ID: 1084753991

View in Genome Browser
Species Human (GRCh38)
Location 11:71223055-71223077
Sequence GAGGGAGCTCAGAGATTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084753986_1084753991 12 Left 1084753986 11:71223020-71223042 CCACATCTGGGAGGTGAGTGACA 0: 1
1: 0
2: 26
3: 193
4: 1833
Right 1084753991 11:71223055-71223077 GAGGGAGCTCAGAGATTTGGAGG 0: 1
1: 0
2: 2
3: 21
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084753991 Original CRISPR GAGGGAGCTCAGAGATTTGG AGG Intronic
900361029 1:2289219-2289241 CAGGGAGCTCAGAGACCCGGAGG + Intronic
900515650 1:3081024-3081046 AAGGGAGCTCAGAGAATCGGGGG + Intronic
901032584 1:6316262-6316284 GAGGGAGGACAGAGACATGGGGG + Intronic
901082010 1:6588883-6588905 GGGTGAGCTCAGAACTTTGGGGG - Intronic
902292124 1:15442362-15442384 GAGGGAGCTCGGGGCTTTAGTGG - Intronic
902374105 1:16022228-16022250 GAGGGTGCTCCGAGATTGGCAGG + Intronic
903281065 1:22250286-22250308 GAGGGAGGGAAGTGATTTGGGGG + Intergenic
903328198 1:22583259-22583281 CAGGGAGCCCAGAGACCTGGAGG - Intronic
903357526 1:22757184-22757206 GAGGGTGCTCAGGGTTTGGGTGG + Intronic
903572839 1:24319068-24319090 GAGGGGGCAAAGAAATTTGGGGG + Intergenic
903950024 1:26991348-26991370 ATGGGAACTCAGAGAGTTGGAGG - Intergenic
904906757 1:33902966-33902988 GAAGGAGGTGAGAGATTTGATGG - Intronic
904939600 1:34156221-34156243 GAGAGAGTTCAGTGATTGGGTGG - Intronic
904944344 1:34188432-34188454 CAGGGAGCTGAGAGATTTCACGG + Intronic
906023996 1:42657648-42657670 GAGGGATCTCAGTGACCTGGAGG + Intergenic
908817791 1:68051694-68051716 GACGGAGCTCGGAGATGTGGAGG - Intergenic
909775262 1:79477584-79477606 GAGGTAGCTGAGAGATTGGGAGG - Intergenic
910459877 1:87437341-87437363 CAGGAAGCACTGAGATTTGGAGG + Intergenic
912014707 1:105018204-105018226 GAGGGAGCTGAGTGAATTGCAGG - Intergenic
912146763 1:106803737-106803759 GATGGTGCTCAGAAATTTGTGGG - Intergenic
913215089 1:116613595-116613617 GAGGGAGCTGAGGGATGTGTGGG - Intronic
914764165 1:150623221-150623243 GAGGTAGCACAGAGATGAGGTGG + Intronic
916461069 1:165025010-165025032 GAGGGAGCTGAGGAATTTGAGGG + Intergenic
916571109 1:166028556-166028578 GACATAGCTCAGTGATTTGGGGG - Intergenic
918333192 1:183480052-183480074 GTGGTAGTTCAAAGATTTGGTGG + Intronic
918927863 1:190810567-190810589 GAGGTAGCACAGGCATTTGGAGG - Intergenic
919548560 1:198954968-198954990 GAAGGAGATCAAAGATTTGTAGG + Intergenic
920938654 1:210459700-210459722 GAGGGAGCTCAGAACTGTTGAGG - Intronic
921605950 1:217155049-217155071 CAGAGAGCTGAGAGACTTGGGGG - Intergenic
922109733 1:222545414-222545436 GAAGGAGCTCAGAGATTCGCAGG + Intronic
923057497 1:230438094-230438116 GAGGGAGCATGGAGATTTGGCGG - Intergenic
923238163 1:232055204-232055226 GAGAGAGCTCACAGGGTTGGAGG - Intergenic
923791068 1:237111753-237111775 CAGAAAGCTCTGAGATTTGGAGG + Intronic
924459639 1:244247620-244247642 GAGGGAGAGCAGAGACTGGGGGG + Intergenic
1064487734 10:15813241-15813263 GAGGGAGCACTGAGAATTAGGGG - Intronic
1064619796 10:17203225-17203247 GGGGGAGCTTAGAAATTTTGTGG + Intergenic
1065808442 10:29417983-29418005 GGAGGAGCTCATAGATTTGTGGG + Intergenic
1067104947 10:43360404-43360426 GATGGAGCACAGAGAGTAGGCGG + Intergenic
1067528316 10:47051754-47051776 GAGGGAGATCAGAGAGTGTGTGG + Intergenic
1068253558 10:54476623-54476645 AAGGGTGATCAGAAATTTGGAGG + Intronic
1069351807 10:67535511-67535533 GTTTGAGCTCAGAGAGTTGGAGG + Intronic
1069688709 10:70335502-70335524 GAGGGAACTCATCGCTTTGGAGG + Intronic
1075852473 10:125600425-125600447 CAGGGATCTCACAGATATGGTGG - Intronic
1076109768 10:127851486-127851508 GAGGGAGGTCAGAGAGATTGGGG + Intergenic
1076697421 10:132253623-132253645 GAGGGAGCTGAGGGAGCTGGAGG + Intronic
1076847366 10:133075837-133075859 AACGGAGGGCAGAGATTTGGGGG + Intronic
1078187810 11:9067052-9067074 GAGGGAGATGGGAGAGTTGGGGG + Intronic
1078654525 11:13225991-13226013 GAGGGAGCTGAAAGAAGTGGTGG - Intergenic
1079303407 11:19299799-19299821 GATGGAGCTCAGATATTTGTTGG + Intergenic
1080308156 11:30858965-30858987 GAGGGGGCTCACAGAATTGAAGG - Intronic
1083738280 11:64694174-64694196 GGGGGGGCTCTGAGGTTTGGTGG - Intronic
1084753991 11:71223055-71223077 GAGGGAGCTCAGAGATTTGGAGG + Intronic
1085032935 11:73283597-73283619 GATGGAGCTCAGACAGTTGCTGG + Intronic
1085870726 11:80346628-80346650 GAGGGAGCTCACAGGTAAGGGGG + Intergenic
1086142271 11:83512291-83512313 GCTGGAGCTCAGAGAAATGGTGG + Intronic
1087707313 11:101508630-101508652 GAGGAAGTTCAAAGATTAGGGGG + Intronic
1088091856 11:106050423-106050445 GAGGGATCACTGAGATTTGCAGG + Intergenic
1088722398 11:112605933-112605955 GAGTGAACACAGAGATTAGGAGG - Intergenic
1089729287 11:120510794-120510816 GAGGGAGCTAATAGGTTTGAGGG + Intergenic
1090050356 11:123372651-123372673 GAAGGAGGGGAGAGATTTGGTGG - Intergenic
1092161344 12:6317063-6317085 GAGGGAGCTCAGAGAGCTCTGGG + Intronic
1092764641 12:11841661-11841683 AAGGGAGTTCAGAGATTAGAGGG + Intronic
1093300788 12:17452061-17452083 GAGGGAGCACAGAGATGAGTTGG + Intergenic
1093387709 12:18579509-18579531 GAGAGATCTCAGAGATTTATAGG - Intronic
1094487713 12:30938281-30938303 GAGGGTGGACAGACATTTGGGGG - Intronic
1095316275 12:40765866-40765888 GATGGAGCTCATAGTGTTGGAGG + Intronic
1096361987 12:50995860-50995882 GAGTCAGCTGAGAGATTTAGGGG + Intronic
1096542981 12:52318543-52318565 GAGGCAGCTCAGAGACAGGGAGG + Intronic
1096604100 12:52752730-52752752 GATGGAGCTGGGAGTTTTGGGGG - Intergenic
1097160532 12:57043507-57043529 GAGGAATCTCAGGGAGTTGGGGG + Intronic
1098510880 12:71312869-71312891 GAGGGGGCTGAGGGACTTGGAGG - Intronic
1102215877 12:111161028-111161050 GGTGGAGCTCAGAGACCTGGGGG + Intronic
1102244173 12:111344609-111344631 GAGGGAGCTGAGGGAGGTGGGGG + Intronic
1103288805 12:119826771-119826793 GAGTGAGCCAAGAGATTTTGTGG + Intronic
1103576475 12:121881308-121881330 CAGGGAGGGAAGAGATTTGGAGG - Intergenic
1104373484 12:128244227-128244249 GAGGGATCTCTGAGAGTGGGTGG - Intergenic
1105218822 13:18307085-18307107 GAGGGAGCTGAGGGATGTGCGGG - Intergenic
1106767755 13:32932132-32932154 GAGGAAGTTCAGAGAGGTGGTGG + Intergenic
1107692677 13:42967802-42967824 GAGGGAGATAAGAGAGTTCGGGG - Intronic
1109249872 13:60006664-60006686 GGGGGAGCTCAGAGATGAGGTGG + Intronic
1111435968 13:88208506-88208528 GAGGGAGGTCAGGGATCTAGAGG + Intergenic
1111737320 13:92159146-92159168 TAGGGAGTTGAGGGATTTGGTGG - Intronic
1115460066 14:33650508-33650530 TAGTGAGCTCCGAGCTTTGGAGG + Intronic
1116494014 14:45538578-45538600 GAGGGAGCTCAGAGATTTAAGGG - Intergenic
1116528040 14:45931995-45932017 GATGTATCTCAGAGATGTGGAGG + Intergenic
1117327900 14:54685754-54685776 AAGGGACCTCAGAGATTTTCTGG - Intronic
1117480186 14:56135483-56135505 ATGGTAGCTCAGAGATTTTGAGG + Intronic
1117589429 14:57251289-57251311 CAGGGATCTCAGATATTTGGAGG - Intronic
1119477501 14:74939529-74939551 GGGGGTGCTGGGAGATTTGGGGG + Intergenic
1121277251 14:92676766-92676788 GCAGGAGCTCACAGATTAGGGGG + Intronic
1126185608 15:45828582-45828604 GAGGGAGCACAGAGAGGAGGTGG + Intergenic
1128232082 15:66042504-66042526 CAGGGAGCTCAGAGCACTGGGGG + Intronic
1128327102 15:66730948-66730970 CAGTGAGCTCAGAGACTGGGTGG + Intronic
1128659545 15:69488184-69488206 CAGGGAGCTCAGAGAGTAGCAGG + Intergenic
1128764291 15:70241706-70241728 GAGGAAGCTGAGAGATCTTGAGG + Intergenic
1129162500 15:73754245-73754267 GAGGGAGCTTTGATATTGGGAGG + Intergenic
1129276915 15:74451743-74451765 AAAGGAGCACAGAGATTTGAAGG - Intronic
1129890667 15:79069688-79069710 AAGGGAAGTCAAAGATTTGGGGG + Intronic
1130554202 15:84911323-84911345 GAGGGAGCTCAGTGGTGTTGCGG + Intronic
1132481193 16:166921-166943 GAGGGAGCACTGTGATGTGGCGG + Intergenic
1132721071 16:1315852-1315874 GAGTGAGATCACAGATTTGGAGG + Intronic
1135045123 16:19149110-19149132 GCGGGATCTGAGAGAGTTGGGGG + Intronic
1137534041 16:49304014-49304036 GAAGGAGATCAGAGTTTTGAGGG - Intergenic
1138520299 16:57567282-57567304 GAGGGAGATGGGAGATGTGGAGG + Intronic
1138618127 16:58188361-58188383 GAGGGAGCTCGAAACTTTGGGGG + Intronic
1139148579 16:64352078-64352100 GAGGCTTCTCAGAGACTTGGGGG + Intergenic
1140714053 16:77706011-77706033 AAAGGAGCTCAGAGCATTGGAGG - Intergenic
1143845282 17:9769092-9769114 GAGGGAGGTCAGAGACTTGCGGG - Intergenic
1144827211 17:18112209-18112231 GAGAGAGGTCAGAGACTTGCTGG - Intronic
1146405300 17:32531426-32531448 GAAGGAACTCAGAGAGTTGCAGG - Intronic
1146787627 17:35732736-35732758 GTGGCAGCTCAGAGATTTCTAGG - Intronic
1149508045 17:57212209-57212231 GAGTGAGCTCAGACACTTGAGGG - Intergenic
1150442278 17:65201247-65201269 GAGGGAGATGAAGGATTTGGGGG + Intronic
1151557482 17:74854000-74854022 GAAGGAGCTCAGAGCTTTGGAGG - Intronic
1151570373 17:74922829-74922851 GAGGCAGCTCAGAGGAGTGGTGG + Intronic
1152441075 17:80310117-80310139 GACAGAGCTCAGAGACATGGGGG - Intronic
1153540409 18:6147996-6148018 CAGGGAGATCAGAGGTTTGATGG + Intronic
1153784600 18:8523401-8523423 CAGGGGGATCAGAGATGTGGAGG + Intergenic
1155586675 18:27374527-27374549 GAGAGAGCTCAAAGCATTGGCGG + Intergenic
1155869227 18:31005257-31005279 GAGGGAGCGGAGAGATTTCAAGG - Intronic
1155979721 18:32167432-32167454 GAAGGTGCTAAGAGATGTGGGGG - Intronic
1159910130 18:74138152-74138174 GAGGGAGCCTAGAAATTAGGTGG - Intronic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1161438556 19:4278470-4278492 GAGGGCACTGAGAGGTTTGGGGG - Intergenic
1161506976 19:4649348-4649370 GAGGAAGCTCACAGCTTAGGGGG + Intronic
1162398196 19:10430208-10430230 GAGTGCCCCCAGAGATTTGGGGG + Intronic
1162775423 19:12975935-12975957 GGCGGAGCTCTGAGATTTTGTGG + Intergenic
1164604352 19:29586496-29586518 GAGAGTGCTCAGAGATCTGCTGG - Intergenic
1164632255 19:29769356-29769378 GAGGGTGCACAGGGAGTTGGTGG - Intergenic
1164739828 19:30567621-30567643 GAGGGAGCATAGAGAGTGGGTGG + Intronic
1164876435 19:31693971-31693993 ATGGGAGCTCAGGGATGTGGAGG - Intergenic
1166015761 19:39978236-39978258 GGGGGAGCTGAGAGATTGGGAGG + Intronic
1166251790 19:41576372-41576394 GAGGGAGCACAGAGACTGGCTGG + Intronic
1166255271 19:41599831-41599853 GAGGGAGCACAGAGACTGGCTGG + Intronic
1166605805 19:44141720-44141742 GTGGGAGAGCAGAGGTTTGGTGG + Exonic
1166719613 19:44989566-44989588 GGGGGAGCTCTGGGATGTGGGGG + Intronic
1166784081 19:45357431-45357453 GAGGGAGGTCAGGGACTAGGAGG + Intronic
1167371596 19:49085778-49085800 GTGGGTGCCCAGAGATTTCGGGG - Intronic
925919310 2:8628270-8628292 GAGGGAGCTCGGAGCTTGAGGGG - Intergenic
926660019 2:15454733-15454755 GAGGGTGATCAGAAATTTGATGG - Intronic
926667409 2:15541217-15541239 CAGTGAGCTCAGAGACTTGTGGG - Intronic
927031325 2:19123327-19123349 ATGGGAGCTCAAAGATCTGGAGG - Intergenic
927959708 2:27233515-27233537 GAGGGAGCTCAGTGACCTCGAGG + Exonic
928651451 2:33407984-33408006 GTGGGAGCACAGGGATTTGTAGG - Intergenic
928906747 2:36376564-36376586 GAGGGAGGTCGTAGACTTGGAGG + Intronic
930171372 2:48255126-48255148 GAGAGAGGTAAGAGATTAGGTGG + Intergenic
930411521 2:51031570-51031592 GATGGAGCTTAGAGACTGGGCGG - Intronic
930411807 2:51033228-51033250 AAGGGAGCTTACAGATTAGGTGG + Intergenic
932950853 2:76291309-76291331 GAGAGAGCCCAGGGAGTTGGAGG + Intergenic
933109514 2:78379266-78379288 GAGGGAGGGGAGAGATTGGGAGG + Intergenic
934295494 2:91739550-91739572 GAGGGAGCTGAGGGATGTGCGGG + Intergenic
935830588 2:106997471-106997493 GAGGGAGATCAGAGCTGTGATGG + Intergenic
935839130 2:107089759-107089781 GAGTGAGCTGAGAGATGTAGAGG + Intergenic
936860851 2:117018705-117018727 AAGGAAGCTGAGATATTTGGGGG + Intergenic
937115841 2:119404451-119404473 GAGGCAGCACAGAGCTATGGGGG - Intergenic
941953610 2:171181870-171181892 GAGGCAGCTGACAGATTAGGAGG - Intronic
942599022 2:177621136-177621158 TAGGGATCCCAGAAATTTGGAGG - Intergenic
946902791 2:224388854-224388876 GAGTGAGCCCAGAGCTCTGGAGG + Intronic
947346847 2:229200590-229200612 GTGGGAGCTCAGTGGTTGGGAGG - Intronic
1168980498 20:1999389-1999411 CAGAGAACTCAGAGATCTGGAGG + Intergenic
1170163282 20:13337452-13337474 CAGTGAGGTCTGAGATTTGGGGG - Intergenic
1170515762 20:17128776-17128798 AAAAGACCTCAGAGATTTGGGGG + Intergenic
1171423421 20:25034050-25034072 GAGAGAGCTCTGAGATTTACCGG - Intronic
1171947136 20:31388741-31388763 GTGGGAGCTGAGAGATTTAAAGG - Intronic
1173007751 20:39153402-39153424 GAGGAAGCTGAGAGATTTTAGGG + Intergenic
1173311918 20:41904399-41904421 GCAGGAGATCAGAGGTTTGGAGG + Intergenic
1174132272 20:48354131-48354153 GTGGGTGCTCAGAGAGATGGTGG + Intergenic
1174905568 20:54546868-54546890 CAGGGAGACCAGACATTTGGTGG + Intronic
1175377513 20:58539025-58539047 GAGAGAACTGAGATATTTGGAGG + Intergenic
1175392497 20:58636073-58636095 GAGGGAGCACAGAGAGAGGGAGG + Intergenic
1175392534 20:58636193-58636215 GAGGGAGCACAGAGAGAGGGAGG + Intergenic
1175394398 20:58649113-58649135 GAGGGAGGTCAGAGAGTTTGGGG + Intergenic
1176723901 21:10414386-10414408 GAGGGTGCACAGAGTTTTTGTGG + Intergenic
1179678478 21:43001049-43001071 GAGGGAAAGCAGAGATTTGGAGG + Intronic
1179921396 21:44509489-44509511 GAGGGGGCGCAGAGGTGTGGGGG + Intronic
1180305149 22:11067560-11067582 GAGGGTGCACAGAGTTTTTGTGG + Intergenic
1181458536 22:23072817-23072839 GAGGAACCTCAGAGACCTGGAGG + Intronic
1181774577 22:25150142-25150164 GAGGGAGCTCAGAGGTTGTCTGG - Intronic
1184148816 22:42627025-42627047 AAGGGAGTTCTGAGTTTTGGAGG + Intronic
1184517712 22:44972929-44972951 CAGGGCGCTCAGAGATGAGGAGG + Intronic
1184700782 22:46171299-46171321 GAAGGAGCTCAAATATCTGGTGG - Intronic
1185251394 22:49803662-49803684 GAGAGAGCTGAGAGAGTGGGAGG - Intronic
950433787 3:12966977-12966999 GAGGGAGAGCGGAGAGTTGGTGG - Intronic
951640029 3:24826702-24826724 AATGGAACTCAGAAATTTGGGGG - Intergenic
952326446 3:32324670-32324692 GAAGGAGCTCAGTGATGTAGAGG + Intronic
952872258 3:37911455-37911477 GTGGGAGCTCAGAGCCTTGAGGG + Intronic
954220654 3:49151697-49151719 GAGGGAGCACAGAGGTGAGGAGG + Intergenic
957218214 3:77348785-77348807 GAGAGAGGTCAGAGCTGTGGTGG - Intronic
957584959 3:82121209-82121231 CAGGGAGGTCACATATTTGGAGG + Intergenic
957911613 3:86625627-86625649 GCAGTAGCTCAGAGATTTGGGGG + Intergenic
960294669 3:115928525-115928547 AATGGAAGTCAGAGATTTGGGGG + Intronic
960505670 3:118490394-118490416 GAGGGATATCAGAGAATTTGTGG - Intergenic
960944416 3:122956473-122956495 GAAGGAGCGCAGAGAAGTGGGGG + Intronic
961545786 3:127632028-127632050 GGGAGAGCTCAGAGAGGTGGGGG + Intronic
962755145 3:138460688-138460710 GAGGGAGATCATAAGTTTGGGGG + Intronic
963986156 3:151597404-151597426 GAGGAAGCCCAGAGAGCTGGAGG + Intergenic
966969827 3:185033260-185033282 GGTGGAGCACAGGGATTTGGAGG - Intronic
967042199 3:185704121-185704143 GATGGAGCTCAGAAATGTTGTGG - Intronic
967413418 3:189190489-189190511 GAGGCTGCCCAGAGATTTGAGGG - Intronic
968489129 4:880817-880839 GAAGGAGCTGTGGGATTTGGGGG + Intronic
968688265 4:1975925-1975947 CAGGAAGGACAGAGATTTGGGGG + Intronic
969289518 4:6229763-6229785 GAAGGAGCACAGAGATTCTGAGG - Intergenic
969525199 4:7700738-7700760 GAGGGAGCACAGAGCATTGGGGG + Intronic
969552014 4:7876169-7876191 GAGGGAGCTCAGGTTTTAGGTGG - Intronic
970584081 4:17498437-17498459 GAGAGAGCTCTGGGATTTTGAGG - Intronic
972601984 4:40581042-40581064 GTGGGAGCACAGAGGTTGGGAGG + Intronic
972976557 4:44643174-44643196 GAGGGAGATGAGAAATTTAGTGG + Intronic
973824503 4:54691708-54691730 GATGGACCTCAGAGTTTTGAGGG + Intronic
979902321 4:126237532-126237554 GAGAGAGATAAGAGTTTTGGGGG - Intergenic
979985196 4:127305323-127305345 GTGGGGGCTCTGAAATTTGGTGG - Intergenic
981029350 4:140108382-140108404 CAGGGAGCTCACAGTTTTGTTGG - Intronic
982773266 4:159417640-159417662 GAAAGAGCTGAGAGATTTGGAGG + Intergenic
984111007 4:175614599-175614621 GCTGGAGCTCAGAAGTTTGGAGG - Intergenic
985839725 5:2297329-2297351 GAGGCAGCTCAGAGATGAGCAGG - Intergenic
986833132 5:11604509-11604531 GAGGAAGCTCAAGGCTTTGGAGG - Intronic
987086598 5:14475321-14475343 GAGAGAGGCCAGAGCTTTGGAGG - Intronic
987497480 5:18666331-18666353 GAGGGGACTCAAAGATTTTGTGG - Intergenic
990031767 5:51269733-51269755 AAGGGATCTCAGAGCCTTGGGGG - Intergenic
990327971 5:54696943-54696965 GAGGGGACTCACAGAGTTGGAGG - Intergenic
992185008 5:74235465-74235487 GAGAAAGCACAGAGAGTTGGGGG - Intergenic
994024833 5:95070439-95070461 GTGGAAGCTGAGAGGTTTGGAGG - Intronic
995236566 5:109835889-109835911 GAAGGATCTGAGAGAGTTGGTGG + Intronic
995414709 5:111896144-111896166 GAGGAAGCACAGAGATTGGTAGG + Intronic
997497801 5:134345131-134345153 GAGGGAGTTCAGAGGTATAGGGG + Intronic
998352021 5:141508120-141508142 GAGGGAGGTCAGGGAGCTGGGGG + Intronic
998415380 5:141942305-141942327 GAGGCAGCTCAGAGATTGACAGG - Intergenic
999061248 5:148638271-148638293 GAGGGGGCTCAGAGTTCTGCAGG - Intronic
999486727 5:152004383-152004405 GAGCGAGCTCATGGATTGGGAGG + Intergenic
1001106446 5:168858610-168858632 GAGGGAGCTCAGAAAGCTGCTGG - Intronic
1001550391 5:172598393-172598415 GACGGAGCTCGGAGAATGGGAGG - Intergenic
1002422186 5:179154486-179154508 GAGGAGGCTCGGAGGTTTGGAGG - Intronic
1003144503 6:3498573-3498595 GAGGTGGCTCAGAGACATGGAGG - Intergenic
1003685431 6:8297709-8297731 CAAGGAGCTCAGAGTTTAGGTGG - Intergenic
1003963630 6:11232656-11232678 CAGTGAGCTCAGAGACTTGAGGG - Exonic
1005180443 6:23098338-23098360 GAGAGAGCTCAGTGAAGTGGTGG - Intergenic
1006429114 6:33984318-33984340 GGGGGAGTTCAGAGATGTGGAGG + Intergenic
1010826021 6:80476401-80476423 GATGGTGATCAGTGATTTGGAGG + Intergenic
1011027107 6:82881183-82881205 GAGGGAGCTATGAAGTTTGGAGG + Intergenic
1012973554 6:105756225-105756247 GAGGCAGCTCAGAGATTCAGAGG + Intergenic
1014906021 6:127028706-127028728 CAGGGATCTCAGAGAATTGTGGG - Intergenic
1015014259 6:128391305-128391327 AGGGGAACTGAGAGATTTGGTGG - Intronic
1015722287 6:136255454-136255476 TGGGGAGGTCAGAGAATTGGGGG - Intergenic
1015751503 6:136564444-136564466 GAGGGAGCACAGGGTCTTGGAGG + Intronic
1016684195 6:146863110-146863132 GAGGGAGCTCAGTGTTTTCTGGG - Intergenic
1017011570 6:150067188-150067210 GAGGGAGCTCAGTTATTTCCCGG - Intronic
1017670751 6:156767185-156767207 GAGGGACCTCAGTGAATGGGAGG - Intergenic
1017971464 6:159315726-159315748 GCGGGCGCTGAGGGATTTGGGGG - Intergenic
1018415551 6:163599512-163599534 AAGGGAGTATAGAGATTTGGGGG + Intergenic
1019512884 7:1426836-1426858 AAGTGAGCTCAGTGTTTTGGTGG - Intergenic
1019951745 7:4378772-4378794 CTGTGAGCTCAGAGATCTGGTGG - Intergenic
1020504341 7:8964585-8964607 CAGGGAGCTAAGAGATTTTCAGG + Intergenic
1020775097 7:12443184-12443206 AAGGGAGCACAGAGGTTTTGGGG - Intergenic
1022561200 7:31351701-31351723 GAGGCAGCACATATATTTGGTGG + Intergenic
1022960602 7:35422756-35422778 GAAGGAACTCACAGAATTGGGGG - Intergenic
1023140451 7:37096905-37096927 GAGGGTTGTCAAAGATTTGGGGG - Intronic
1026326491 7:69315060-69315082 GAGGTAGATGAGACATTTGGTGG - Intergenic
1026563370 7:71468944-71468966 GAAGGAGCTCAGAGATTGGTGGG + Intronic
1026887915 7:73965221-73965243 GAGGCTGCCCAGAGATTAGGAGG + Intergenic
1029180672 7:98699297-98699319 GAGGAAGCTCAGAGCACTGGTGG - Intergenic
1029536699 7:101161568-101161590 AAGGCAGCTCAGGGAGTTGGGGG - Intronic
1031134536 7:117872188-117872210 GAGGGAGAGGAGAGATGTGGAGG - Intronic
1032190372 7:129762043-129762065 AAGGGAGCAGAGTGATTTGGGGG - Intergenic
1034617251 7:152429137-152429159 AGGGGTGCTCAAAGATTTGGAGG - Intronic
1034671042 7:152858633-152858655 GAGGGAGATGAGAGATTGGGAGG + Intergenic
1036251391 8:7165802-7165824 GAGGGATCCCAGTGATTTTGAGG + Intergenic
1036366097 8:8121658-8121680 GAGGGATCCCAGTGATTTTGAGG - Intergenic
1042209167 8:66361313-66361335 GACTGAGCTTATAGATTTGGAGG + Intergenic
1042492819 8:69420168-69420190 CAAGAAGTTCAGAGATTTGGTGG - Intergenic
1045303147 8:100932319-100932341 GAGGGAGTTCAGAGCTAAGGTGG - Intronic
1045583643 8:103505149-103505171 TAGGTAGCTAAGAAATTTGGGGG - Intronic
1047185624 8:122630464-122630486 CAGGTAGCTCACAGAATTGGTGG - Intergenic
1047197121 8:122731919-122731941 GGGTGAGCTCAGAGAATTAGAGG - Intergenic
1050702735 9:8359171-8359193 CAGGGATCTTAGAGATCTGGTGG + Intronic
1050820135 9:9868492-9868514 GAGAAAGATAAGAGATTTGGAGG + Intronic
1053425048 9:38004909-38004931 CTGGGAGCTGAGAGATTTGTGGG + Intronic
1054762072 9:69012870-69012892 CAGGAAGCCCAGATATTTGGAGG - Exonic
1055670433 9:78600183-78600205 AAGAGAGCTCAGAGGATTGGTGG + Intergenic
1056896546 9:90556126-90556148 GCTGGAGTTCAGAGATTGGGTGG - Intergenic
1057009541 9:91589475-91589497 GAGGGAGCACAGAGTTCTGACGG + Intronic
1057217869 9:93239328-93239350 CAGGGAGCTCAGAGCGTGGGGGG + Intronic
1057852821 9:98578286-98578308 GAGAGAGGTCCTAGATTTGGAGG - Intronic
1058114678 9:101071306-101071328 GAGGAAGAACAGATATTTGGAGG + Intronic
1058669579 9:107349245-107349267 AAGGTAGCTCAGTGATGTGGGGG - Intergenic
1059571826 9:115446026-115446048 GAGGCAGATCTGAGATCTGGAGG - Intergenic
1060944431 9:127561608-127561630 CAGGGAGCCCAGAGGTTTTGGGG - Intronic
1061547986 9:131315752-131315774 GAGGGAGCTGTGTGATTAGGTGG - Intergenic
1062432602 9:136532741-136532763 AGGGGAGCTCAGAGAGGTGGTGG + Intronic
1203361687 Un_KI270442v1:222205-222227 GAGGGAGCTCATTGGTGTGGGGG - Intergenic
1185790138 X:2923107-2923129 TAGGGTGCTGAGAGAGTTGGAGG + Intronic
1187890283 X:23928066-23928088 TAGGGAGCTAAGGAATTTGGGGG + Intronic
1189288130 X:39866563-39866585 GAGGCATCTTTGAGATTTGGGGG - Intergenic
1190221468 X:48514986-48515008 CAGGGAGCGCAGATATATGGGGG + Intronic
1190448237 X:50552597-50552619 GAGGGAGCTCACAAATTTCATGG + Intergenic
1191864858 X:65695751-65695773 GTGCCAGCTCATAGATTTGGGGG - Intronic
1192448220 X:71225972-71225994 AAGGGAGCTGAGAGATGTGCTGG - Intergenic
1195398983 X:104441650-104441672 GAGAGAGGGCATAGATTTGGGGG + Intergenic
1198594589 X:138222662-138222684 GAGGAAGGTGAGAGAGTTGGTGG + Intergenic
1199702299 X:150391322-150391344 GAGGGGGCTCAGGGATCTGTGGG - Intronic
1200219463 X:154384030-154384052 GAGGGAGCTCAGGGAGGTGGTGG - Intergenic