ID: 1084757924

View in Genome Browser
Species Human (GRCh38)
Location 11:71251282-71251304
Sequence CCTCCAGGCGGGTCTGCGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084757924_1084757938 25 Left 1084757924 11:71251282-71251304 CCGCACGCAGACCCGCCTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1084757938 11:71251330-71251352 GCCCCAGAACCCTGGCGGCGAGG 0: 1
1: 0
2: 4
3: 17
4: 188
1084757924_1084757935 17 Left 1084757924 11:71251282-71251304 CCGCACGCAGACCCGCCTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1084757935 11:71251322-71251344 CACGCCAAGCCCCAGAACCCTGG 0: 1
1: 0
2: 0
3: 20
4: 256
1084757924_1084757936 20 Left 1084757924 11:71251282-71251304 CCGCACGCAGACCCGCCTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1084757936 11:71251325-71251347 GCCAAGCCCCAGAACCCTGGCGG 0: 1
1: 0
2: 0
3: 17
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084757924 Original CRISPR CCTCCAGGCGGGTCTGCGTG CGG (reversed) Intronic
900109158 1:998383-998405 CCTCCAGGCGTCTGTGCGGGGGG - Intergenic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900510041 1:3054523-3054545 GCTCCCGGCGGGGCTGTGTGGGG - Intergenic
900633903 1:3652527-3652549 CCTCCGGGCGGGTGCGCGGGCGG - Exonic
900682781 1:3925986-3926008 CCTCCAGTCAGGGCTGCATGAGG - Intergenic
901644376 1:10708849-10708871 CCTGCAGGCGGCTCGGAGTGGGG + Intronic
901740641 1:11339572-11339594 CCTCCAGCTGGGGCTGGGTGGGG + Intergenic
902333532 1:15742514-15742536 CCTCCGGCCAGGTCTGCGTAAGG - Exonic
902873258 1:19326629-19326651 CCTCCAGCAGGGGCTGGGTGGGG + Intronic
908769728 1:67585040-67585062 CCCCCAGGAGGGGCTGAGTGGGG + Intergenic
912379406 1:109239264-109239286 GGCCCAGGCGGGTCTGCCTGTGG - Intergenic
919814252 1:201427878-201427900 CCTCCAGGAAGGCCTGGGTGGGG + Intronic
920278814 1:204828513-204828535 GCGCCAGGCGGGGCTGCGTCCGG + Intergenic
921010251 1:211134019-211134041 CTTCGAGCCGGGACTGCGTGCGG - Intronic
921480895 1:215663574-215663596 CCTACAGGCAGGGCTGCATGAGG - Intronic
923384719 1:233454745-233454767 TCTCCAGGCTGGTCTCCTTGAGG + Intergenic
923663488 1:235979028-235979050 CATACAGCCGGGTCTGCTTGTGG + Exonic
1069597348 10:69681090-69681112 CTTCCAGGCTGGTCTCCTTGAGG - Intergenic
1071279508 10:84087276-84087298 CCCCCAGGCTGCTCTGCCTGTGG - Intergenic
1072821359 10:98561030-98561052 CCTCCTGGAGGATCTGCCTGAGG - Intronic
1072881999 10:99236882-99236904 CCTCCAGGAGGGTCTGGAGGGGG - Intergenic
1075633592 10:124015948-124015970 CCTCCAGGTGGGTGTTTGTGGGG - Intronic
1076039185 10:127228336-127228358 CCTCCGGGCCGGGCAGCGTGGGG - Intronic
1077014642 11:394167-394189 TCTTCAGGCGGCTCTGGGTGAGG + Intronic
1077227645 11:1445348-1445370 CCTCCAGGCTGGGCAGCGAGCGG - Exonic
1078460597 11:11512335-11512357 CCTCCTGGCGGATCTGGGTCAGG - Intronic
1084648505 11:70474488-70474510 CCTCCACGTGGGTAAGCGTGAGG - Intronic
1084757924 11:71251282-71251304 CCTCCAGGCGGGTCTGCGTGCGG - Intronic
1085037555 11:73309169-73309191 CCCCCTGGCGGGTCTGCGTTCGG + Exonic
1095953713 12:47795213-47795235 GCTCCAGGCGGGGCTGCATGGGG + Exonic
1097250122 12:57627879-57627901 CCTCCAGGCGGGCCTGGGATAGG + Intronic
1101739538 12:107490208-107490230 CCTGAAGGCGGGGCTGCTTGAGG + Intronic
1102695874 12:114799064-114799086 CATCCAGGCTGGAGTGCGTGGGG + Intergenic
1104159889 12:126168188-126168210 CCTGCAGGAGGGTGTGGGTGGGG - Intergenic
1105830953 13:24162328-24162350 CCTCCAGGCGGGGCAGGCTGTGG - Intronic
1113037116 13:106062384-106062406 CCTCCAGGAGAGTCTGCCTCTGG - Intergenic
1113767984 13:112892815-112892837 ACTCCCTGCGGGTCTGAGTGGGG + Intergenic
1116251067 14:42482738-42482760 GCCAGAGGCGGGTCTGCGTGCGG - Intergenic
1117956462 14:61127268-61127290 CCTGCAGGGGAGTCTGGGTGAGG + Intergenic
1122728319 14:103775775-103775797 CTTCCAGGCGGATCTGCTTCAGG - Intronic
1123699270 15:22902657-22902679 CCTCCAGGCCGGGCTGGGAGTGG - Intronic
1124629176 15:31327341-31327363 CCTCGACGCGGGGCAGCGTGGGG - Exonic
1125749194 15:42017206-42017228 CCTCCAGGAGGGGGTGCCTGTGG + Intronic
1130653108 15:85773497-85773519 CCTCCAGGCAGCTCAGCGGGTGG + Intronic
1132602592 16:780241-780263 CCACCATGGGGGTCTGCTTGAGG + Intronic
1135169727 16:20173236-20173258 CCTCCAGGGTGCTCTGCCTGTGG + Intergenic
1135510600 16:23079884-23079906 CCTTCAGACGGGTTTGCTTGTGG - Intronic
1135649293 16:24191782-24191804 CCTCCGGGAGGGTTTGGGTGTGG + Intronic
1136366019 16:29809667-29809689 CCCCCAGATGGGTCTGCATGTGG - Exonic
1138588928 16:57988884-57988906 ACTCCAGGCGGCTCTGCCAGTGG - Intergenic
1142009449 16:87706422-87706444 CCTCCAGGGGGGTCGGCGGAGGG + Intronic
1142032659 16:87846273-87846295 CTTCCAGGCTGGCCTGCCTGTGG - Intronic
1142278127 16:89133581-89133603 CCACCAGGAAGGGCTGCGTGGGG - Intronic
1143724360 17:8835308-8835330 CCTGCAGGCGGCTCTGGGGGAGG - Exonic
1144764240 17:17724237-17724259 ACTCCGGGCAGGTCTGCGCGCGG - Intronic
1147258776 17:39196997-39197019 GCGCCAGGCGGGTGTGGGTGGGG - Intronic
1148755801 17:49972376-49972398 CCAGAAGCCGGGTCTGCGTGGGG - Intronic
1148911895 17:50947278-50947300 CCTCCTGGAGGGTCTGCAGGGGG + Intergenic
1150189519 17:63223442-63223464 CCTCCGGGCTGCTCTGCCTGTGG - Intronic
1150278289 17:63913828-63913850 TCTCCAGGCAGGCCTGTGTGAGG + Intronic
1152739348 17:82012262-82012284 CCTGAAAGAGGGTCTGCGTGTGG - Exonic
1158549508 18:58423190-58423212 CATCCAGGGGGGTCTGAGGGAGG + Intergenic
1160190477 18:76710748-76710770 CCACCAGGCGGGGCTACCTGAGG + Intergenic
1160343475 18:78110108-78110130 ACTCAAGGCTGGGCTGCGTGGGG - Intergenic
1160560984 18:79755638-79755660 CCTGAAGGCGATTCTGCGTGTGG + Exonic
1160668324 19:344212-344234 GCGCCAGGCGGGTCCGCGTCGGG + Intronic
1161183000 19:2898097-2898119 CCACCTGCCGGGTCTGTGTGAGG + Intergenic
1162312233 19:9914126-9914148 GCTCGAAGAGGGTCTGCGTGCGG - Intronic
1162807308 19:13144619-13144641 CGTCCATGCGGGACTGGGTGTGG + Exonic
1163430146 19:17262587-17262609 CCTCCAGGGAGGCCTGCGTGCGG + Exonic
1165422131 19:35727544-35727566 CCTCCAGGGGGGCCTGCGCCAGG + Exonic
1166367125 19:42283642-42283664 CGCCCAGGCGGGTGTGCGGGAGG + Intronic
1167116674 19:47492701-47492723 CCTCCAGGAAGCTCTGCGAGGGG + Intronic
925229841 2:2223909-2223931 CCTCCAGGTGGGTCAGCGAAGGG + Intronic
927751243 2:25673029-25673051 CCTGGAGGCGGCTCTGCGTTAGG - Intronic
928950927 2:36812382-36812404 CCTTCAGGCTGGTCTGAGTAGGG - Intronic
928981425 2:37139399-37139421 ACTCCAGGCTGGGCTGGGTGTGG - Intronic
932217838 2:69978267-69978289 CCTCCAGGGGAGTCTCCTTGGGG + Intergenic
937955237 2:127418502-127418524 CCTCCAGGCAGGTCTATGAGGGG + Intronic
942043502 2:172085962-172085984 CCTCCAGGCGGCTCTGGGCGAGG - Exonic
945833027 2:214809285-214809307 GCTGCAGTCGGGTCGGCGTGCGG - Intronic
1172083024 20:32357932-32357954 CCTCCTGGCGGGTGCGGGTGGGG - Intergenic
1173814305 20:45975285-45975307 CCCCCAGGCTGGCCTGGGTGGGG - Intergenic
1173894611 20:46541544-46541566 CTTGCAGGCAGGTCTGGGTGTGG + Exonic
1175497096 20:59422812-59422834 CCTCCAGGGGTCTCTGCCTGAGG + Intergenic
1175823321 20:61923606-61923628 CCTCCAGGCGGATCAGCTTGTGG - Exonic
1175961286 20:62637865-62637887 CCTCCCCGCGGGTCTGGGGGTGG - Intergenic
1176047228 20:63099251-63099273 CTTCCAGGTGGGTCTGAGGGAGG - Intergenic
1180067744 21:45421059-45421081 CCTCGAGGCAGGGCTGGGTGGGG - Intronic
1180201656 21:46228457-46228479 CTTCCAGGCCGGTCTGCTCGCGG + Exonic
1180633507 22:17246208-17246230 CCTCCAGGTAGGTGTGCATGAGG - Intergenic
1183947691 22:41336022-41336044 CCTCCATCCGGCTCTCCGTGGGG + Intronic
1184284901 22:43465014-43465036 CCTCCAGGCAGGTGTGTATGTGG - Intronic
1184311181 22:43644095-43644117 ATTCCAGGCGTGGCTGCGTGCGG + Intronic
1185180900 22:49362537-49362559 CCTCCAGGAGGCCCTGCCTGCGG - Intergenic
949383621 3:3473774-3473796 CCTCCAGGCAGGTCTGAATATGG - Intergenic
951286018 3:20814957-20814979 TCTCCAGGAGGATCTGAGTGTGG - Intergenic
952983469 3:38756979-38757001 CCTCCAACCAAGTCTGCGTGGGG + Intronic
954213142 3:49109415-49109437 CCTCCATGCGGAGCTGCATGTGG - Intronic
968706026 4:2078147-2078169 TCTCAAGGCGGGTCTGCATGAGG - Intronic
969085533 4:4653354-4653376 CCTCCAGGGGGCTCTGAGGGAGG - Intergenic
970600267 4:17636557-17636579 CCTTCAGGCGGGTCTGCAGGCGG + Exonic
971406057 4:26321346-26321368 CCTCCAGCGGGCTCTGCCTGGGG + Intronic
981474991 4:145179749-145179771 CGGCCCGGCGGGTCTGGGTGGGG - Intronic
987292899 5:16525001-16525023 CCTGCAGGTGGATGTGCGTGGGG + Intronic
987292922 5:16525105-16525127 CCTGCAGGTGGATGTGCGTGGGG + Intronic
988521124 5:31946433-31946455 CCCTCCGGCGGGTCTGGGTGGGG + Intronic
988896342 5:35678571-35678593 CCTCCAGTCAGGTCAGCGTATGG - Intronic
994400581 5:99274770-99274792 CGCCCAGGCTGGACTGCGTGCGG + Intergenic
1002047637 5:176550763-176550785 CCTCCAGGAGGGTCAGGGTGGGG - Intronic
1002075002 5:176703154-176703176 CCTCCAGACCGGGCTGCGTTTGG + Intergenic
1002175785 5:177400378-177400400 CCTGCAGGCGGGCCTGAGCGTGG - Exonic
1002720842 5:181260765-181260787 CCTCCTGAAGGGTCTGCATGGGG + Exonic
1003980912 6:11388942-11388964 CTTCCAGCTGGGTCTGCATGTGG - Intergenic
1006164325 6:32055878-32055900 CCTCCACGAGGGGCGGCGTGTGG - Intronic
1006637064 6:35468557-35468579 TCTCAAGGCGGGTCGGCCTGCGG + Intronic
1012661298 6:101897423-101897445 TCTCCAGGCTGGTCTGTCTGTGG + Intronic
1017600904 6:156080065-156080087 CCTCCTGAAGGGTCTGCCTGAGG - Intergenic
1018866333 6:167749174-167749196 GCTCAGGGCGGGTCAGCGTGGGG + Intergenic
1019844651 7:3485477-3485499 CCTCCAGGCTGTGCTGCCTGGGG + Intronic
1024634437 7:51275706-51275728 CCTCCTGGGTGGGCTGCGTGCGG - Intronic
1031063233 7:117075602-117075624 CTTCCAGGCCTGTCTGTGTGAGG + Intronic
1032108626 7:129056026-129056048 CCTCCAGGAAGTTCTTCGTGGGG + Intergenic
1033125987 7:138707776-138707798 CCTCCAGGCCTCTCTGCTTGTGG + Intronic
1033288573 7:140062587-140062609 GCTCCAAGCCGGGCTGCGTGGGG - Exonic
1034281989 7:149861061-149861083 CCTCCGAGCAGGCCTGCGTGGGG + Exonic
1036453633 8:8890967-8890989 CCTGCAGGCGGGTCTGACCGAGG - Exonic
1038472745 8:27838969-27838991 CCTCCAGGCTGCTCTGCCTGTGG - Intergenic
1045367951 8:101493664-101493686 GCGGCAGGCGGGACTGCGTGGGG + Intronic
1047491335 8:125377124-125377146 TCTCCAGGCTGGGCTGGGTGCGG - Intergenic
1047559595 8:125972400-125972422 ACTCCAGGCTGCTCTGCCTGTGG + Intergenic
1047607600 8:126490481-126490503 CCTCCAGGCAGGGCGGCCTGTGG - Intergenic
1049504200 8:142986094-142986116 CGTCCAGGCAGGGCTGCATGAGG - Intergenic
1049657161 8:143804012-143804034 CATCCAGGCGGTTCTGTGAGAGG - Intronic
1049709433 8:144056988-144057010 CCTCCAGGCGGCTCAGCCTCTGG + Exonic
1049850509 8:144827718-144827740 CCTCCAGGCGGGAAAGCGCGGGG + Intronic
1053292225 9:36888767-36888789 CCTCCAGGCAGCTCTGCAGGCGG + Intronic
1053593225 9:39534034-39534056 GGTCCAGGCGGTTCTGCGAGTGG + Intergenic
1053850961 9:42288742-42288764 GGTCCAGGCGGTTCTGCGAGTGG + Intergenic
1054573081 9:66831243-66831265 GGTCCAGGCGGTTCTGCGAGTGG - Intergenic
1058959566 9:109979924-109979946 CATCCAGGCCTGTCTGCGTCTGG - Intronic
1062612945 9:137383140-137383162 CCTCCAGGGTGGCCTGTGTGGGG - Intronic
1200128272 X:153828455-153828477 CCTCCTGGCGGGTCTCCTTGGGG + Intronic