ID: 1084757573

View in Genome Browser
Species Human (GRCh38)
Location 11:71249468-71249490
Sequence CCCTCCCTGCTGCCCCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 397}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084757568_1084757573 5 Left 1084757568 11:71249440-71249462 CCATTTCCACTGGTTTTTCTCAG 0: 1
1: 0
2: 2
3: 33
4: 400
Right 1084757573 11:71249468-71249490 CCCTCCCTGCTGCCCCAAGGAGG 0: 1
1: 0
2: 4
3: 60
4: 397
1084757569_1084757573 -1 Left 1084757569 11:71249446-71249468 CCACTGGTTTTTCTCAGCCACAC 0: 1
1: 0
2: 1
3: 22
4: 267
Right 1084757573 11:71249468-71249490 CCCTCCCTGCTGCCCCAAGGAGG 0: 1
1: 0
2: 4
3: 60
4: 397
1084757566_1084757573 25 Left 1084757566 11:71249420-71249442 CCTGAAGAGGCTGTGCGCGTCCA 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1084757573 11:71249468-71249490 CCCTCCCTGCTGCCCCAAGGAGG 0: 1
1: 0
2: 4
3: 60
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084757573 Original CRISPR CCCTCCCTGCTGCCCCAAGG AGG Intronic