ID: 1084759477

View in Genome Browser
Species Human (GRCh38)
Location 11:71260176-71260198
Sequence CTCCCTCCAAGCAGACCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084759477_1084759481 30 Left 1084759477 11:71260176-71260198 CCAGCAGGTCTGCTTGGAGGGAG No data
Right 1084759481 11:71260229-71260251 TCAAAAGATGCACAGCAGGCCGG No data
1084759477_1084759480 26 Left 1084759477 11:71260176-71260198 CCAGCAGGTCTGCTTGGAGGGAG No data
Right 1084759480 11:71260225-71260247 TGCATCAAAAGATGCACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084759477 Original CRISPR CTCCCTCCAAGCAGACCTGC TGG (reversed) Intergenic
No off target data available for this crispr