ID: 1084752964

View in Genome Browser
Species Human (GRCh38)
Location 11:71215937-71215959
Sequence CTTGGTTATCTTCATCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 163}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084752964_1084752969 1 Left 1084752964 11:71215937-71215959 CCTCCAGGATGAAGATAACCAAG 0: 1
1: 0
2: 2
3: 13
4: 163
Right 1084752969 11:71215961-71215983 AGAGAGATGGGAACAGAAGCAGG 0: 1
1: 0
2: 4
3: 77
4: 751
1084752964_1084752971 7 Left 1084752964 11:71215937-71215959 CCTCCAGGATGAAGATAACCAAG 0: 1
1: 0
2: 2
3: 13
4: 163
Right 1084752971 11:71215967-71215989 ATGGGAACAGAAGCAGGCAAGGG 0: 1
1: 0
2: 4
3: 35
4: 452
1084752964_1084752970 6 Left 1084752964 11:71215937-71215959 CCTCCAGGATGAAGATAACCAAG 0: 1
1: 0
2: 2
3: 13
4: 163
Right 1084752970 11:71215966-71215988 GATGGGAACAGAAGCAGGCAAGG 0: 1
1: 1
2: 2
3: 56
4: 505
1084752964_1084752972 12 Left 1084752964 11:71215937-71215959 CCTCCAGGATGAAGATAACCAAG 0: 1
1: 0
2: 2
3: 13
4: 163
Right 1084752972 11:71215972-71215994 AACAGAAGCAGGCAAGGGAGTGG 0: 1
1: 0
2: 6
3: 92
4: 1458
1084752964_1084752973 21 Left 1084752964 11:71215937-71215959 CCTCCAGGATGAAGATAACCAAG 0: 1
1: 0
2: 2
3: 13
4: 163
Right 1084752973 11:71215981-71216003 AGGCAAGGGAGTGGAGCAAGTGG 0: 1
1: 2
2: 4
3: 81
4: 975

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084752964 Original CRISPR CTTGGTTATCTTCATCCTGG AGG (reversed) Intronic