ID: 1084757924

View in Genome Browser
Species Human (GRCh38)
Location 11:71251282-71251304
Sequence CCTCCAGGCGGGTCTGCGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084757924_1084757935 17 Left 1084757924 11:71251282-71251304 CCGCACGCAGACCCGCCTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1084757935 11:71251322-71251344 CACGCCAAGCCCCAGAACCCTGG 0: 1
1: 0
2: 0
3: 20
4: 256
1084757924_1084757938 25 Left 1084757924 11:71251282-71251304 CCGCACGCAGACCCGCCTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1084757938 11:71251330-71251352 GCCCCAGAACCCTGGCGGCGAGG 0: 1
1: 0
2: 4
3: 17
4: 188
1084757924_1084757936 20 Left 1084757924 11:71251282-71251304 CCGCACGCAGACCCGCCTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1084757936 11:71251325-71251347 GCCAAGCCCCAGAACCCTGGCGG 0: 1
1: 0
2: 0
3: 17
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084757924 Original CRISPR CCTCCAGGCGGGTCTGCGTG CGG (reversed) Intronic