ID: 1084777512

View in Genome Browser
Species Human (GRCh38)
Location 11:71387230-71387252
Sequence GATTCAGGGCCAGCTCGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084777500_1084777512 25 Left 1084777500 11:71387182-71387204 CCTGTGGGATTTGCAGCCAGCTC No data
Right 1084777512 11:71387230-71387252 GATTCAGGGCCAGCTCGACAGGG No data
1084777508_1084777512 -3 Left 1084777508 11:71387210-71387232 CCAGCTGGTGAGATGGGAAGGAT No data
Right 1084777512 11:71387230-71387252 GATTCAGGGCCAGCTCGACAGGG No data
1084777504_1084777512 9 Left 1084777504 11:71387198-71387220 CCAGCTCAAGGGCCAGCTGGTGA No data
Right 1084777512 11:71387230-71387252 GATTCAGGGCCAGCTCGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084777512 Original CRISPR GATTCAGGGCCAGCTCGACA GGG Intergenic
No off target data available for this crispr