ID: 1084758248

View in Genome Browser
Species Human (GRCh38)
Location 11:71252376-71252398
Sequence CGCGGGCCGGGGAGGACGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 1, 1: 0, 2: 2, 3: 61, 4: 526}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084758248_1084758270 22 Left 1084758248 11:71252376-71252398 CCTCCCGTCCTCCCCGGCCCGCG 0: 1
1: 0
2: 2
3: 61
4: 526
Right 1084758270 11:71252421-71252443 TCACCTGGCTCGGCGAGTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 32
1084758248_1084758269 21 Left 1084758248 11:71252376-71252398 CCTCCCGTCCTCCCCGGCCCGCG 0: 1
1: 0
2: 2
3: 61
4: 526
Right 1084758269 11:71252420-71252442 CTCACCTGGCTCGGCGAGTCGGG 0: 1
1: 0
2: 0
3: 3
4: 65
1084758248_1084758260 7 Left 1084758248 11:71252376-71252398 CCTCCCGTCCTCCCCGGCCCGCG 0: 1
1: 0
2: 2
3: 61
4: 526
Right 1084758260 11:71252406-71252428 TCCCCGGCCGCCGCCTCACCTGG 0: 1
1: 1
2: 2
3: 47
4: 517
1084758248_1084758274 27 Left 1084758248 11:71252376-71252398 CCTCCCGTCCTCCCCGGCCCGCG 0: 1
1: 0
2: 2
3: 61
4: 526
Right 1084758274 11:71252426-71252448 TGGCTCGGCGAGTCGGGGGCGGG 0: 1
1: 0
2: 0
3: 17
4: 149
1084758248_1084758255 -9 Left 1084758248 11:71252376-71252398 CCTCCCGTCCTCCCCGGCCCGCG 0: 1
1: 0
2: 2
3: 61
4: 526
Right 1084758255 11:71252390-71252412 CGGCCCGCGCCCTGCGTCCCCGG 0: 1
1: 0
2: 2
3: 34
4: 257
1084758248_1084758271 23 Left 1084758248 11:71252376-71252398 CCTCCCGTCCTCCCCGGCCCGCG 0: 1
1: 0
2: 2
3: 61
4: 526
Right 1084758271 11:71252422-71252444 CACCTGGCTCGGCGAGTCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 66
1084758248_1084758264 12 Left 1084758248 11:71252376-71252398 CCTCCCGTCCTCCCCGGCCCGCG 0: 1
1: 0
2: 2
3: 61
4: 526
Right 1084758264 11:71252411-71252433 GGCCGCCGCCTCACCTGGCTCGG 0: 1
1: 0
2: 0
3: 18
4: 213
1084758248_1084758273 26 Left 1084758248 11:71252376-71252398 CCTCCCGTCCTCCCCGGCCCGCG 0: 1
1: 0
2: 2
3: 61
4: 526
Right 1084758273 11:71252425-71252447 CTGGCTCGGCGAGTCGGGGGCGG 0: 1
1: 0
2: 0
3: 9
4: 127
1084758248_1084758268 20 Left 1084758248 11:71252376-71252398 CCTCCCGTCCTCCCCGGCCCGCG 0: 1
1: 0
2: 2
3: 61
4: 526
Right 1084758268 11:71252419-71252441 CCTCACCTGGCTCGGCGAGTCGG 0: 1
1: 0
2: 0
3: 7
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084758248 Original CRISPR CGCGGGCCGGGGAGGACGGG AGG (reversed) Intronic