ID: 1084775532

View in Genome Browser
Species Human (GRCh38)
Location 11:71372279-71372301
Sequence GTGCCTGTCTTTACTGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084775532_1084775538 18 Left 1084775532 11:71372279-71372301 CCAGAAGCAGTAAAGACAGGCAC No data
Right 1084775538 11:71372320-71372342 GGAGTCTATGAGGAGACCCAGGG No data
1084775532_1084775535 -3 Left 1084775532 11:71372279-71372301 CCAGAAGCAGTAAAGACAGGCAC No data
Right 1084775535 11:71372299-71372321 CACAAATGAAGGAGGATGAGAGG No data
1084775532_1084775539 30 Left 1084775532 11:71372279-71372301 CCAGAAGCAGTAAAGACAGGCAC No data
Right 1084775539 11:71372332-71372354 GAGACCCAGGGAATCAAGAGAGG No data
1084775532_1084775537 17 Left 1084775532 11:71372279-71372301 CCAGAAGCAGTAAAGACAGGCAC No data
Right 1084775537 11:71372319-71372341 AGGAGTCTATGAGGAGACCCAGG No data
1084775532_1084775536 8 Left 1084775532 11:71372279-71372301 CCAGAAGCAGTAAAGACAGGCAC No data
Right 1084775536 11:71372310-71372332 GAGGATGAGAGGAGTCTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084775532 Original CRISPR GTGCCTGTCTTTACTGCTTC TGG (reversed) Intergenic
No off target data available for this crispr