ID: 1084751631

View in Genome Browser
Species Human (GRCh38)
Location 11:71208106-71208128
Sequence GGGTTTAAGTACAGGGACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084751631_1084751640 6 Left 1084751631 11:71208106-71208128 CCAGCGTCCCTGTACTTAAACCC 0: 1
1: 0
2: 1
3: 5
4: 127
Right 1084751640 11:71208135-71208157 GGGCACAGAAAGCCATGCAGTGG 0: 1
1: 1
2: 1
3: 39
4: 325
1084751631_1084751644 18 Left 1084751631 11:71208106-71208128 CCAGCGTCCCTGTACTTAAACCC 0: 1
1: 0
2: 1
3: 5
4: 127
Right 1084751644 11:71208147-71208169 CCATGCAGTGGTGTTCCCAGGGG 0: 1
1: 0
2: 2
3: 22
4: 273
1084751631_1084751642 17 Left 1084751631 11:71208106-71208128 CCAGCGTCCCTGTACTTAAACCC 0: 1
1: 0
2: 1
3: 5
4: 127
Right 1084751642 11:71208146-71208168 GCCATGCAGTGGTGTTCCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 183
1084751631_1084751641 16 Left 1084751631 11:71208106-71208128 CCAGCGTCCCTGTACTTAAACCC 0: 1
1: 0
2: 1
3: 5
4: 127
Right 1084751641 11:71208145-71208167 AGCCATGCAGTGGTGTTCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084751631 Original CRISPR GGGTTTAAGTACAGGGACGC TGG (reversed) Intronic
901633649 1:10659771-10659793 GTGTTGAAGGACAGGGAGGCAGG + Exonic
902835214 1:19043032-19043054 GGGGTTCAGCACAGGGACTCTGG - Intergenic
906131178 1:43458105-43458127 GGGTTTCATTCCAGGGATGCAGG + Intergenic
906290073 1:44614085-44614107 GGGTTTCAGGACTGGGATGCTGG + Intronic
908883718 1:68762886-68762908 GGGTTTCATTTCAGGGATGCAGG + Intergenic
909298871 1:73985352-73985374 GGGTTTCATTCCAGGGATGCAGG - Intergenic
911530035 1:99033009-99033031 GGGATGAAGTAGAGGGATGCTGG - Intergenic
911999317 1:104810802-104810824 GGGTTTTATTCCAGGGATGCAGG - Intergenic
921181903 1:212638011-212638033 GGGGTTAAGTAGAGGCAAGCCGG - Intergenic
921843185 1:219850624-219850646 GGGTTTCATACCAGGGACGCAGG + Intronic
921861705 1:220047973-220047995 GTGTTAAAGTACGGGGACCCGGG + Intergenic
923953392 1:238987356-238987378 GGGTTTGAGTACCAGGATGCAGG - Intergenic
924280523 1:242432586-242432608 GGGTTTAAGTACAACCACACAGG + Intronic
924494538 1:244574287-244574309 CGGTTAAAGTACAAGGACACAGG + Intronic
1067435378 10:46273025-46273047 GGGCTTTAGTGCAGGGATGCTGG - Intergenic
1067438345 10:46294338-46294360 GGGCTTTAGTGCAGGGATGCTGG + Intronic
1067838181 10:49654461-49654483 GGGTGCAAGCCCAGGGACGCTGG + Intronic
1069225005 10:65932095-65932117 GGGGTTAAGAATAGGGACTCTGG + Intronic
1069648524 10:70023679-70023701 GGGTTTAATACCAGGGATGCAGG + Intergenic
1073111195 10:101063889-101063911 GGTTTTGATTACAGGCACGCAGG + Intronic
1075947116 10:126443835-126443857 GGGTTTCACAACAGGGATGCAGG + Intronic
1076317748 10:129554753-129554775 GGGTCTAAGTACAAGAACGGAGG - Intronic
1076537545 10:131190581-131190603 GGGTTTTATTTCAGGGAGGCAGG + Intronic
1081326384 11:41750541-41750563 GGGTTTTATTCCAGGGATGCAGG - Intergenic
1083768177 11:64852287-64852309 CGGTTTAAGTACAGGGAAGCCGG - Exonic
1083856177 11:65394146-65394168 GGGTCTAGGGACAGGGAGGCTGG - Intronic
1084751631 11:71208106-71208128 GGGTTTAAGTACAGGGACGCTGG - Intronic
1086239798 11:84675849-84675871 GGATTTATGCACAGGGACTCTGG + Intronic
1087914158 11:103789183-103789205 GTGGTTAAGTACAGAGACTCTGG + Intergenic
1088413222 11:109559430-109559452 GGGTTTCATTCCAGGGATGCAGG - Intergenic
1088951452 11:114575004-114575026 GGGTTTCATACCAGGGACGCAGG + Intronic
1090516758 11:127437003-127437025 GGGTATAAATACAGAGAGGCAGG - Intergenic
1091839687 12:3611935-3611957 AGGTATAAGAACAGGGAAGCAGG + Intronic
1092507534 12:9119430-9119452 GGGTTTAAGGACAAGGACATTGG + Intergenic
1094263135 12:28524430-28524452 GGGTTTAATACCAGGGATGCAGG - Intronic
1096869224 12:54583086-54583108 GGGTAGAGGTACAGGGAAGCGGG + Intronic
1099476787 12:83117432-83117454 GGGTTTCATTTCAGGGATGCAGG + Intronic
1104224528 12:126818900-126818922 GGGTTTAAGAAGAGAGACTCGGG + Intergenic
1111160588 13:84390017-84390039 GGGTTTCATTCCAGGGATGCAGG - Intergenic
1112191195 13:97179567-97179589 GAATTTAAGTCCAGGGAAGCAGG - Intergenic
1116324711 14:43517845-43517867 GGGTTTCATAACAGGGATGCAGG + Intergenic
1116353576 14:43898320-43898342 GTGTTTAATAACAGGGACTCTGG + Intergenic
1116445039 14:44999233-44999255 GTGTTTAAGTACAGTGAGGTAGG - Intronic
1126688339 15:51267435-51267457 TGGCTTGAGCACAGGGACGCTGG + Intronic
1127028532 15:54835046-54835068 GGCTTTAAGTCCAAGGACACAGG - Intergenic
1129632212 15:77272922-77272944 GGGTTTCATAACAGGGATGCAGG + Intronic
1130429889 15:83836873-83836895 GTGTTTAAGTGCAGGGACTTTGG - Intronic
1135205579 16:20480983-20481005 TGGTTTAAGAACAGGGACTGTGG + Intronic
1135213328 16:20542830-20542852 TGGTTTAAGAACAGGGACTGTGG - Intronic
1136750605 16:32632449-32632471 GGGTTAAAATACAAGGAAGCCGG + Intergenic
1138746929 16:59374458-59374480 GGGGTTAATTCCAGGGATGCAGG - Intergenic
1203052735 16_KI270728v1_random:891655-891677 GGGTTAAAATACAAGGAAGCCGG + Intergenic
1142517752 17:443779-443801 GGATTTAAATACAGGGGTGCAGG + Intronic
1144957590 17:19027018-19027040 GGGTCTAAGTCCAGGCAGGCTGG - Intronic
1144977566 17:19147498-19147520 GGGTCTAAGTCCAGGCAGGCTGG + Intronic
1149052906 17:52327513-52327535 GGGTTTCATACCAGGGACGCAGG + Intergenic
1149560601 17:57605500-57605522 GGGGTGGAGTACGGGGACGCTGG - Intronic
1153594696 18:6713261-6713283 GGTTTTAAATACAGGTACTCTGG + Intergenic
1156643234 18:39127352-39127374 GGGTTTCATAACAGGGATGCAGG + Intergenic
1161846579 19:6714560-6714582 GTGGTTAAGAACAGGGACCCAGG + Intronic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
932473428 2:71980882-71980904 GGGTTTCATTCCAGGGATGCAGG + Intergenic
934739469 2:96709289-96709311 GGGTTTATGTAAAGAGACGCAGG - Intronic
935106229 2:100046346-100046368 TGGTTTAAGAACATGGACTCTGG - Intronic
937267307 2:120624691-120624713 GTGTTGAAGCACAGTGACGCTGG + Intergenic
943582549 2:189702000-189702022 AGTTCAAAGTACAGGGACGCAGG - Intronic
944902156 2:204226472-204226494 GGATTTAAGTCCGGGCACGCTGG + Intergenic
945049393 2:205808780-205808802 GGGTTTGAGGACATGGATGCAGG - Intergenic
945622141 2:212153242-212153264 GGTTTAAAGTACAGGGAACCTGG - Intronic
948102082 2:235383305-235383327 GGGTCTTAGTACAGTGACCCTGG - Intergenic
948704167 2:239778985-239779007 GGGTTGGAGCACAGGGACGTGGG - Intronic
1169198780 20:3697533-3697555 GGGTTGCAGTACAGGGAAGGAGG + Intronic
1173961466 20:47075623-47075645 GGGTTCAAGTATAGCGACTCAGG + Intronic
1176906401 21:14506855-14506877 GGGTTTAATACCAGGGATGCTGG + Intronic
1179404100 21:41111200-41111222 GGGTTTAAGCAGAGGGAGGCAGG + Intergenic
1180278695 22:10671551-10671573 GGGTTAAACCACAGGGACCCAGG - Intergenic
1185070234 22:48652046-48652068 GGGTTTAATTACAGGAGTGCAGG + Intronic
954938516 3:54349213-54349235 GGGTTCAAGAACAGGGACTTAGG + Intronic
956271646 3:67454192-67454214 CTCTTTAAGTACAGGGACGAGGG + Intronic
956559774 3:70562317-70562339 GGGTTTTGTTACAGGGATGCAGG - Intergenic
964808866 3:160641002-160641024 GGGTATAAATACAGGGACAATGG + Intergenic
965594572 3:170397991-170398013 GGGTTTGAATACCGGGAGGCAGG + Intergenic
967977324 3:195042691-195042713 GGGTTGGGGTACAGGGAGGCAGG + Intergenic
968513074 4:1003748-1003770 GGGGTGAAGGGCAGGGACGCAGG - Intronic
969165341 4:5305017-5305039 GGGTTTCATAACAGGGATGCAGG - Intronic
971182803 4:24346109-24346131 GGGTTTCATACCAGGGACGCAGG - Intergenic
976825401 4:89255143-89255165 GTGTTTAAGAACATGGACTCTGG + Intronic
977635823 4:99297074-99297096 GGGTTTCATACCAGGGACGCAGG + Intergenic
977904380 4:102458670-102458692 GGGTTTCAGACCAGGGATGCAGG + Intergenic
978577233 4:110199223-110199245 GGGTTTAGGTACCGGGAAGGGGG + Intergenic
987916570 5:24222785-24222807 GGGTTTCATTACAGGGATGCAGG - Intergenic
992179966 5:74185990-74186012 GGGTTTAAGAGCAGGGAGTCTGG + Intergenic
992269693 5:75052724-75052746 GGGCTTCGGGACAGGGACGCGGG - Intergenic
995857730 5:116611189-116611211 GGATGTAAGTACAGGCACACAGG - Intergenic
996123734 5:119701686-119701708 GGGTTTCATAACAGGGATGCAGG - Intergenic
996503922 5:124247426-124247448 GGGTTTCAGTGCAGCGATGCAGG + Intergenic
999337824 5:150738427-150738449 GGGTTTAATACCAGGGATGCAGG + Intronic
1000394953 5:160764373-160764395 GGGTTTCATACCAGGGACGCAGG + Intronic
1001167035 5:169378552-169378574 GGGTTTCACACCAGGGACGCAGG + Intergenic
1008775094 6:55028697-55028719 GGGTTTCATACCAGGGACGCAGG - Intergenic
1009298040 6:61979565-61979587 GGGTATATATACAGGAACGCAGG - Intronic
1010518062 6:76799155-76799177 GGGTTTCATGACAGGGATGCAGG - Intergenic
1013508496 6:110822743-110822765 GGGTTTCAGCCCAGGGATGCAGG + Intronic
1014285359 6:119490979-119491001 GGGTTTCATACCAGGGACGCAGG + Intergenic
1016176500 6:141082788-141082810 GGGTTTCATACCAGGGACGCAGG + Intergenic
1020033768 7:4951423-4951445 GGGGTGAAGTGCAGGGACCCAGG - Intronic
1020374711 7:7471531-7471553 GGGTTTCATAACAGGGATGCAGG + Intronic
1020997728 7:15284890-15284912 GGGTTTCATTACAGGGATGCAGG + Intronic
1022759383 7:33331081-33331103 GGGTTTCATTCCAGGGATGCAGG + Intronic
1024692567 7:51818945-51818967 GGGTTTAATTAAAGGGAGGTGGG - Intergenic
1029053484 7:97714847-97714869 GGGTTTTATAACAGGGATGCAGG + Intergenic
1030255322 7:107504327-107504349 GGGTTTTATTTCAGGGATGCAGG - Intronic
1033268209 7:139905445-139905467 GGGTTTCATAACAGGGATGCAGG - Intronic
1044227920 8:89740339-89740361 GGGTTTCATAACAGGGACGCAGG + Intergenic
1044907553 8:97021034-97021056 GGGTTTCATACCAGGGACGCAGG + Intronic
1045492019 8:102677131-102677153 GAGTCTAAGTACAGGAAAGCAGG - Intergenic
1045878229 8:107007802-107007824 GGGTTTCATACCAGGGACGCAGG + Intergenic
1046985882 8:120388176-120388198 GGGTTTCACTCCAGGGATGCAGG - Intronic
1047192054 8:122687139-122687161 GCGTTTAAGTAGAGGGAAGAAGG - Intergenic
1048415205 8:134220291-134220313 GGGTTTAATTCCAAGGATGCAGG + Intergenic
1049654990 8:143793389-143793411 GGGTTTAAGGCAAGGGACGGGGG + Intronic
1052638394 9:31132156-31132178 GGGTTTCATACCAGGGACGCAGG - Intergenic
1056037959 9:82628998-82629020 GGAGTGAAGTACAGGGAAGCAGG - Intergenic
1056777528 9:89524467-89524489 GGGTTCAAGGACAGGAACACAGG - Intergenic
1058420763 9:104831087-104831109 GGTTTTAGGTACTGGGACCCTGG - Exonic
1060500143 9:124147055-124147077 GGCTTTCAGTAAAGGGACACAGG + Intergenic
1187036963 X:15550361-15550383 GCAGTTAAGAACAGGGACGCTGG - Intronic
1187812962 X:23200424-23200446 GGGTGTGAGTACAGGGGAGCAGG - Intergenic
1191045617 X:56133327-56133349 GGGTTTCATTCCAGGGATGCAGG + Intergenic
1191954480 X:66629002-66629024 GGGTTTCATACCAGGGACGCAGG + Intronic
1193157254 X:78187275-78187297 GGGTTTCATAACAGGGATGCAGG + Intergenic
1193307702 X:79969152-79969174 GGGTTTTATTCCAGGGAAGCAGG - Intergenic
1194874320 X:99167503-99167525 GGGTTTCATTCCAGGGATGCAGG + Intergenic
1196244238 X:113380605-113380627 GGGTTTCATTCCAGGGATGCAGG - Intergenic