ID: 1084760842

View in Genome Browser
Species Human (GRCh38)
Location 11:71269745-71269767
Sequence GAACAATGGCCTGTGAAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084760839_1084760842 -7 Left 1084760839 11:71269729-71269751 CCATCAAGATCACTGAGAACAAT No data
Right 1084760842 11:71269745-71269767 GAACAATGGCCTGTGAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084760842 Original CRISPR GAACAATGGCCTGTGAAGGT TGG Intergenic
No off target data available for this crispr