ID: 1084775814

View in Genome Browser
Species Human (GRCh38)
Location 11:71374354-71374376
Sequence CTCTGATGGTGGCCTGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084775814_1084775826 27 Left 1084775814 11:71374354-71374376 CCAGAATCAGGCCACCATCAGAG No data
Right 1084775826 11:71374404-71374426 CCAGATAGGGAAGCTGCTGGAGG No data
1084775814_1084775821 14 Left 1084775814 11:71374354-71374376 CCAGAATCAGGCCACCATCAGAG No data
Right 1084775821 11:71374391-71374413 CTGTAGACGCCACCCAGATAGGG No data
1084775814_1084775820 13 Left 1084775814 11:71374354-71374376 CCAGAATCAGGCCACCATCAGAG No data
Right 1084775820 11:71374390-71374412 ACTGTAGACGCCACCCAGATAGG No data
1084775814_1084775823 24 Left 1084775814 11:71374354-71374376 CCAGAATCAGGCCACCATCAGAG No data
Right 1084775823 11:71374401-71374423 CACCCAGATAGGGAAGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084775814 Original CRISPR CTCTGATGGTGGCCTGATTC TGG (reversed) Intergenic
No off target data available for this crispr