ID: 1084785368

View in Genome Browser
Species Human (GRCh38)
Location 11:71438826-71438848
Sequence CCCCCAGAGCCTGCCGGCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084785368 Original CRISPR CCCCCAGAGCCTGCCGGCAT CGG Intronic
900194767 1:1370666-1370688 CCCCCCGAGCCTCCCGGGAAGGG - Intergenic
900999548 1:6142000-6142022 CCCTCAGAGCCTGCCGGCCTCGG + Intronic
902184959 1:14718045-14718067 CCGCCAAAGACCGCCGGCATTGG + Intronic
902607419 1:17576358-17576380 CACCCAGAGCAGCCCGGCATTGG - Intronic
903421284 1:23219170-23219192 CCAGCAGCACCTGCCGGCATTGG + Intergenic
903554191 1:24181164-24181186 TCCCCAGAGCCTGCCTGCCATGG + Intronic
903968474 1:27103916-27103938 CCTCCAGAGCCAGCCTGCCTGGG - Intronic
904000525 1:27336063-27336085 CTCCCAGTGCCTCCCAGCATTGG + Exonic
904364487 1:30001757-30001779 CCTCCTGTGCCTGCCAGCATTGG + Intergenic
905478718 1:38246750-38246772 CCCCGAGAGGCTGCCAGCCTGGG - Intergenic
906251305 1:44312881-44312903 ACCCCAGAGTCAGCCAGCATAGG + Intronic
908755000 1:67461378-67461400 TCCCCTGAGCCTGCAGGCTTTGG - Intergenic
912558586 1:110534025-110534047 CCACCAGTGCCTGCCGTCTTTGG - Intergenic
913167928 1:116206103-116206125 GCCCCAGAGGCTGCTGCCATTGG + Intergenic
918198299 1:182243178-182243200 CCCACAGAGTCTGCCAGCACTGG + Intergenic
920839170 1:209539451-209539473 CCCCCAGAGACTGGGGACATAGG - Intergenic
921902268 1:220463315-220463337 ACCCCTGAGCCTGCAGGGATGGG - Intergenic
923808007 1:237281662-237281684 CCCCCAGATGGTGCAGGCATTGG + Intronic
1066548090 10:36523672-36523694 TCCCAAGAGACTGCTGGCATAGG - Exonic
1067317150 10:45179856-45179878 GGCCTAGAGCCTGCCTGCATGGG + Intergenic
1072454072 10:95561140-95561162 CCCCCAGAGCATCCCCCCATGGG - Intronic
1075347431 10:121693857-121693879 CCCCTAGAGCCCACCAGCATGGG + Intergenic
1076154033 10:128189028-128189050 CCTCCAGAGTCTGAGGGCATAGG - Intergenic
1076481467 10:130787842-130787864 ACCCCAGAGCCTGCCTTCAGGGG - Intergenic
1077090405 11:775803-775825 CCCCCAGAGCCTTCTGGATTGGG - Intronic
1077330686 11:1982659-1982681 CCCCCAGACCCTCCCGGCAGAGG - Intronic
1078091167 11:8265652-8265674 CCCTCAGACCCTGAGGGCATGGG - Intronic
1083847707 11:65345589-65345611 CCCCCACAGCTTGCAGGGATGGG + Intronic
1084785368 11:71438826-71438848 CCCCCAGAGCCTGCCGGCATCGG + Intronic
1087887305 11:103495495-103495517 CCCCCAAAGCCTACCCACATAGG - Intergenic
1090173186 11:124623040-124623062 CCCCAGGACGCTGCCGGCATCGG - Exonic
1090458826 11:126871866-126871888 CCCCCAGTGCCTGTCTTCATGGG + Intronic
1090645792 11:128765572-128765594 CCCCCAGAGCAAGAGGGCATAGG - Intronic
1202813664 11_KI270721v1_random:37838-37860 CCCCCAGACCCTCCCGGCAGAGG - Intergenic
1091546802 12:1506596-1506618 CCCCCAGACCCTGCAGGCAGGGG - Intergenic
1096127465 12:49130456-49130478 CCTCCCTTGCCTGCCGGCATCGG + Intronic
1096398398 12:51284925-51284947 TCACCAGAGCCTGAAGGCATCGG + Intronic
1099953954 12:89334189-89334211 CCCTGAGAACCTGCCTGCATGGG - Intergenic
1101187270 12:102292373-102292395 ACCCAAGAGCCTGGTGGCATGGG + Intergenic
1105821844 13:24087178-24087200 CTCCCAGAGCCTGCCAGCCCAGG + Intronic
1107875897 13:44790136-44790158 ACCCCTGAGCCTGCAGGGATGGG + Intergenic
1108493752 13:51005134-51005156 CCCCCAGAGCCTGGTGGCTGAGG + Intergenic
1110270607 13:73585351-73585373 TCCCCAGATCCTGGCTGCATTGG - Intergenic
1114189495 14:20429881-20429903 CCCCCGGACGCTTCCGGCATGGG - Exonic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118752017 14:68814551-68814573 CTCCCCAGGCCTGCCGGCATGGG - Intergenic
1119348639 14:73946284-73946306 ACCTCAGAGCCTGCGGGCACTGG + Exonic
1121324709 14:93013105-93013127 CCCCCAGGGCCTGCCCACGTGGG - Intronic
1121553436 14:94819410-94819432 ACCCCTGAGCCTGCAGGGATGGG + Intergenic
1122804169 14:104248280-104248302 CCCCCAGGGCCTGGAGGCCTGGG - Intergenic
1129194650 15:73956645-73956667 CCCCCTGAGGCTGCTGGCATTGG + Intergenic
1132512803 16:352610-352632 CCGCCAGAGCCGGCCGGAGTCGG - Exonic
1132532296 16:458416-458438 CCCCCAGGCCCTGTGGGCATCGG - Intronic
1132532311 16:458455-458477 CCCCCAGGCCCTGTGGGCATCGG - Intronic
1132532326 16:458494-458516 CCCCCAGGCCCTGTGGGCATCGG - Intronic
1132532341 16:458533-458555 CCCCCAGGCCCTGTGGGCATCGG - Intronic
1132532356 16:458572-458594 CCCCCAGGCCCTGTGGGCATCGG - Intronic
1132878296 16:2149821-2149843 CCCGCTGAGCCTGCAGGCCTGGG + Intronic
1132993295 16:2808537-2808559 CTCCCAGTGCCTGCCTGCCTGGG + Intergenic
1138453746 16:57108895-57108917 GCCTCAGATCCTGCCAGCATTGG - Intronic
1141147177 16:81539384-81539406 CCCGCAGGGCCTGCAGACATTGG - Intronic
1142153105 16:88521348-88521370 GCCCCAGAGCCTGGCGTCAGGGG - Intronic
1142367810 16:89659309-89659331 CCCGCAGAGCCTGCCGTCCGAGG + Intronic
1142685373 17:1574599-1574621 CCCACGGAGCCCGCCGGCAGGGG + Exonic
1143022386 17:3923622-3923644 CCCGCAGAGCCTCCCAGCTTGGG - Intergenic
1146143511 17:30389135-30389157 CCCCCAGAGCCCGCTGCCCTGGG - Intronic
1146176673 17:30669526-30669548 CCCTCCCAGCCTGCTGGCATTGG + Intergenic
1146350137 17:32085641-32085663 CCCTCCCAGCCTGCTGGCATTGG + Intergenic
1147861992 17:43529219-43529241 GCCCCAGAGCCTGGCGACCTGGG + Exonic
1148049241 17:44761007-44761029 CCCCCAGTGACTGCGGGCCTTGG - Intronic
1148386569 17:47238554-47238576 GCCCCAGAGCCCGCCGCCCTGGG - Intergenic
1151942150 17:77299681-77299703 CCCACAGAGCCTCCCTGCAAAGG - Intronic
1152017763 17:77762968-77762990 CCCCCATCCCCTCCCGGCATGGG - Intergenic
1152231934 17:79118096-79118118 CCCCCAGTGCCGGCCGGCCCTGG + Intronic
1152853583 17:82650915-82650937 TCCCCAGAGCCTCCCAGCCTGGG + Intergenic
1154011629 18:10579484-10579506 CCCCCCGGGCCTGCCTGCAGAGG - Intergenic
1154027631 18:10723669-10723691 CCCCCAGAGACTGCCTGGAGAGG - Intronic
1156366913 18:36438028-36438050 CCTCCAGAGGCTGCCTGCAGGGG + Intronic
1160425149 18:78774074-78774096 CCCCCACAGCCAGGCGGCTTTGG - Intergenic
1160793208 19:932530-932552 CCCCCAGGCCCTGCCAGCTTGGG + Exonic
1161087209 19:2340695-2340717 CCCCCAGCGCCTGCCCGGGTCGG + Intronic
1161673018 19:5624578-5624600 CCCCCAGCCCCTGCAGGCAGTGG + Intronic
1162053492 19:8049559-8049581 ACCCCAGAGCCTGCAGGGTTGGG - Intronic
1162982143 19:14247361-14247383 CCCTCCCAGCCTGCTGGCATTGG - Intergenic
1165158331 19:33801625-33801647 CAGCCTGAGCCTGCCGGCAGCGG + Intronic
1165754723 19:38286182-38286204 CCCACAGAGCCTGCCTGCCTGGG - Intronic
1166862614 19:45818788-45818810 ACCCCAGGGCCTGCCTTCATGGG - Intronic
1166996349 19:46721404-46721426 CCACCAGAGGCTGCCAGCACAGG + Intronic
1167346440 19:48948422-48948444 AACCCACAGCCTTCCGGCATGGG - Intergenic
1167935533 19:52903916-52903938 CACCCACAGCATGCCTGCATTGG - Intergenic
927072844 2:19548280-19548302 ACCCCTGAGCCTGCAGGGATGGG - Intergenic
927591275 2:24360223-24360245 CCCGCAGAGCCTCCGGGCAGCGG + Intronic
928205284 2:29279399-29279421 CCCCCAGAGGCTGCAGGGAAGGG + Intronic
930728824 2:54708973-54708995 CCCTCGGAGCCTGCCGTCCTGGG + Intergenic
932344821 2:70988575-70988597 CCCCCACATCCTGCCTGCATGGG + Exonic
932780208 2:74554634-74554656 CCCCCAGCGGCTGCCGGCGGGGG + Exonic
932907906 2:75773858-75773880 CCCTCAGAAGCTGCAGGCATTGG - Intergenic
934613774 2:95758898-95758920 CTCCCAGGGACTGCCGGCACAGG + Intergenic
934840502 2:97621337-97621359 CTCCCAGGGACTGCCGGCACAGG - Intergenic
934941697 2:98507627-98507649 CCACCAGAGGCCGCCTGCATGGG - Intronic
935359594 2:102236282-102236304 CCCTGAGAGCCAGCCGGCAGGGG + Intronic
936276222 2:111100059-111100081 CTGCCAGTGCCTGCCTGCATTGG + Intronic
936976181 2:118224515-118224537 CCCGCAGAGCCAGGCGGCAAAGG - Intergenic
937956090 2:127422543-127422565 CCCCCAAAGCCCGCAGGCAGAGG + Intronic
938235993 2:129707863-129707885 CCCGCAAACCCTGCCTGCATGGG + Intergenic
938323032 2:130377792-130377814 CCCCCGGATCCTGCCGGCCCAGG - Intergenic
938370291 2:130764083-130764105 GCCACACAGCCTGCCAGCATGGG - Exonic
945132289 2:206585913-206585935 GCCCCAGAGAGTGCCAGCATTGG + Intronic
946471585 2:219965707-219965729 CCCCTATAGCCTGCAGGCAGTGG + Intergenic
949064840 2:241983767-241983789 ACCCCAGAGCCTGTGGGCCTGGG + Intergenic
1169143990 20:3240669-3240691 CCCCCGGAGCATGGCTGCATAGG + Intergenic
1169358469 20:4927541-4927563 CTCCTAGAGCCTGCAGGCAGTGG - Intronic
1171854357 20:30331293-30331315 TCCTCAAAGCCTGACGGCATTGG - Intergenic
1172116638 20:32576973-32576995 ACCCCAGAGCCTGGAGGCAGGGG - Intronic
1173524525 20:43721640-43721662 ACCCCTGAGCCTGCAGGGATGGG + Intergenic
1175468305 20:59207995-59208017 CCCCCAGAGCCTTCCAGGGTAGG + Intronic
1175599420 20:60260666-60260688 TCCCAGGAGCCTGCCGGCACTGG - Intergenic
1175837158 20:62003665-62003687 CTCCCAGAGCCAGCTGCCATTGG - Intronic
1175918454 20:62438541-62438563 CCCCCAGAGCCTGGCGACAGCGG - Intergenic
1175952345 20:62590304-62590326 GCCCCAGAGCCAGCAGGCAGCGG + Intergenic
1176025274 20:62982391-62982413 CCCCCAGAGCCTGTGAGCACAGG - Intergenic
1176217690 20:63956046-63956068 CCCGAGGAGCCTGCCGGCTTGGG + Intronic
1177925415 21:27208324-27208346 CCCCCAGAAGCTGCCAGAATCGG - Intergenic
1179501495 21:41812146-41812168 CCCCCAGAGCCTCCCAGAGTAGG + Intronic
1179566242 21:42250874-42250896 CCCCCAGACCCCGCAGGGATCGG + Intronic
1179929377 21:44557363-44557385 CCCACAGAGACTTCAGGCATTGG + Intronic
1179937114 21:44612923-44612945 CCCCCAGGGCCAGCCGGCTCCGG + Exonic
1180986250 22:19905526-19905548 CCCTCAGAGGCTGCCCGCTTGGG - Intronic
1183483094 22:38075489-38075511 CCCCCGGAGCCTGCTGGGAGTGG + Exonic
1185254027 22:49822017-49822039 TTCCCAGTGACTGCCGGCATCGG - Intronic
1185367284 22:50442445-50442467 TTCCCAGTGACTGCCGGCATCGG - Intronic
954650952 3:52162449-52162471 ACCCCTGAGCCTGCAGGGATGGG + Intergenic
954660352 3:52223748-52223770 CCTCCAGTGCCTGCCTGCAGGGG + Exonic
966491426 3:180531872-180531894 ACCCCAGAGCCTGCAGGGATGGG - Intergenic
967201506 3:187076245-187076267 CCCCCAGAGCCACCCTGCATTGG - Exonic
974894840 4:67926711-67926733 CCCCCAGAGCCTGCCACCCTGGG + Intronic
976990435 4:91358610-91358632 CACCCACAGCGTGCCTGCATTGG - Intronic
984081288 4:175252771-175252793 CCCCTAGACACTGCCGCCATGGG + Intergenic
984282303 4:177685842-177685864 CCCTAAGAGCCTGCTGACATGGG + Intergenic
988609976 5:32714157-32714179 CCCCCAGTCCCAGCCGGCCTTGG - Intronic
989168038 5:38449528-38449550 CCCCCAGAGACTGAAGGCTTGGG - Intronic
989557476 5:42814089-42814111 CACCCACAGCGTGCCTGCATTGG + Intronic
989557491 5:42814202-42814224 CACCCACAGCGTGCCTGCATTGG + Intronic
992219736 5:74560069-74560091 CCCCCAGGGGCTGCCAGCGTGGG + Intergenic
994245641 5:97472160-97472182 CCCGCAGAGCCTGCCATCCTAGG - Intergenic
998192775 5:140041939-140041961 CCCGCAGACCCTGCCAGCCTGGG + Intronic
998404462 5:141866293-141866315 GCCACAGAGCCTGCTGGCAGTGG + Intronic
998725273 5:145005467-145005489 TCCCAAGAGCCTGCTGGCACAGG - Intergenic
1001272739 5:170327824-170327846 CCACAAGAGGCTGCTGGCATGGG - Intergenic
1001843902 5:174904089-174904111 CCCCAAGACCCTGGTGGCATGGG - Intergenic
1003235855 6:4294751-4294773 GCCCCAGAGGCTGCCTGCAGGGG - Intergenic
1004191745 6:13470276-13470298 CAGCCACAGCCTGCTGGCATGGG - Intronic
1004338953 6:14790229-14790251 CCCCCAGGGCCTCTGGGCATGGG + Intergenic
1005332198 6:24761289-24761311 ACCCCCGAGCCTGCAGGGATGGG + Intergenic
1006591924 6:35164579-35164601 AGTCCAGAGCCTGCCTGCATGGG + Intergenic
1006643083 6:35498285-35498307 CCCCCAGAGCCCGTCAGCGTGGG - Exonic
1010378597 6:75202755-75202777 CCCCCAGCGCTTGCCGCCCTGGG - Exonic
1013980320 6:116121220-116121242 CCCCCAGGGCCTCCTGGCTTTGG - Exonic
1014710388 6:124799861-124799883 CCCCCACAGCCTACCAGCAGTGG + Intronic
1017722537 6:157253875-157253897 CTCCCAGAGCCTGCCTGGAAAGG + Intergenic
1018038965 6:159904919-159904941 CCCCAAGAACCTGCTGGCCTCGG + Intergenic
1018774409 6:166999618-166999640 CCCCCAGTGCCCGCCGGCCCCGG - Intronic
1019032448 6:169024640-169024662 CCCTCAGAGCCGCCCCGCATCGG + Intergenic
1019423870 7:964022-964044 CCCCCAGAGCCTGCCGAGGCGGG + Intronic
1019423882 7:964055-964077 CCCCCAGAGCCTGCCGAGGCGGG + Intronic
1019423905 7:964121-964143 CCCCCAGAGCCTGCCGAGGCGGG + Intronic
1019516083 7:1440799-1440821 CCCCCACAGCCAGCCGGCCGGGG + Intronic
1019706055 7:2497872-2497894 TCCCCAGACCCTGCCGGGGTGGG + Intergenic
1019911428 7:4102639-4102661 CCACCAGAGCCTCCCAGCAGGGG + Intronic
1019956349 7:4417711-4417733 CAGCCAGAGCATGCCAGCATGGG - Intergenic
1021097084 7:16547222-16547244 CCACCAGAGCCTGCCACCCTGGG + Intronic
1021902379 7:25298862-25298884 CCAGCAGAGACTGCCGTCATAGG + Intergenic
1026272169 7:68845927-68845949 CCCGCAGAGGCTACTGGCATAGG - Intergenic
1028922206 7:96321595-96321617 CCCCCAGCGCTTGCCGGCCCAGG + Intronic
1029460972 7:100693860-100693882 CCCCCAGAGCCGGCCAGCCTCGG - Intergenic
1029473312 7:100767982-100768004 CCCACAGAGCTGGCCGCCATAGG - Exonic
1029595907 7:101537598-101537620 CCCACAGAGCCTGCAGACCTGGG - Intronic
1031531999 7:122886664-122886686 TCCCCAGAGCCCGCCGGCAGAGG + Intronic
1032782199 7:135172253-135172275 CACCCACAGCATGCCTGCATGGG + Intergenic
1033584931 7:142767449-142767471 CCACCAGAGCCTGCTGGGAAGGG + Intergenic
1033586414 7:142778062-142778084 CCACCAGAGCCTGCTGGGAAGGG + Intergenic
1034210569 7:149358878-149358900 CCCCCGGAGCCTGCTGCCCTGGG - Intergenic
1035176328 7:157054692-157054714 CCCCCAGACCCTGCCAACAGAGG + Intergenic
1035577319 8:716170-716192 CCCCCAGACTCTGCCCGCAGAGG + Intronic
1040621362 8:49096265-49096287 CCTCCAGCTCCTGCCGGCACCGG + Intergenic
1042271572 8:66961644-66961666 CCCCCAGGGCCCGCCGGCCCCGG + Exonic
1042687994 8:71462582-71462604 CCCCCGGAGCCTGCCACCCTGGG - Intronic
1046395548 8:113633894-113633916 CCCCCAGATCCTGCCACCCTGGG - Intergenic
1048073361 8:131042460-131042482 CGCCCAGGGCCTGACGTCATTGG - Intergenic
1049312361 8:141939870-141939892 CCCCCAGCGCCTGGCTGAATTGG + Intergenic
1049756288 8:144312580-144312602 CCCCCAGCCCCTGCCTGCAATGG + Intronic
1052861805 9:33442196-33442218 CCCCCAGGACCGGCCAGCATTGG - Exonic
1052902170 9:33802718-33802740 CCACCAGAGCCTGCTGGGAAGGG + Intergenic
1057548469 9:96035069-96035091 ACCCCCGAGCCTGCAGGGATGGG - Intergenic
1060413065 9:123412499-123412521 CTCACAGAGCCTGCAGGCATAGG - Intronic
1060470292 9:123942802-123942824 CACCCAGAGCCTCCCGGAATAGG + Intergenic
1062048165 9:134433926-134433948 CCCCCAGAGCCTGGTGGCAGGGG - Intronic
1062154586 9:135039582-135039604 GCCCCACAGCCTGCAGGCATCGG - Intergenic
1062621916 9:137426657-137426679 CCCACAGAGCCTGCCCTCCTGGG - Intronic
1185449747 X:275860-275882 CGCTCAGAGCCTGCAGGCTTGGG + Intergenic
1185514643 X:690433-690455 CCCTCAGAGGCTGCCCTCATGGG + Intergenic
1189007394 X:37009869-37009891 CGCCCAGAGCCTCCCGACACTGG + Exonic
1195654715 X:107323805-107323827 CCCCCGCAGCCTGCCGCCCTGGG + Intergenic
1195740521 X:108060560-108060582 TCCCCATATCCTGCTGGCATGGG + Intronic
1196854808 X:119972844-119972866 CCCCCAGCGCCTGGCGGGAGTGG - Intergenic
1196857267 X:119995888-119995910 CCCCCAGCGCCTGGCTGAATTGG - Intergenic