ID: 1084760525

View in Genome Browser
Species Human (GRCh38)
Location 11:71267900-71267922
Sequence CAGGGGCCTGCCCTGGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084760525_1084760531 -10 Left 1084760525 11:71267900-71267922 CCACCACCCAGGGCAGGCCCCTG No data
Right 1084760531 11:71267913-71267935 CAGGCCCCTGGCCTAGAGGCCGG No data
1084760525_1084760537 27 Left 1084760525 11:71267900-71267922 CCACCACCCAGGGCAGGCCCCTG No data
Right 1084760537 11:71267950-71267972 CTAGAGCTAGTGCAGCTCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084760525 Original CRISPR CAGGGGCCTGCCCTGGGTGG TGG (reversed) Intergenic
No off target data available for this crispr