ID: 1084762597

View in Genome Browser
Species Human (GRCh38)
Location 11:71283412-71283434
Sequence CCCAAAGTCAATGCCGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084762597_1084762604 -1 Left 1084762597 11:71283412-71283434 CCCACCACGGCATTGACTTTGGG No data
Right 1084762604 11:71283434-71283456 GTGCTGGCCTCGTCTGACAGGGG No data
1084762597_1084762602 -3 Left 1084762597 11:71283412-71283434 CCCACCACGGCATTGACTTTGGG No data
Right 1084762602 11:71283432-71283454 GGGTGCTGGCCTCGTCTGACAGG No data
1084762597_1084762603 -2 Left 1084762597 11:71283412-71283434 CCCACCACGGCATTGACTTTGGG No data
Right 1084762603 11:71283433-71283455 GGTGCTGGCCTCGTCTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084762597 Original CRISPR CCCAAAGTCAATGCCGTGGT GGG (reversed) Intergenic
No off target data available for this crispr