ID: 1084769063

View in Genome Browser
Species Human (GRCh38)
Location 11:71330998-71331020
Sequence CCTCAGATGGAGAGAATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084769053_1084769063 6 Left 1084769053 11:71330969-71330991 CCATCACCTTGGTCTAGCCACAC No data
Right 1084769063 11:71330998-71331020 CCTCAGATGGAGAGAATGGAGGG No data
1084769052_1084769063 7 Left 1084769052 11:71330968-71330990 CCCATCACCTTGGTCTAGCCACA No data
Right 1084769063 11:71330998-71331020 CCTCAGATGGAGAGAATGGAGGG No data
1084769055_1084769063 0 Left 1084769055 11:71330975-71330997 CCTTGGTCTAGCCACACAAGGCC No data
Right 1084769063 11:71330998-71331020 CCTCAGATGGAGAGAATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084769063 Original CRISPR CCTCAGATGGAGAGAATGGA GGG Intergenic
No off target data available for this crispr