ID: 1084777773

View in Genome Browser
Species Human (GRCh38)
Location 11:71388671-71388693
Sequence CATTAGGACTGTTGGGATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084777773_1084777782 27 Left 1084777773 11:71388671-71388693 CCAACATCCCAACAGTCCTAATG No data
Right 1084777782 11:71388721-71388743 ATGACATCTACTCTCTGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084777773 Original CRISPR CATTAGGACTGTTGGGATGT TGG (reversed) Intergenic
No off target data available for this crispr