ID: 1084769955

View in Genome Browser
Species Human (GRCh38)
Location 11:71336181-71336203
Sequence CAATTTCACCACCGTGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084769955_1084769961 30 Left 1084769955 11:71336181-71336203 CCAGGTGCACGGTGGTGAAATTG No data
Right 1084769961 11:71336234-71336256 CAGAATTCCTCCTCATCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084769955 Original CRISPR CAATTTCACCACCGTGCACC TGG (reversed) Intergenic
No off target data available for this crispr