ID: 1084757566

View in Genome Browser
Species Human (GRCh38)
Location 11:71249420-71249442
Sequence TGGACGCGCACAGCCTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 71}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084757566_1084757571 22 Left 1084757566 11:71249420-71249442 CCTGAAGAGGCTGTGCGCGTCCA 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1084757571 11:71249465-71249487 ACACCCTCCCTGCTGCCCCAAGG 0: 1
1: 0
2: 7
3: 59
4: 416
1084757566_1084757573 25 Left 1084757566 11:71249420-71249442 CCTGAAGAGGCTGTGCGCGTCCA 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1084757573 11:71249468-71249490 CCCTCCCTGCTGCCCCAAGGAGG 0: 1
1: 0
2: 4
3: 60
4: 397
1084757566_1084757576 27 Left 1084757566 11:71249420-71249442 CCTGAAGAGGCTGTGCGCGTCCA 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1084757576 11:71249470-71249492 CTCCCTGCTGCCCCAAGGAGGGG 0: 1
1: 0
2: 5
3: 35
4: 346
1084757566_1084757575 26 Left 1084757566 11:71249420-71249442 CCTGAAGAGGCTGTGCGCGTCCA 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1084757575 11:71249469-71249491 CCTCCCTGCTGCCCCAAGGAGGG 0: 1
1: 1
2: 6
3: 55
4: 424

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084757566 Original CRISPR TGGACGCGCACAGCCTCTTC AGG (reversed) Intronic
900233424 1:1574477-1574499 TGGAGGCGCACAACATCCTCAGG - Exonic
901061282 1:6473118-6473140 TGCACACCTACAGCCTCTTCGGG - Exonic
901506803 1:9690094-9690116 AGGACGCGCACAGCCACTGCTGG - Intronic
905448185 1:38040997-38041019 TGGAGGCCCAGAGCCTCTCCAGG + Intergenic
910163925 1:84302904-84302926 TGAACTGGCACAGCTTCTTCTGG - Intronic
922767130 1:228162028-228162050 TGGGCTTGCACAGCCTCTCCTGG - Intergenic
1063418083 10:5889797-5889819 AGGGCGCGCACAGCCTCGCCCGG + Exonic
1064274306 10:13892125-13892147 TGGACGCGCGCAGCCTCACCGGG - Intronic
1075613359 10:123871260-123871282 TTGAGGCTCACAGCCTGTTCAGG - Intronic
1077231275 11:1459106-1459128 TGGACGCCCACAGCCTCGATGGG - Intronic
1077680249 11:4233346-4233368 TGGAGGCCCACAGCATCCTCAGG + Intergenic
1077681235 11:4242560-4242582 TGGAGGCCCACAGCATCCTCAGG - Intergenic
1077684528 11:4278765-4278787 TGGAGGCCCACAGCATCCTCAGG + Intergenic
1077685513 11:4288003-4288025 TGGAGGCCCACAGCATCCTCAGG - Intergenic
1077689661 11:4329923-4329945 TGGAGGCCCACAGCATCCTCAGG + Intergenic
1077690666 11:4339164-4339186 TGGAGGCCCACAGCATCCTCAGG - Intergenic
1078180019 11:9003770-9003792 TGGACGAGCCCAGCTTCTTGAGG + Exonic
1083312684 11:61792852-61792874 TCGCCACGCACAGCCTCTTGGGG - Exonic
1084757566 11:71249420-71249442 TGGACGCGCACAGCCTCTTCAGG - Intronic
1086094486 11:83036828-83036850 TGGACACGCCAAGCCTTTTCTGG - Intronic
1089689812 11:120180393-120180415 TGGGAATGCACAGCCTCTTCAGG + Intronic
1091208308 11:133835555-133835577 TGGAAGGGCACAGCCCCCTCAGG + Intergenic
1101997220 12:109533939-109533961 TGGACGTGCACAGCCTGCTGGGG - Intronic
1102927495 12:116837280-116837302 TGGAAGCTCACAGTCTCTGCCGG + Intronic
1119263933 14:73253398-73253420 TGGGTGAGCACAGCCTCTCCAGG + Intronic
1119989248 14:79176587-79176609 TGAACGAGCACAGCATATTCAGG - Intronic
1121310380 14:92932493-92932515 TGGTCCCGCAAGGCCTCTTCCGG + Exonic
1123011511 14:105352003-105352025 TGGAGGCACCAAGCCTCTTCTGG - Intronic
1128575244 15:68769895-68769917 AGCACGCCCACAGCCTCTTCTGG + Intergenic
1131614818 15:94005128-94005150 TGGACCAGCACACACTCTTCAGG - Intergenic
1132048943 15:98591091-98591113 TGGAGGCACACAGCCTCTGGCGG - Intergenic
1133020553 16:2965012-2965034 TGGGCGCGCACAACTTCTGCCGG + Exonic
1136513142 16:30751413-30751435 TGGGCGCCCACTGCCTCCTCTGG + Intronic
1139630386 16:68228306-68228328 TGGACGCCCACAGCTTCCTTTGG + Exonic
1140355625 16:74303453-74303475 AGGAGACGTACAGCCTCTTCTGG + Intronic
1145265433 17:21377585-21377607 TGCGCGCGCACGGCCTCTCCGGG + Intronic
1148969541 17:51467804-51467826 TGGAGGAGCCCAGGCTCTTCTGG - Intergenic
1152132340 17:78484891-78484913 TGGCCCCGCACACCCTCATCCGG - Exonic
1152468328 17:80477587-80477609 TGGACGCCCCCAGCCACCTCCGG - Intronic
1152802528 17:82337949-82337971 TCGAGGAGCACAGCCTTTTCAGG - Intergenic
927168609 2:20350396-20350418 CGCACGCGCACACCCCCTTCCGG + Intronic
938701643 2:133885118-133885140 AGCACCAGCACAGCCTCTTCTGG - Intergenic
948525146 2:238566823-238566845 TGGACGTGCAGAGCCTCCTGGGG + Intergenic
948852899 2:240717167-240717189 CTGACACGCACAGCCTCTGCTGG + Exonic
1174783919 20:53414924-53414946 TGGACAAGAACAGCTTCTTCAGG + Intronic
1175460024 20:59145657-59145679 TGGAAGCCCACACCCTCTTTTGG + Intergenic
1178327937 21:31660187-31660209 GGGACGAGCACAGCCGCTCCAGG - Intronic
1183706553 22:39478181-39478203 TGGACCCGCACTACCTCTCCAGG - Intronic
952512206 3:34069071-34069093 TGGACTCTCACAGCCTCCTGGGG + Intergenic
953670205 3:44956114-44956136 TTGAAGCGTACAGCCTCTCCAGG - Intronic
953705252 3:45225938-45225960 CGGACGCGCCCGGCCTCCTCGGG - Exonic
957932061 3:86892781-86892803 TGGACGCTCCCAGTCTCTTAAGG + Intergenic
960801735 3:121546696-121546718 TAGAACTGCACAGCCTCTTCAGG - Intergenic
961553076 3:127680044-127680066 TGCGGCCGCACAGCCTCTTCAGG - Exonic
965329450 3:167352401-167352423 TGGAAACGCACAGCCTCTCAAGG + Intronic
969462383 4:7335646-7335668 TCCACGCACACAGCCCCTTCAGG + Intronic
973888414 4:55346189-55346211 GGGACGCGCAGAGCCCCTCCCGG - Exonic
976388365 4:84484402-84484424 AGGCCCAGCACAGCCTCTTCAGG + Intergenic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
980991234 4:139740360-139740382 GAGACGAGCACAGCCTCTGCCGG + Exonic
985876499 5:2602638-2602660 TGGACGCCCACATCCTCTTTAGG - Intergenic
999772200 5:154784140-154784162 TTGACAAGCAAAGCCTCTTCTGG + Intronic
1006720106 6:36144700-36144722 TGGACGCCCACACACTCATCAGG + Intergenic
1006981935 6:38154227-38154249 AGGGCTCGCACAGCCTCTTCGGG - Exonic
1010015967 6:71105209-71105231 TGGAGGGGCACAGCCTCTGTTGG - Intergenic
1019167756 6:170110296-170110318 GAAACGCCCACAGCCTCTTCAGG + Intergenic
1022626340 7:32040747-32040769 TGGAAGGGCACAGTCTCTTGTGG - Intronic
1031665334 7:124476429-124476451 TGGAGGCCCACAGCATCCTCAGG + Intergenic
1032238224 7:130142051-130142073 TGCAAGCACACAGGCTCTTCTGG + Intergenic
1034349827 7:150408421-150408443 TGGCTGCGCACAGCTGCTTCCGG + Intronic
1035446374 7:158945680-158945702 GGGCCGCCCACCGCCTCTTCAGG - Exonic
1037889096 8:22613570-22613592 AGAAGGGGCACAGCCTCTTCAGG - Intronic
1040816486 8:51513234-51513256 TGCAAGTGCACAGCCTCATCTGG - Intronic
1048831474 8:138481789-138481811 TGGTCTCTCCCAGCCTCTTCAGG + Intronic
1059097755 9:111437008-111437030 TGGAATCCCACAGCCTCCTCCGG - Exonic
1059677433 9:116552838-116552860 TGGACGTGCACAACCTCTGCAGG + Intronic
1061360624 9:130139755-130139777 TGGAGGCTCACCGCCTCATCTGG - Exonic
1185593101 X:1291583-1291605 TGGACGTTCCCAGCCTCTTCAGG + Intronic
1199881337 X:151975762-151975784 AGGATGCACACAGCCCCTTCTGG - Intergenic