTCTGCAGCTCAGG 0: 1
1: 0
2: 4
3: 35
4: 387
Right 1084750605 11:71202373-71202395 TACCTTAAGAACAGCCTACCTGG 0: 1
1: 0
2: 0
3: 3
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084750601 Original CRISPR CCTGAGCTGCAGAGAGTGGC TGG (reversed) Intronic
900164667 1:1239926-1239948 CCTGAGCGGCAGGGAGCTGCCGG - Intergenic
900247812 1:1646716-1646738 CCTGAGAAGCAGAGACTGGTGGG - Intronic
900259039 1:1713870-1713892 CCTGAGAAGCAGAGACTGGTGGG - Intronic
900348600 1:2224225-2224247 CCTGAGGAGGAGAGAGTGGGTGG + Intergenic
900607527 1:3530536-3530558 TCCCAGCTGCAGAGAGAGGCAGG + Intronic
900900791 1:5514247-5514269 CCTGCTCTGCAGAGAATGGATGG - Intergenic
901207259 1:7504209-7504231 CCTGGGCAGCAGAGCCTGGCAGG - Intronic
901242201 1:7702052-7702074 CCTGTGGTGCAGTGAGTGGCAGG + Intronic
901872490 1:12146125-12146147 TCTGAGCTGCAGAGAATGGCAGG - Intergenic
902215265 1:14930769-14930791 GCTGAGCTGCCGAGAGTCACAGG + Intronic
902811976 1:18893121-18893143 CCTGGGCTCCAAAGAGGGGCTGG - Intronic
903997227 1:27314968-27314990 CATGAGTTTCAAAGAGTGGCAGG + Intergenic
904005164 1:27359813-27359835 CCTCATCTGCTGAGGGTGGCGGG - Intronic
904684394 1:32250109-32250131 CCTCAGCTGCAGAGAGAAGTGGG - Intergenic
905125181 1:35711088-35711110 CCTGACCTTCAGTGACTGGCAGG + Intergenic
905447317 1:38035428-38035450 ACTGAGATTCAGAGAATGGCAGG + Intergenic
905803683 1:40861563-40861585 CGTGAGCTGCTGAGGGCGGCCGG - Exonic
905947921 1:41919316-41919338 CCTGATCTGCAGCCAGAGGCTGG - Intronic
906318032 1:44800569-44800591 CCTGAGCTGGAGATGCTGGCCGG + Exonic
906383029 1:45344877-45344899 CCTGAGGTGGAGAAGGTGGCTGG + Exonic
906522292 1:46474747-46474769 CCGGAGCCGCAGAGAGGCGCAGG + Intergenic
907266906 1:53267522-53267544 GATGAGCTTCAGAGATTGGCAGG + Intronic
907273995 1:53306925-53306947 CCTGAGGTTCAGAGAGGGACAGG + Intronic
907933308 1:59019777-59019799 CAAGAGATGCAGGGAGTGGCAGG + Intergenic
908210501 1:61895416-61895438 CCAAGGCTGCAGAGAGTAGCAGG - Intronic
910281444 1:85505986-85506008 CCTGAGCTGCTCACAGTGTCTGG - Intronic
912452197 1:109774064-109774086 CATGTGCTGCAGAGAGGAGCTGG + Intronic
912561798 1:110556353-110556375 ACTGAGCTACAAAGAGGGGCGGG - Intergenic
912928035 1:113930102-113930124 CCTCAGCGGCAGTGAGCGGCCGG - Intronic
915249081 1:154575962-154575984 ACTGTGCAGCAGAGGGTGGCAGG - Exonic
915406095 1:155660632-155660654 GCTGGGCTGGAGAGAGGGGCTGG + Exonic
915419256 1:155766428-155766450 GCTGGGCTGGAGAGAGGGGCTGG + Exonic
915885646 1:159718236-159718258 CCTGGGCTGCACAGAGCAGCGGG - Intergenic
915955876 1:160219495-160219517 GCTGAGTTGCAGGGAGTGGTGGG + Intronic
916755028 1:167761217-167761239 CCAGAGCTGCAGGGAGATGCAGG + Intronic
917802993 1:178587238-178587260 CCAGAGCTGCAGAGAGAGGGGGG - Intergenic
918308745 1:183270441-183270463 CCTTTCCTCCAGAGAGTGGCAGG - Intronic
919535988 1:198788583-198788605 CCTCAGCTACAGAGAGAGGTAGG - Intergenic
919796525 1:201324552-201324574 TCTGTGCAGCAGAGGGTGGCGGG - Exonic
919860520 1:201736919-201736941 CCTGGGGTGCAGGGAGTGGGGGG - Intronic
920312128 1:205054678-205054700 CCAGAGCTCCAGAGAGAGACAGG + Intronic
920531820 1:206707609-206707631 ACTAAGGTGCAGAGAGTTGCAGG - Intronic
921581759 1:216903778-216903800 CCAGAGCTGCAGAGGGTGGTTGG - Intronic
922507272 1:226133804-226133826 GCTGTGCTGCAGAGACTGGATGG + Intergenic
922765872 1:228156591-228156613 CCTCAGCTGCATAAAGAGGCCGG + Intronic
922846545 1:228689557-228689579 CCTGGGCTGCAGACAGGTGCTGG + Intergenic
923820843 1:237439209-237439231 CCTGAGCTACAGAAAATGACAGG + Intronic
1062917751 10:1254886-1254908 CCTGAGCTTCAAAGAATGGTGGG + Intronic
1063196648 10:3749651-3749673 CCTGTGGTGTAGAGAGAGGCAGG - Intergenic
1063410100 10:5830966-5830988 CCTCAGCTGCAGAGAGTCACTGG + Intronic
1063442161 10:6081543-6081565 CATGAGCTGCAGAGAGTGGGAGG + Intergenic
1063607317 10:7534072-7534094 CCTGTGCTGTAGAGGGTGGGAGG - Intergenic
1064346779 10:14540043-14540065 CCAGAGCTGCAGAGTGGAGCAGG - Intronic
1064529247 10:16290358-16290380 CCTCAGCTGCACTGAATGGCTGG + Intergenic
1065883405 10:30057635-30057657 CCTTTGCTGCAGAGACTGGAAGG - Intronic
1066372129 10:34826130-34826152 CCTGTGCTGCAGAGGCTGGAAGG + Intergenic
1066586745 10:36944224-36944246 CCTCAGCTGCGAAGAGTGTCAGG + Intergenic
1067552938 10:47247848-47247870 CCTGAGGGGCAGAGGGAGGCAGG + Intergenic
1069231834 10:66020264-66020286 CTTGAGCTGAAGAAAGTGGAAGG + Intronic
1069716497 10:70524370-70524392 CCAGAGCTGCAGAGAAGGGAGGG - Intronic
1069833500 10:71294887-71294909 CCTGAGCTCCTGAGAATGGGAGG - Intronic
1069862812 10:71481956-71481978 CCTGGGCTGCAAAGGGTGGGGGG + Intronic
1073063178 10:100744215-100744237 CCGGAGCTGCAGACGGGGGCTGG + Intronic
1073110993 10:101062937-101062959 CCTGAGCCGCGGAGAGGTGCCGG + Exonic
1073189271 10:101639181-101639203 CCTGAGGGGCAGAGAGAGACTGG - Intronic
1075564929 10:123496316-123496338 CCAGATCTGCACAGAGTGGTGGG - Intergenic
1075825714 10:125355820-125355842 CCAGAGCTGCAGACTGAGGCAGG + Intergenic
1076403214 10:130196646-130196668 CCTCAGCTGCAGAAGGTTGCAGG + Intergenic
1076756062 10:132572385-132572407 CCTGAGCTGCACAGCTTGCCTGG + Intronic
1076983229 11:216519-216541 CATGAGCTGCAGTGACTGGTAGG - Exonic
1077329613 11:1978277-1978299 CTTGAGGTGCAGAGAGAGGATGG + Intronic
1077452249 11:2655423-2655445 GCTGAACTGCCTAGAGTGGCTGG - Intronic
1077537098 11:3129620-3129642 GCTGAGCACCAGGGAGTGGCTGG + Intronic
1078443999 11:11390542-11390564 CCTGAGCAGCAGTGATTTGCAGG - Intronic
1079126118 11:17719721-17719743 CCCAAGCGGCAGAGAGTGGCCGG - Exonic
1080539600 11:33253787-33253809 ACGGAGCTCCAGAGAGTGGCTGG + Intergenic
1080855351 11:36107008-36107030 CCTGAGCTGCAGGGTGGGTCCGG - Intronic
1081191509 11:40108189-40108211 CCAGAGCTGCAAATAGTGCCTGG + Intergenic
1082774559 11:57235451-57235473 CGGCAGCTGCAGAGAGTGGTGGG + Exonic
1082788267 11:57329492-57329514 CCTGAGCTTCTGAGAGTCACTGG + Intronic
1083299455 11:61732721-61732743 CCTGTGGGGCAGAGAGAGGCAGG + Intronic
1083487768 11:62994410-62994432 CCTGAGCCCCAGAGAGTGCAGGG + Intronic
1083766594 11:64844398-64844420 CCTGAGCTGGGGTGAGTGGCGGG - Exonic
1084266636 11:68008513-68008535 GCTGAGCTCCAGAGAATGGCAGG + Intergenic
1084289515 11:68152777-68152799 CCCGTGCTGCAGAGAGGGGAAGG - Intergenic
1084358358 11:68653844-68653866 CCTGGGCGGCTGGGAGTGGCTGG + Intergenic
1084456542 11:69271043-69271065 CATGATATCCAGAGAGTGGCAGG + Intergenic
1084549426 11:69832186-69832208 CCTCAGCTGCTGAGAATTGCAGG - Intergenic
1084750601 11:71202344-71202366 CCTGAGCTGCAGAGAGTGGCTGG - Intronic
1085457268 11:76672121-76672143 CCTGAGCTGCAGTGAGGGGATGG + Intergenic
1088792735 11:113240555-113240577 CCTGAACTGCAGGGTTTGGCAGG + Intronic
1089705265 11:120273099-120273121 CTTGAGCTGTAGAGAGTGAGGGG + Intronic
1090419468 11:126564281-126564303 CCTGGGCTGCAGACGGTGGATGG - Intronic
1090596789 11:128329144-128329166 TCTGTCCTGCAGAGAATGGCAGG - Intergenic
1091144299 11:133264119-133264141 TTTGAGTTGCTGAGAGTGGCAGG + Intronic
1091369143 11:135044343-135044365 ACTGAGCTCCAGGGAGTGGGAGG - Intergenic
1202812592 11_KI270721v1_random:33456-33478 CTTGAGGTGCAGAGAGAGGATGG + Intergenic
1091630194 12:2154253-2154275 CTTGTGCTGCAGAGCCTGGCCGG + Intronic
1091724406 12:2835379-2835401 CCTGGGCTGCAGATAATGCCAGG - Intronic
1091831412 12:3553336-3553358 CCTGGCCAGCAGAGAATGGCAGG - Intronic
1092254943 12:6921722-6921744 CTTGAGCAGCAGACAGTTGCAGG - Exonic
1095636328 12:44438049-44438071 CCAGTGCTGAGGAGAGTGGCTGG + Intergenic
1095648786 12:44582305-44582327 CCTGAGCAGCTGATTGTGGCTGG - Intronic
1095981628 12:47977717-47977739 CCTGGGCTTCTGAGAGGGGCTGG - Intronic
1096769752 12:53927669-53927691 CCCGAGCTGCGCACAGTGGCGGG + Intergenic
1098765773 12:74486915-74486937 CCTGAACAGCTGAAAGTGGCTGG - Intergenic
1100051268 12:90451221-90451243 ACTGGGCTGAAGAGAGTGGGAGG - Intergenic
1100260993 12:92931971-92931993 CCTGTGCAGCAGAGAGTAGGTGG - Intergenic
1101050367 12:100856786-100856808 CATGTGAGGCAGAGAGTGGCAGG + Intronic
1101304795 12:103517492-103517514 CCTGAAGTTCAAAGAGTGGCAGG + Intergenic
1102495589 12:113316809-113316831 CCTGAGCTGCAGTGAGAGGTGGG + Intronic
1102919917 12:116784251-116784273 CGTGAGCTGCAGTGAGAGCCAGG - Intronic
1103171144 12:118821068-118821090 CCCCAGCTGCACAGAGTGACAGG - Intergenic
1104754826 12:131262434-131262456 TTTGAGCTGCAGAGAGTGGCAGG + Intergenic
1104871850 12:132005060-132005082 GCTCAGCTGCAGAGGGTTGCGGG - Exonic
1105600158 13:21879413-21879435 GCTGAGCTGCAGTGATTGGCTGG + Intergenic
1105602694 13:21901465-21901487 CCTGAGTTGGAGAGAGTGCTGGG + Intergenic
1106452324 13:29894377-29894399 CCTTACATGCAGAAAGTGGCTGG - Intergenic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1108176391 13:47797050-47797072 CCAGAGCAGCAGTGACTGGCAGG - Intergenic
1108200625 13:48039417-48039439 CCTGAGCTGCAGAAACTCACAGG - Intronic
1108512569 13:51169616-51169638 CCCAGGCTGCACAGAGTGGCCGG - Intergenic
1110279460 13:73675937-73675959 ACAGAGGGGCAGAGAGTGGCAGG + Intergenic
1113504707 13:110807481-110807503 CCTGAGCTGCTCAGAATGGTAGG - Intergenic
1117446975 14:55813355-55813377 CCAGAGGTGCAAAGAGGGGCTGG + Intergenic
1117962913 14:61180284-61180306 CAAGAGCTGCAGTGAGCGGCTGG + Intergenic
1118615403 14:67571717-67571739 CCTGAGCTGCAGTGAGGGAGGGG + Intronic
1118841774 14:69518867-69518889 CTTGAGCAGCCCAGAGTGGCTGG + Intronic
1122151474 14:99728374-99728396 CCTGGGCTGGGGAGAGGGGCAGG - Intergenic
1124019122 15:25903577-25903599 CCGTAGCTGCAGGGATTGGCTGG + Intergenic
1124032879 15:26027314-26027336 CCTGAGCTACAGAAAGGAGCAGG - Intergenic
1124341358 15:28891327-28891349 CCTGAGCTGGAGAGAGTGTGAGG + Intronic
1124704691 15:31954058-31954080 CCTGAGCTGCTGTGAGCAGCAGG + Intergenic
1124721035 15:32110894-32110916 CCTGAGCTTCAGAGCATGGGTGG + Intronic
1124959322 15:34382969-34382991 AAGGAGCTGGAGAGAGTGGCAGG - Exonic
1124965754 15:34432394-34432416 TCTGAGCTGGAGAGAGTGTGAGG - Intronic
1124975948 15:34529190-34529212 AAGGAGCTGGAGAGAGTGGCAGG - Exonic
1124982376 15:34578499-34578521 CCTGAGCTGGAGAGAGTGTGAGG - Intronic
1125518362 15:40335315-40335337 CCTGAGCCACAGAGAGGAGCAGG - Exonic
1126725989 15:51632963-51632985 GCTGTGCTGCAGAGAGAAGCAGG + Intergenic
1126852928 15:52809145-52809167 CCTAAGTAGCAGGGAGTGGCAGG + Intergenic
1127074461 15:55311898-55311920 CCAGAGCTCCCGATAGTGGCAGG + Intronic
1127483631 15:59399818-59399840 CCTGCCCTGGAGGGAGTGGCTGG - Intronic
1128646397 15:69381664-69381686 ACTGAGCAACAGAGAGTAGCAGG + Intronic
1128740698 15:70082029-70082051 CCAGAGCTGCAGGGAAAGGCTGG + Intronic
1128764814 15:70244568-70244590 TCTGAGCTGGAGAGTATGGCTGG - Intergenic
1129711128 15:77820634-77820656 ACTGAGGTGCAGAGAGGGGTCGG - Intronic
1130108757 15:80948425-80948447 ACTGGGCTTCAGAGAGGGGCAGG + Intronic
1131195241 15:90350148-90350170 CAGAAGCTGCAGAGAGCGGCAGG + Intergenic
1131268787 15:90934322-90934344 CCAGAGCTGAAGAGAGAGGTGGG - Intronic
1132285823 15:100661564-100661586 GCTCAGCTGCATTGAGTGGCTGG - Intergenic
1132464760 16:72398-72420 CCGGAGCTGCTCAGAGCGGCCGG - Intronic
1132693624 16:1192580-1192602 CCTGAGCTGGCTAGGGTGGCAGG + Intronic
1133303966 16:4798662-4798684 CATCAGCTGCAGGGAGAGGCGGG + Exonic
1133324500 16:4935105-4935127 CCAGATATACAGAGAGTGGCAGG + Intronic
1133983726 16:10652344-10652366 CCTGGCCTGGAGAGAGTGGGAGG - Intronic
1136111668 16:28067361-28067383 CATGAGCTGAAGACAGTGGATGG + Intergenic
1136573792 16:31111587-31111609 CCTCAGCTGCTGACAGAGGCAGG - Intronic
1137931217 16:52589270-52589292 CCTGCCCTCCAGAGAGTGGCTGG - Intergenic
1138036086 16:53608093-53608115 ACTGAGAAGTAGAGAGTGGCAGG - Intronic
1138105954 16:54287187-54287209 CCTAAGCTGCTGAAAGTGGCCGG - Intergenic
1138548552 16:57734818-57734840 CCTGACCTGCGGTGAGAGGCTGG + Intergenic
1139485947 16:67256730-67256752 GATGAGCTGCAGGGAGGGGCGGG - Intronic
1141659226 16:85432871-85432893 ATAGAGCTGCAGAGAGTGCCGGG - Intergenic
1141998413 16:87649118-87649140 CCTCTGCTGCAGAGAGGGGCGGG + Intronic
1142005390 16:87687384-87687406 CTTCGGCTGCAGAGAGTGGCTGG + Intronic
1142302569 16:89267061-89267083 CCTGAGCTTCAGCTTGTGGCTGG - Intergenic
1143107361 17:4536416-4536438 GCTGAGCAGCAGTGAGTGGGGGG + Exonic
1143517894 17:7429173-7429195 CCAGAGCTGAAGGGAGTGGGAGG - Intergenic
1143679380 17:8465030-8465052 CCTGTACTGCAGACAGTGCCCGG - Intronic
1146119167 17:30175619-30175641 CCTGAGGTGAAGAGAGCGCCTGG - Intronic
1147430319 17:40366865-40366887 CCTGAGCTGGAGGGAGTGGTGGG - Intergenic
1147677152 17:42215430-42215452 CCTGTGCTGCAGACACTTGCTGG + Intronic
1147703652 17:42411606-42411628 CCTCAGCTGCAGGGAGTGGGTGG + Intronic
1148755498 17:49970986-49971008 CCTGGGCTGCGGAGTGTGGCTGG + Intronic
1148784757 17:50140618-50140640 CCTGAGCTTCAGGAAGGGGCGGG + Intronic
1149638621 17:58189455-58189477 CCAGAGCTGGAGAGGGTGGGTGG + Intergenic
1149664869 17:58358370-58358392 CCTGAGCTGGAGTCACTGGCTGG + Exonic
1149993365 17:61394992-61395014 CCTGAGCCCCAGAGAAGGGCAGG + Intergenic
1150289863 17:63974906-63974928 GCAGAGCTGGGGAGAGTGGCCGG - Intergenic
1151705279 17:75764072-75764094 CATGAGCTCCAGAGCCTGGCAGG + Exonic
1151799175 17:76367502-76367524 CCTGAGCTACAGAGCGAGACTGG - Intronic
1151887166 17:76929946-76929968 CTTCAGCTTCAGAGAGTGGTGGG + Intronic
1151980090 17:77503474-77503496 CCTGAGCTCCAGAGAATGCAGGG - Intergenic
1152285601 17:79410942-79410964 CGTGTGGTGCAGAGAGTGGGAGG - Intronic
1152431121 17:80248724-80248746 CCTGAACAGCAGGGAGTGGGGGG - Intronic
1152654824 17:81514645-81514667 CCTGAGCCGCGGGGAGGGGCGGG + Intronic
1152657764 17:81527891-81527913 CCTGGGCTGCAGGTTGTGGCTGG + Intergenic
1152794076 17:82298388-82298410 TCAGAGCTGCAGCGAGCGGCTGG + Intergenic
1153961954 18:10147597-10147619 CCTTTGCTGCAGTGAGTGTCCGG + Intergenic
1160490515 18:79333793-79333815 CCTGAGCTACAGAAAGTTCCTGG + Intronic
1160569491 18:79807148-79807170 CCTGAGGTGCAGACAGATGCAGG - Intergenic
1160774957 19:851099-851121 CCTGAGGTTCAGGGAGCGGCTGG + Intronic
1161144815 19:2671261-2671283 CCTGAGCTGCTGGGAGTTGGTGG - Intronic
1161772717 19:6240068-6240090 TCTGAGCCTCAGAGAGAGGCAGG + Intronic
1161864371 19:6822587-6822609 CCTCAGCTGCCCAGAGCGGCCGG - Intronic
1162452796 19:10764863-10764885 GGTGAGCAGCAGACAGTGGCAGG - Intronic
1163267383 19:16229153-16229175 CCTGAGGTGAAGACAGAGGCTGG - Intronic
1163334123 19:16660478-16660500 CCTGAGCTGCACAGGGTGCGGGG + Intergenic
1163651014 19:18517769-18517791 CCTCAGCTGCCCAGAGTGCCGGG - Intronic
1163842990 19:19622758-19622780 TCTGAGCTGCAGAGAAAGACAGG + Intergenic
1164401364 19:27904478-27904500 CCTCAGCTAGGGAGAGTGGCTGG - Intergenic
1164596510 19:29533879-29533901 CCTGAGCTGCAGAGGGAGCTCGG + Intronic
1164713181 19:30373857-30373879 CCTGAGCTGCAGTGGGAGCCGGG + Intronic
1164842824 19:31406288-31406310 ACTGGGCTGCAGAGTGTGACTGG - Intergenic
1165318542 19:35072399-35072421 CCTGCTCAGCAGAGAGAGGCTGG - Intergenic
1165746251 19:38231449-38231471 CATGAAGTGCAGAGAGTGGGTGG - Intergenic
1166382462 19:42362153-42362175 CCGGACCTGCAGTGAGTGCCTGG + Exonic
1166566087 19:43766599-43766621 CCAGAGCTGCAGAGAGCACCTGG - Exonic
1168267789 19:55231801-55231823 CCTGAGCTGCAGGGCGTCACGGG + Exonic
1168312028 19:55465208-55465230 CCTGAGCAGCAGAGTGAGGGAGG + Intergenic
1168323066 19:55521775-55521797 TCTGGCCTGCAGAGAGGGGCTGG - Intergenic
925036565 2:691976-691998 ACTGAGCTGGAGAGAGATGCGGG - Intergenic
925059054 2:876880-876902 TCCGAGCTGCAGAGAGTGAAAGG - Intergenic
925406019 2:3605855-3605877 CCAGAGCTGCACAGCCTGGCAGG - Intronic
926652954 2:15366579-15366601 GCTGAGCTGCTGAGGGTTGCAGG - Exonic
926715164 2:15918647-15918669 TCAGAGCTGGAGAGAGTGGTGGG - Intergenic
929731215 2:44494850-44494872 CTTGAGCTTCACAGAGTGGCAGG - Intronic
930017312 2:46979784-46979806 CCTCTGCTGCAGAGACAGGCAGG - Intronic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
931152984 2:59595916-59595938 CCTGAGCCACAGAAAGTGTCAGG + Intergenic
931916542 2:66962782-66962804 CCTGAGAGGCAGAGAGGGGGTGG - Intergenic
932341748 2:70966899-70966921 CCTGGGCTGCAGAGTGAGACAGG + Intronic
932783130 2:74575966-74575988 CCTCAGCTTCCCAGAGTGGCTGG + Intronic
933164929 2:79065420-79065442 ACTGAGATCCAGAGAGTGGCTGG - Intergenic
934046948 2:88180137-88180159 TCTGGGCTGCAGAGGGCGGCTGG - Intronic
937145169 2:119638452-119638474 CCTGGGCTGCAGGGAGGGGCAGG + Intronic
937275572 2:120681855-120681877 CCTGAGCTGTAGAGTGGGGTTGG - Intergenic
938578728 2:132627242-132627264 CCTGAGCTGGAGGGATTGTCAGG + Intronic
938591887 2:132747505-132747527 CCTGAGCTTCAGAGTCAGGCCGG - Intronic
938763608 2:134445850-134445872 CCTGGGCTGCAGAGGCTGTCTGG + Intronic
938836918 2:135113520-135113542 CCTCAGCTGCTGTGACTGGCTGG - Intronic
939966316 2:148613779-148613801 CCTGAGCTACAGAAAGAGACTGG + Intergenic
941576993 2:167245346-167245368 CTTGAATTGCATAGAGTGGCTGG - Exonic
945560155 2:211329889-211329911 CCTAAGCAGCAGAGAGTTGTTGG - Intergenic
946180011 2:217943302-217943324 CCTTGGCTGCAGGGAGGGGCTGG - Intronic
946300240 2:218819319-218819341 CCTGAGCTCCTGAGAGTCTCGGG - Intergenic
946409811 2:219510358-219510380 CCTGAGTGGCAGAGACAGGCTGG - Intergenic
948165322 2:235856853-235856875 CCTGAGCTCACGACAGTGGCTGG - Intronic
948749615 2:240124216-240124238 CCTGAGCATCAGCGAGGGGCTGG - Intergenic
948805502 2:240452144-240452166 CCTGGGCTGCAGGGAGGGGAGGG + Intronic
948947604 2:241229012-241229034 CCTGAGAGGCAGAGGGTGACGGG - Exonic
949028503 2:241777317-241777339 CCTGAGCCGCAGACCGAGGCTGG - Intronic
949043381 2:241859324-241859346 CCTGGGCTGCAGTGAGGGGTGGG + Intergenic
1170701845 20:18711102-18711124 CCTGAGCTCCATGGAGTGGTGGG + Intronic
1172013098 20:31857845-31857867 CCTGAGCTGCAGAGGTTGATGGG + Intronic
1173601402 20:44298030-44298052 CCTGAGCTGGTGACAGTGTCAGG + Intergenic
1173658761 20:44718753-44718775 ACTGAGCTCCAGAGAGGGACAGG - Intronic
1176042117 20:63071419-63071441 GCTGAGCTGCAGAGAAGGGTAGG - Intergenic
1176093975 20:63331173-63331195 CGTGAGGCGCAGAGAGAGGCGGG - Intronic
1176131645 20:63498966-63498988 CCTGGGGGGCAGAGGGTGGCCGG - Intronic
1176185914 20:63778973-63778995 CCTGACCTGCAGATGGCGGCAGG + Intronic
1176363271 21:6016524-6016546 CCTCACCTGCAGAGTGTGGCTGG - Intergenic
1176521854 21:7830165-7830187 CCGGAGCGGCAGACAGTCGCTGG + Intergenic
1178427059 21:32487278-32487300 CCCAAGCTGGAGAGAGAGGCTGG + Intronic
1178655874 21:34460177-34460199 CCGGAGCGGCAGACAGTCGCTGG + Intergenic
1179050415 21:37884394-37884416 GCTGAGATGCAGAGAGAAGCTGG - Intronic
1179354659 21:40648408-40648430 GCTGAGCTGTTGATAGTGGCAGG + Intronic
1179728332 21:43353446-43353468 CCAGAGGCGCAGAGAGAGGCCGG + Intergenic
1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG + Intergenic
1179808655 21:43856110-43856132 CCCCTGCTGCAGACAGTGGCAGG - Intergenic
1179966142 21:44807176-44807198 GCTGAGCTGCAGTGAGGGGACGG - Intronic
1180014191 21:45072305-45072327 CCAGAGCAGCAGAGAGCGGATGG - Intergenic
1180244568 21:46538466-46538488 CCCGAGCTGCAGAGAGAGGATGG - Exonic
1180975904 22:19848309-19848331 CAGGAGCTGCAGAGCCTGGCAGG - Exonic
1181568089 22:23751683-23751705 CCTGGGATGCAGAGAGTTGGGGG - Intergenic
1182018704 22:27062896-27062918 CCTGAGCTGCAGGTGGTGCCTGG + Intergenic
1183094236 22:35542539-35542561 CCTGAGCTGCCAAGGGTGGTGGG + Intronic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1184038226 22:41928574-41928596 CCTGAGCAGCAGCGAGGGGGAGG + Intergenic
1184434464 22:44461830-44461852 CCTGAGCTCCAGAGACATGCAGG + Intergenic
1184806448 22:46797527-46797549 GCTGAGCTGCTGAGAGTGCTGGG - Exonic
1185243991 22:49763670-49763692 CCAGGGCTGCACAGAGAGGCTGG - Intergenic
1185311772 22:50160067-50160089 GCTGAGGAGCAGAGAGTGGGAGG + Intronic
949145225 3:691392-691414 ACTGCACTGCAGAGTGTGGCTGG + Intergenic
949996105 3:9618779-9618801 CAAGGGCTGCAGAGAGTAGCAGG - Intergenic
950116015 3:10450717-10450739 CCTGGGCTCCAGAGAGGGACGGG - Intronic
950123868 3:10499717-10499739 CCTGGGCACCAGAGAGAGGCTGG - Intronic
951845869 3:27083546-27083568 CCAGAGGTGAAGAGAATGGCTGG - Intergenic
953358389 3:42273709-42273731 CCTCAGCTTCAGAGAGAAGCTGG - Intergenic
953867325 3:46595569-46595591 CCTGGGCTGCAGAGTGGAGCGGG + Intronic
953886805 3:46718661-46718683 CCTGAGTAGCTGAGAGTAGCTGG - Intronic
954259659 3:49429361-49429383 CCTGAGCTTCGGTGATTGGCTGG - Intergenic
954391259 3:50269227-50269249 CCTGAGCTGCTGAGATGGGGCGG + Exonic
954439618 3:50514711-50514733 CCAGACCTGCAGAGGGAGGCAGG + Intergenic
954577145 3:51682829-51682851 CCAGAGCTGCAGACAGTTGAGGG + Intronic
954747494 3:52795387-52795409 ACTGAGGTCCAGAGAGGGGCAGG - Intronic
955544397 3:60012494-60012516 CCTGAGCTCAAGAGAGCTGCCGG + Intronic
955795120 3:62628225-62628247 CCTTAGCTGCAGTCACTGGCTGG + Intronic
955972627 3:64450932-64450954 GGTGAGCTGGAGAGAGTGGTTGG - Intergenic
956699753 3:71948476-71948498 CCTGAGCTGCAGAGCAGAGCAGG + Intergenic
959103034 3:102035159-102035181 CCTAGGCTGCATAGAGTTGCTGG - Intergenic
959820180 3:110724788-110724810 CCTGATCTGCAGTATGTGGCAGG + Intergenic
960815239 3:121665108-121665130 CCTGTGCTGCATTGTGTGGCAGG - Intronic
961183638 3:124895896-124895918 ACTGAGGTCCAGAGGGTGGCAGG - Intronic
962236282 3:133710314-133710336 CCTGAGCAGCTGAACGTGGCTGG + Intergenic
966732216 3:183160893-183160915 CCTGGCATGCAGAGAGTGCCAGG + Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
968405930 4:338881-338903 CCTGGGCTGGAGGGAGTCGCAGG + Intronic
968602758 4:1518106-1518128 CCAGAGCTGCAGAGTACGGCAGG - Intergenic
968617319 4:1583604-1583626 CCTGAGCTGCTGGGAGCTGCAGG - Intergenic
968728221 4:2258092-2258114 CAGGACCTGCAGACAGTGGCTGG + Intronic
968942909 4:3648417-3648439 CCTGAGCTGCGGAGGCGGGCGGG - Intergenic
969715063 4:8864366-8864388 CCTGAGCAGCTCAGGGTGGCTGG + Intronic
970941614 4:21640944-21640966 AGTTATCTGCAGAGAGTGGCAGG - Intronic
972775800 4:42239399-42239421 CCTGTGCTGGAGAGAGGGGAGGG - Intergenic
973863270 4:55086792-55086814 CCTGGGCTGCAGGGAGGGGCAGG - Intronic
974278000 4:59751584-59751606 CCCCAGCAGCAGAGAGTGGTTGG - Intergenic
978362147 4:107942285-107942307 GCTGAGGTGCAGACAGTGGGTGG - Intronic
982223244 4:153142367-153142389 CCTGAGAGACAAAGAGTGGCAGG + Intergenic
984541847 4:181048365-181048387 ACTGTGTTGCAGAGAATGGCAGG + Intergenic
985950437 5:3218353-3218375 CCTAAGCTGCAGATAGCCGCGGG + Intergenic
986687092 5:10284135-10284157 CGTGAGCTGCAGAGCGTGGCCGG - Intronic
987395585 5:17420024-17420046 GATGAGCTGCTGAGAGAGGCTGG - Intergenic
990723713 5:58729112-58729134 CGTGATCTGCAGAAAGTGCCAGG - Intronic
990978521 5:61580241-61580263 CTGCAGCTGCAGAGAGAGGCAGG + Intergenic
992023508 5:72648721-72648743 ACTGAACTGCAGAGGCTGGCTGG + Intergenic
992956156 5:81910664-81910686 ACTTCCCTGCAGAGAGTGGCAGG - Intergenic
995550910 5:113280447-113280469 CCTTTGCTGGTGAGAGTGGCTGG - Intronic
996292398 5:121867493-121867515 CCTCAGCTGAAGAGAGCTGCGGG + Intergenic
997315863 5:132935196-132935218 CCTCAGCTGCCCAGAGTAGCTGG - Intronic
997366038 5:133325699-133325721 CTGCAGCTCCAGAGAGTGGCTGG - Intronic
998132491 5:139658499-139658521 CTAGAGCTCCAGAGAGGGGCTGG - Intronic
999177148 5:149639640-149639662 CCAGGGCTGCAGGGAGGGGCTGG + Intergenic
999240690 5:150125672-150125694 CCTGAGGCCCAGAGAGGGGCAGG + Intronic
1000173706 5:158729044-158729066 CCTGCTCTGCAGAGATTGGGTGG + Intronic
1001599037 5:172917008-172917030 GCTGGGCTGGAGAGGGTGGCAGG + Intronic
1002083196 5:176749525-176749547 CGTGAGCTGCAGTGAGTGTGGGG + Intergenic
1002206890 5:177569146-177569168 CCTGAGTTGCAGACAGTGCAGGG - Intergenic
1002348277 5:178563229-178563251 CCAAAGCAGCAGGGAGTGGCAGG - Intronic
1002674371 5:180898765-180898787 CCTGAACTTCAGAGAATGGAGGG + Intergenic
1002854180 6:1022953-1022975 CCTGAGCTGCAGGGAGTTTGGGG - Intergenic
1003868479 6:10383618-10383640 CCTAGGCTGCAGAGGGCGGCGGG - Intergenic
1003874242 6:10422495-10422517 CCTGAGCTGCGGTGAGGGGCGGG + Intergenic
1003897175 6:10618143-10618165 TCTGAGGCGCAGAAAGTGGCAGG - Intronic
1004557892 6:16717353-16717375 CCTGAGATGAACAGAGAGGCAGG + Intronic
1004597084 6:17110216-17110238 GCTTTGCTGCAGAGAGTGGGAGG + Intronic
1005898092 6:30195477-30195499 ACTGAGGTCCAGAGAGTGGGAGG - Intronic
1006020327 6:31114133-31114155 CCTGATCTGCAGCCAATGGCAGG - Intergenic
1006341214 6:33448170-33448192 CCTGAGATGCAGAGAGGAGTGGG - Intronic
1006396468 6:33790460-33790482 CCTGAGGTGGAGCAAGTGGCAGG - Intergenic
1006449665 6:34098854-34098876 CCTTAGCTGCAGAGAGGGGGTGG + Intronic
1010191413 6:73201028-73201050 CCTGAGCTGCAGCAAGGGGAGGG - Intergenic
1011243654 6:85299329-85299351 CTGGAGCTGCAGTGAATGGCAGG + Intergenic
1012653294 6:101784224-101784246 CCAAAGCTGCATAGAGTAGCAGG - Intronic
1012696546 6:102391418-102391440 CCTGAGCTAATGAAAGTGGCAGG - Intergenic
1014003822 6:116394885-116394907 CATCAGCTGCTGAGAGTCGCTGG + Intronic
1014163972 6:118202775-118202797 CCTGAGTGACAGAGAGTAGCTGG + Intronic
1015429062 6:133108894-133108916 TCTGAACTGCAGAGTGTTGCTGG - Intergenic
1016632508 6:146249365-146249387 CCAAAGCTGCACAGAGTAGCAGG - Intronic
1017582402 6:155880502-155880524 CCTGACCTGCAGAGAGCATCTGG + Intergenic
1017709916 6:157158157-157158179 CCTGTCCTGCACAGAGTGGCTGG + Intronic
1017775025 6:157673765-157673787 CCGGGGCTGCAGAGGGCGGCTGG + Exonic
1018205927 6:161436879-161436901 ACAGAGCTGCAGAGGGTGACCGG - Intronic
1018321752 6:162617977-162617999 CCTGAGGTGCAGAGATTTGAAGG + Intronic
1018789264 6:167134050-167134072 TCTAAGCTGCAGAGCATGGCAGG - Intronic
1019321711 7:419032-419054 CTTGAGCTTCAGACAGGGGCAGG - Intergenic
1019428576 7:988402-988424 GCTGACCTGCAGAGAAAGGCAGG - Exonic
1019551289 7:1603867-1603889 CCTGGGCTGGAGAGAGTCCCAGG + Intergenic
1020144446 7:5631982-5632004 CAGAAGATGCAGAGAGTGGCTGG + Intronic
1020149783 7:5673095-5673117 CCGGAGGTCCAGAGAGTGGTGGG - Intronic
1026110658 7:67456473-67456495 CCTGCGCTGCAGTGACAGGCAGG + Intergenic
1027050741 7:75019785-75019807 CCTGAGATGCAGGCAGGGGCCGG + Intronic
1027054006 7:75037891-75037913 CCTGAGCTGGAGACAGTGTTAGG - Intronic
1031693892 7:124825088-124825110 CCTTTGATGAAGAGAGTGGCAGG - Intronic
1032167467 7:129556701-129556723 CCAGAGGGGCAGAGAGAGGCTGG + Intergenic
1032520008 7:132536666-132536688 AAGGAGCTGCAGAGAGAGGCTGG + Intronic
1035134282 7:156685464-156685486 CCTAGGCTGCAGGGTGTGGCCGG + Intronic
1035872454 8:3150437-3150459 CTTGCTCAGCAGAGAGTGGCCGG - Intronic
1036671579 8:10792016-10792038 CCTGAGCGGGAGAGAGGGGGCGG - Intronic
1037056534 8:14449089-14449111 CCTGGGCTGCAGGGACTTGCTGG - Intronic
1037730371 8:21518932-21518954 CCTGAGTTGGAGATACTGGCTGG - Intergenic
1038287875 8:26222194-26222216 GCTGAGCAGCAGTGAGTGACAGG - Intergenic
1038644345 8:29350335-29350357 CCTAGGCTGCAGAAAGGGGCGGG + Exonic
1039200905 8:35092554-35092576 CCTGGAGGGCAGAGAGTGGCAGG + Intergenic
1040500450 8:48000484-48000506 CCCCAGCAGCAGAGAGTGGTTGG - Intergenic
1041343652 8:56872344-56872366 CCTGATCTGCAAAGACTTGCAGG + Intergenic
1041691333 8:60690864-60690886 ACTGAGCTGCAGAAAATGACAGG - Intronic
1042792084 8:72619284-72619306 CCAGTGCTGGAGAGATTGGCAGG + Intronic
1042864029 8:73341115-73341137 CCTTGCCTGCAGAGAGGGGCTGG - Intergenic
1043391969 8:79800634-79800656 CCTTGGCTGCAGAAAGTTGCTGG - Intergenic
1043438252 8:80254761-80254783 TCTAGGCTGGAGAGAGTGGCTGG + Intergenic
1044605214 8:94042132-94042154 CCTGAGCTAGAGAGAGGGCCAGG + Intergenic
1047326971 8:123848932-123848954 CCTTAGCTGCAAAGAGGGGCCGG + Intergenic
1047861539 8:128972560-128972582 GCTGAAATGAAGAGAGTGGCAGG - Intergenic
1047990170 8:130277891-130277913 ACAGAGATGTAGAGAGTGGCAGG + Intronic
1048275326 8:133061691-133061713 CCTGAGCTGCAGACACAGGTAGG - Intronic
1048831080 8:138478158-138478180 CCTGAGATGCAGGGAGTGTCAGG - Intronic
1049339795 8:142105970-142105992 CCTGACCTGGAGGGAGTGGGGGG - Intergenic
1049356340 8:142190589-142190611 CCTGAGCTGCGGCCAGTCGCCGG + Intergenic
1050112818 9:2234403-2234425 CCTGAGAAGCAGGGAGAGGCGGG - Intergenic
1050598991 9:7231718-7231740 GCTTACCTGCACAGAGTGGCGGG - Intergenic
1050673110 9:8020132-8020154 ACTGAGCTGCACAGAGTGTATGG + Intergenic
1050987557 9:12102281-12102303 CCAGAGCTGCAGAGACTAGCAGG + Intergenic
1051338687 9:16091525-16091547 CCTGTGCTCCAGGGACTGGCAGG - Intergenic
1051378740 9:16433057-16433079 GCTGAGCTGCAGGAAGAGGCAGG + Intronic
1051643591 9:19246257-19246279 CCTGAGCAGTGGAGTGTGGCTGG + Intronic
1052119363 9:24691996-24692018 AATGAGCTGCAGATAGGGGCTGG - Intergenic
1052707168 9:32008112-32008134 CCAGAGGTGCAAAGAGTAGCTGG - Intergenic
1057658452 9:96977740-96977762 CCTGAGCCTCACAGAGTGCCAGG - Intronic
1057724939 9:97561787-97561809 CTCGAGGTTCAGAGAGTGGCAGG - Intronic
1058215886 9:102232534-102232556 CAAGAGCAGCACAGAGTGGCGGG - Intergenic
1060945543 9:127568036-127568058 CCGGAGCTGCAGAGGGGGCCTGG - Intronic
1061084593 9:128391695-128391717 CCCTGGCTGCAGAGAGTGGGAGG + Exonic
1061334465 9:129922530-129922552 CCTGGGCTTCATAGGGTGGCTGG + Intronic
1061369995 9:130192728-130192750 CCGGTGCTGCAGTGAGTGGGGGG + Intronic
1061407828 9:130402559-130402581 ACTGAGGTCCAGAGAGTGGAAGG + Intronic
1061675691 9:132214344-132214366 CCTGCGCTGCAGGGAGGGGCAGG - Intronic
1203782110 EBV:106348-106370 CCTGTGCTGGAAAGAGAGGCTGG + Intergenic
1186637320 X:11420575-11420597 CCTGAGCAGCCCAGGGTGGCAGG - Intronic
1187127698 X:16469500-16469522 CCTGGGCTCAAGAGAGTAGCTGG + Intergenic
1190630227 X:52378880-52378902 CCTGAGCTGAGGTGAGGGGCTGG + Intergenic
1190636142 X:52435839-52435861 CCTGAGCTGAGGTGAGGGGCTGG + Intergenic
1190685568 X:52869588-52869610 CCTGAGCTGAGGTGAGGGGCTGG + Intergenic
1191001009 X:55659476-55659498 CCTGAGCTGAGGTGAGGGGCTGG + Intergenic
1191027574 X:55930962-55930984 CCTGAGGTACAGAGAGAAGCTGG - Intergenic
1191095046 X:56665085-56665107 CCTGGGCTGCACACAGTGGGAGG - Intergenic
1193068904 X:77286405-77286427 CCAGAGGTGCAGAGAGGAGCTGG + Intergenic
1194600568 X:95915798-95915820 CCTCAGTTGCAGAGAATGGATGG + Intergenic
1195247106 X:103004730-103004752 TCTGGGCTGCTGAGGGTGGCAGG + Intergenic
1195291722 X:103436522-103436544 TCTGAACTGCAGAGAGTCTCCGG - Intergenic
1196707269 X:118727468-118727490 CCTGAGCCGGCGAGAGCGGCCGG - Intergenic
1196791045 X:119465198-119465220 CATGAGCCGCAGCGACTGGCCGG - Intergenic
1197689020 X:129477221-129477243 GCTGCGATGCAGAGAATGGCAGG - Intronic
1197709123 X:129653714-129653736 CCTGAGCTGCAGGGAGGGGTCGG + Intronic
1200957941 Y:8970368-8970390 CCTGTGCACCAGAGAGTGTCTGG - Intergenic
1200969892 Y:9140565-9140587 CCTCTGCAGCAGAGAGTAGCCGG + Intergenic