ID: 1084757566

View in Genome Browser
Species Human (GRCh38)
Location 11:71249420-71249442
Sequence TGGACGCGCACAGCCTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 71}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084757566_1084757575 26 Left 1084757566 11:71249420-71249442 CCTGAAGAGGCTGTGCGCGTCCA 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1084757575 11:71249469-71249491 CCTCCCTGCTGCCCCAAGGAGGG 0: 1
1: 1
2: 6
3: 55
4: 424
1084757566_1084757573 25 Left 1084757566 11:71249420-71249442 CCTGAAGAGGCTGTGCGCGTCCA 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1084757573 11:71249468-71249490 CCCTCCCTGCTGCCCCAAGGAGG 0: 1
1: 0
2: 4
3: 60
4: 397
1084757566_1084757571 22 Left 1084757566 11:71249420-71249442 CCTGAAGAGGCTGTGCGCGTCCA 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1084757571 11:71249465-71249487 ACACCCTCCCTGCTGCCCCAAGG 0: 1
1: 0
2: 7
3: 59
4: 416
1084757566_1084757576 27 Left 1084757566 11:71249420-71249442 CCTGAAGAGGCTGTGCGCGTCCA 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1084757576 11:71249470-71249492 CTCCCTGCTGCCCCAAGGAGGGG 0: 1
1: 0
2: 5
3: 35
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084757566 Original CRISPR TGGACGCGCACAGCCTCTTC AGG (reversed) Intronic