ID: 1084786199

View in Genome Browser
Species Human (GRCh38)
Location 11:71443140-71443162
Sequence TGCCAAATAGTGTCCCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 671
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 605}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084786194_1084786199 12 Left 1084786194 11:71443105-71443127 CCGCCTACTGGCATCAGAGCTTC 0: 1
1: 0
2: 0
3: 15
4: 149
Right 1084786199 11:71443140-71443162 TGCCAAATAGTGTCCCACAGTGG 0: 1
1: 0
2: 4
3: 61
4: 605
1084786195_1084786199 9 Left 1084786195 11:71443108-71443130 CCTACTGGCATCAGAGCTTCATT 0: 1
1: 0
2: 2
3: 7
4: 141
Right 1084786199 11:71443140-71443162 TGCCAAATAGTGTCCCACAGTGG 0: 1
1: 0
2: 4
3: 61
4: 605

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084786199 Original CRISPR TGCCAAATAGTGTCCCACAG TGG Intronic
901877396 1:12174740-12174762 TGCCCACTAGTGTCCAAAAGAGG - Intronic
901906211 1:12413878-12413900 TGCCAAACAGTTTTCCAAAGTGG - Intronic
902912380 1:19609415-19609437 GGCCAAACAGTGTTCCAAAGTGG - Intronic
903103879 1:21057082-21057104 TGCCAAATTGCTTCCCAAAGTGG - Intronic
903571240 1:24307167-24307189 TCCCAAAGTGTGTTCCACAGTGG + Intergenic
904408281 1:30308245-30308267 TGACAGATAGATTCCCACAGTGG + Intergenic
905400405 1:37698217-37698239 TGCCAAATTGTTTCCCAAAGTGG - Intronic
905766116 1:40602467-40602489 AGCCAAATAGTATCCCAAAAAGG - Intergenic
906173704 1:43750246-43750268 TGCCAAATTGTTTTCCACAGTGG - Intronic
906672885 1:47669982-47670004 TGCCAAACAGTGTCCCAAAGTGG + Intergenic
906847758 1:49212709-49212731 TGCCAAATGTTGTCCCCCTGAGG + Intronic
908369853 1:63470824-63470846 TGCCAAACAGTTTCCCAAAGTGG + Intronic
908424138 1:63989060-63989082 TGCCATATTGTTTTCCACAGTGG + Intronic
909201350 1:72693631-72693653 TGCCAAATTGTCTGCCTCAGGGG - Intergenic
909567462 1:77069615-77069637 TGCCAAATCGTTTTCCAAAGTGG + Intergenic
910079100 1:83318079-83318101 TGCCAAATAGTTTTCCAAAATGG + Intergenic
910151873 1:84157961-84157983 TGCCAAATTGTTTCCCAAAGTGG + Intronic
910824356 1:91389890-91389912 TGCCAAATTGTTTTCCAAAGTGG - Intronic
910919203 1:92326098-92326120 TGCCAAACAGTTTTCCAAAGTGG + Intronic
910921536 1:92353262-92353284 TGCCAAAGTGTTTTCCACAGTGG + Intronic
910964580 1:92795348-92795370 TGCCAAACTGTTTTCCACAGTGG - Intergenic
911351056 1:96756075-96756097 TGCCAAATTGTCTTCCAAAGTGG - Intronic
911643485 1:100314046-100314068 TGCCAAATTGTTTTCCAAAGTGG + Intergenic
912010871 1:104960559-104960581 TGCCAAATTGTCTTCCAAAGTGG - Intergenic
912139679 1:106708031-106708053 TGTGAAATAGTGTCTCACTGTGG + Intergenic
912673405 1:111652789-111652811 TGCCAAACTGTTTTCCACAGTGG - Intronic
912887794 1:113493942-113493964 TGCCACATCGTCTCCCACAATGG - Intronic
914892706 1:151641272-151641294 TGCCAAACAGTTTTCCAAAGTGG + Intronic
915295376 1:154917682-154917704 TGCCAAATTGTTTTCCAAAGTGG - Intergenic
915693356 1:157713328-157713350 TGCCAAAAAGTTTTCCAAAGTGG + Intergenic
915772142 1:158437034-158437056 TGCCAAATAGTTTTTCAAAGTGG + Intergenic
916522472 1:165577130-165577152 AGCCAAATTGTTTCCCAAAGTGG - Intergenic
916554168 1:165878887-165878909 TGCCAAATTGTCTTCCAAAGTGG + Intronic
916767377 1:167874551-167874573 TGCCAAATAGTTTTCCAAAATGG - Intronic
917032615 1:170710635-170710657 TTCCAAATAGTGTCACACTGGGG - Intronic
917243574 1:172975739-172975761 TGTCAAACAGTTTCCCAAAGTGG + Intergenic
917278741 1:173358485-173358507 TTCCAAATAGTTTTCCAAAGTGG - Intergenic
917403755 1:174681136-174681158 TGCCAAATTGTTTCCCAAAGTGG - Intronic
917439918 1:175058776-175058798 TGCCAAATGGTTTTCCAAAGTGG - Intergenic
917613372 1:176712746-176712768 TCCCAAATAATTTTCCACAGTGG + Intronic
917850236 1:179056706-179056728 TGCCAAATTGTCTTCCAAAGTGG + Intronic
917919707 1:179741354-179741376 TGCCAAATTGTTTTCCAAAGTGG - Intergenic
918461394 1:184780670-184780692 TGCCAAATTGTTTTCCAAAGTGG + Intergenic
918650197 1:186953136-186953158 TGCCAAATGGTCTTCCAAAGTGG + Intronic
919099784 1:193080335-193080357 TGCCAAATTGTTTTCCACAGGGG - Intronic
919323274 1:196070757-196070779 TGCCAAACTGTCTCCCAAAGTGG + Intergenic
920680653 1:208069972-208069994 TGAGAAATAGTGTCCCAGAGAGG + Intronic
921506865 1:215982483-215982505 TGACAGATAGTGTGCCACGGAGG - Intronic
922016468 1:221653416-221653438 TGTCAAATTGTTTCCCAAAGTGG - Intergenic
922123963 1:222704245-222704267 GGCCAAATTGTTTTCCACAGTGG - Intronic
922626482 1:227050381-227050403 TGCCAAATTGTTTTCCACAGTGG - Intronic
923181566 1:231525271-231525293 TGCCAAATTGTCTCCTATAGTGG + Intergenic
1062984081 10:1750753-1750775 TGCCAAATTGGCTTCCACAGTGG - Intergenic
1063392179 10:5657591-5657613 TGCCATACAGTCTTCCACAGTGG - Intronic
1063503534 10:6576127-6576149 TGCCATATTGTTTTCCACAGTGG - Intronic
1064182255 10:13128262-13128284 TGCCAAACAGTTTTCCAGAGTGG + Intronic
1064307503 10:14181119-14181141 TCCGAAAAAGTGTCTCACAGTGG + Intronic
1064607386 10:17057517-17057539 TGCCAAATTGTTTTCCAAAGTGG - Intronic
1065148038 10:22792279-22792301 TGCCAAACAGTTTCCCAGTGTGG + Intergenic
1065336649 10:24659107-24659129 TGCCAAACCGTTTTCCACAGTGG - Intronic
1066175300 10:32897223-32897245 TGCCAAACTGTTTTCCACAGTGG - Intergenic
1066534854 10:36380649-36380671 TGCCAAACTTTGTCCCAAAGTGG - Intergenic
1066545471 10:36495434-36495456 TGCCACATCGTGCTCCACAGTGG + Intergenic
1067151575 10:43739283-43739305 TGCCAAATTGTTTTCCAAAGTGG + Intergenic
1067934135 10:50594018-50594040 TGCCAAATTGTTTTCCAAAGTGG + Intronic
1068906337 10:62328224-62328246 TGCCAAACTGTCTTCCACAGTGG + Intergenic
1069212242 10:65776837-65776859 TGCCAAACTGTTTCCCAAAGTGG + Intergenic
1070242045 10:74691940-74691962 TGCCAAATTGTCTTCCAAAGTGG - Intronic
1070317003 10:75323429-75323451 TGCCAAATTGTTTTCCAAAGTGG + Intergenic
1070615319 10:77965345-77965367 TGCCAAACTGTGTCTCAAAGTGG + Intergenic
1070685016 10:78474067-78474089 TGACAAACAGTTTCCCAAAGTGG + Intergenic
1070852540 10:79578615-79578637 TACCAAATCGTGTTCCAAAGTGG - Intergenic
1072195087 10:93110744-93110766 TGCCAAATTGCTTTCCACAGTGG + Intergenic
1072592425 10:96838894-96838916 TGCCAAATTGTTTCCTAAAGTGG + Intronic
1074142941 10:110691349-110691371 TGCCAAACTGTTTCCCACAGTGG + Intronic
1074146164 10:110719144-110719166 TGCCAAATGGTGTTCCAAAAAGG + Intronic
1074360747 10:112822505-112822527 TGCCAAATTGTACACCACAGCGG - Intergenic
1074756023 10:116624755-116624777 TGTCAGATAGAGTCCCACAGTGG - Intronic
1074806566 10:117059281-117059303 TGCCAAACTGTTTCCCAGAGTGG - Intronic
1074990661 10:118703636-118703658 TGCGAAATAGTCTTCCAAAGAGG + Intronic
1075222622 10:120598384-120598406 TGCCAAACAGACTCCCAGAGGGG + Exonic
1075570744 10:123540975-123540997 TGCCAAACACTTTCCCAAAGTGG + Intergenic
1076641961 10:131923517-131923539 TGCCAAACAGTTTCCCAAGGTGG + Intronic
1076810388 10:132883537-132883559 TGCCAGATTGTCTCCCACAGCGG - Intronic
1077286973 11:1771498-1771520 TGCCAAACTGTCTCCCAAAGTGG - Intergenic
1077854600 11:6110473-6110495 TGCAAAATACTTTCCCACAGTGG + Intergenic
1077903872 11:6513773-6513795 TGCCAAACAGTTTTCCAGAGTGG + Intronic
1077965253 11:7124142-7124164 TGCCAAATTGTTTTCCACACAGG + Intergenic
1078056833 11:8015990-8016012 TCCCACAAAGTGTCCCACTGTGG + Intergenic
1078173872 11:8953850-8953872 TGCCAGATTGTTTCCCAAAGTGG - Intronic
1078499247 11:11853406-11853428 TGCCAAATACTTTTCCACAATGG - Intronic
1078521126 11:12064477-12064499 TGCCAAATTGTTTTCCAAAGTGG + Intergenic
1078903065 11:15659466-15659488 TGACAAACAGTTTCCCAAAGTGG - Intergenic
1079416372 11:20240210-20240232 TGCCAAATTGTTTTCCAAAGTGG + Intergenic
1080040655 11:27756349-27756371 TGCCATATTGTTTCCCACAGTGG + Intergenic
1080215451 11:29834925-29834947 TGCCACATTGTCTTCCACAGTGG - Intergenic
1080273472 11:30475824-30475846 TGCCAAAAAGTTTTCCAAAGAGG + Intronic
1080650380 11:34217852-34217874 TGCCAAATTGTCTTCCAAAGTGG + Intronic
1081053366 11:38374825-38374847 TTCCAAATTGCTTCCCACAGTGG + Intergenic
1081328498 11:41775377-41775399 TGCCAAAGAGTTTCCTAAAGTGG - Intergenic
1082952270 11:58830231-58830253 TGCCAAACTGTTTTCCACAGTGG - Intergenic
1084786199 11:71443140-71443162 TGCCAAATAGTGTCCCACAGTGG + Intronic
1085546533 11:77323510-77323532 TGCCAAACAGTTTTCCAAAGTGG - Intronic
1085612311 11:77962298-77962320 TGCCAAATAGTTTTCCATAATGG + Intronic
1086040439 11:82470488-82470510 TGCCAAATAGTTTTCCAAACTGG + Intergenic
1086865434 11:91974028-91974050 TCCAAAATACTGTCACACAGGGG + Intergenic
1087020401 11:93596694-93596716 TGCCAAATATTCTCCCTCAAAGG - Intergenic
1087773299 11:102234676-102234698 TGACAAAAAGTGTACCACCGTGG - Intergenic
1087980003 11:104600216-104600238 TGCCAAACTGTCTCCCAAAGAGG - Intergenic
1089548350 11:119249013-119249035 TGCCAAACTGTTTCCCACAGTGG - Intronic
1090806246 11:130204097-130204119 TGACAAGAAGGGTCCCACAGAGG - Intronic
1090864221 11:130682559-130682581 TGCCAAATTGCTTTCCACAGTGG + Intronic
1091522926 12:1266126-1266148 TGCCAAACAGTCTCCCAAAGTGG + Intronic
1091547822 12:1515392-1515414 TGCCAAATTGTTTTCCTCAGTGG + Intergenic
1091942151 12:4496956-4496978 TGCCAAATAGTTTTTCAAAGTGG - Intronic
1092950171 12:13495382-13495404 TGCCAAATAGTGTTACTTAGAGG + Intergenic
1093095505 12:14967210-14967232 GGCCAAATGGTTTTCCACAGTGG + Intergenic
1093394445 12:18664193-18664215 CACCAAACTGTGTCCCACAGTGG - Intergenic
1094006863 12:25762931-25762953 TGCCAAATTGTCTTCCAAAGTGG + Intergenic
1094170615 12:27487634-27487656 TGCCAAACAGTGTTCCAGAGTGG + Intronic
1094224521 12:28030236-28030258 TGCCACATTGTCTTCCACAGTGG - Intergenic
1094312641 12:29101719-29101741 TGCTAAATAGTCTTCCAAAGTGG + Intergenic
1094314589 12:29124438-29124460 TGCCAAACAGTCTTCCATAGTGG + Intergenic
1095546852 12:43382059-43382081 TGCCAAACTGTTTTCCACAGTGG - Intronic
1096565780 12:52477637-52477659 TGCCAAACTGTCTCCCAAAGTGG - Intergenic
1097592967 12:61593887-61593909 TGCCACATTGTCTTCCACAGTGG - Intergenic
1097969112 12:65613275-65613297 TGCCAAACTGTTTTCCACAGTGG - Intergenic
1098526859 12:71496502-71496524 TGCCAAATAGTTTTCTAAAGTGG - Intronic
1098593437 12:72241715-72241737 TGCCAAACAGTCTTCCAGAGTGG + Intronic
1098838832 12:75454265-75454287 GGCAAAATAGTGTCTTACAGAGG - Intergenic
1098853158 12:75621864-75621886 TGGCAAATAGTCTTCCAAAGTGG - Intergenic
1099256224 12:80316602-80316624 AGCCAAACAGTGTCTCACAAAGG - Intronic
1099378976 12:81932908-81932930 TGCCAAATTGTATTCCAAAGTGG + Intergenic
1100621334 12:96277217-96277239 TGCCAAAATGTTTTCCACAGTGG - Intergenic
1101479368 12:105082773-105082795 TGCCAAACAGTTTTCCAAAGTGG + Intronic
1102424088 12:112827022-112827044 TGCCAAACAGTGTTCCAAAGTGG + Intronic
1102899216 12:116623342-116623364 TGACAAATACTATCCCACTGGGG - Intergenic
1103171823 12:118827373-118827395 TGCCAAACAGTCCCCCAAAGGGG + Intergenic
1104681348 12:130754189-130754211 TGCCAAATAGTTTTCCAAAGTGG + Intergenic
1105703054 13:22948229-22948251 TACCAAAGAGCCTCCCACAGGGG + Intergenic
1105855751 13:24370711-24370733 TACCAAAGAGCCTCCCACAGAGG + Intergenic
1106779487 13:33043129-33043151 TGTCAAATAGTTTTCCAAAGTGG + Intronic
1106806939 13:33318969-33318991 TGCCAAATGGTTTTCCAAAGTGG - Intronic
1106851356 13:33796475-33796497 TTCCAAATAGTTTTCCAAAGTGG - Intergenic
1106933604 13:34694043-34694065 TGCCAACTAGGGGCTCACAGAGG + Intergenic
1107454615 13:40543252-40543274 TGCCAAATGGTTTTCCAAAGTGG - Intergenic
1107762579 13:43696366-43696388 TGCCAAATTGTTTTCCAAAGTGG + Intronic
1108061693 13:46539483-46539505 TGCCAAATTGTCTTCCAAAGTGG + Intergenic
1108839791 13:54598316-54598338 AGGCAAATTGTGTCTCACAGGGG - Intergenic
1108865328 13:54916742-54916764 TGCCAAACAGTTTTCCAAAGTGG - Intergenic
1109518828 13:63481911-63481933 TGCCAAATGGTCACCCAAAGTGG + Intergenic
1110530711 13:76594430-76594452 AGCCAAATTGTGTAGCACAGGGG + Intergenic
1110822298 13:79930921-79930943 TGCCAAATTGTTTTCCAAAGTGG - Intergenic
1111948336 13:94689034-94689056 TGCCAAACTGTTTTCCACAGTGG - Intergenic
1112148157 13:96724939-96724961 TGCCAAATGGTCTTCCAAAGTGG + Intronic
1112489690 13:99850595-99850617 TGCCAAACTGTTTTCCACAGCGG - Intronic
1113381601 13:109810756-109810778 TGCCATACTGTGTCCAACAGAGG - Intergenic
1114175463 14:20315352-20315374 TGCCAAATTGTCTTCCAAAGTGG - Intronic
1114497616 14:23144231-23144253 TGCCAAACTGTCTTCCACAGTGG + Intronic
1114941360 14:27614556-27614578 TGCCACAGAGTGTCCCACCGAGG + Intergenic
1114968208 14:27991560-27991582 TGCCAAATTGTCTTCCAAAGTGG + Intergenic
1115042571 14:28949162-28949184 TGCCACACAGTCTTCCACAGTGG + Intergenic
1115720292 14:36153538-36153560 TGCCAAAGAATGTTCCAAAGTGG - Intergenic
1115753397 14:36512541-36512563 TACCAAATTGGGCCCCACAGAGG + Intronic
1116035853 14:39626663-39626685 TGCCAAATAGTTTTCCAAAGTGG + Intergenic
1116949784 14:50868712-50868734 TGCCAAATTGTTTTCCAAAGTGG - Intronic
1118195408 14:63621165-63621187 TGCCAAAGTGTTTTCCACAGAGG - Intronic
1118214378 14:63794826-63794848 TGCCAAATTGTTTTCCAAAGTGG - Intergenic
1118407068 14:65435678-65435700 TGCCAAATTGTTTTCCAAAGTGG + Intronic
1118523922 14:66619298-66619320 TGCTAAATTGTTTCCCAAAGTGG + Intronic
1118735637 14:68699424-68699446 TGCCAAATTGTTTTCCAAAGTGG + Intronic
1119283388 14:73430297-73430319 TGCCAAATTGTTTTCCAAAGAGG + Intronic
1120737843 14:88075278-88075300 TGCCAAATTGTCTTCCAAAGTGG - Intergenic
1120952517 14:90055018-90055040 TGCCAAATTGTCTTCCAAAGTGG - Intergenic
1121596105 14:95163945-95163967 TGCCAAACTGTTTTCCACAGTGG - Intergenic
1122361187 14:101166104-101166126 TGCCAAACTGTCTCCCAAAGTGG + Intergenic
1122432291 14:101661063-101661085 TGCCATACTGTTTCCCACAGTGG + Intergenic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1125987522 15:44069247-44069269 TGCCAAACTGTTTCCCAGAGTGG - Intronic
1126609162 15:50511345-50511367 TGCCAAATTGTTTTCCAAAGTGG - Exonic
1126658507 15:51007372-51007394 TGCCAAATTGTCTTCCAAAGTGG + Intergenic
1126689584 15:51278881-51278903 GGCTAAATACTGTCCCACATAGG + Intronic
1127102254 15:55578429-55578451 TGCCAAACTGTTTTCCACAGTGG + Intronic
1127247159 15:57189655-57189677 TGCCAAACTGTTTTCCACAGGGG - Intronic
1127444621 15:59048028-59048050 TGCCAAATTGTTTCCCTAAGTGG - Intronic
1127624108 15:60763598-60763620 TGCTAAAGTGTGTCCCACATGGG - Intronic
1127648143 15:60978030-60978052 TGCCAAACTGTTTTCCACAGAGG + Intronic
1127730402 15:61796446-61796468 TGCCAAAGAATTTCCCAAAGGGG + Intergenic
1128190025 15:65684288-65684310 TGCCAAATTGTTTTCCAAAGTGG + Intronic
1128305470 15:66595414-66595436 TGCCAAATAGTCTACCATAGAGG - Intronic
1128324858 15:66717730-66717752 TGCCATACAGGGTCCCACAATGG + Intronic
1128380883 15:67111561-67111583 TGCCAAATTGTTTTCCAAAGTGG + Intronic
1128473535 15:67976734-67976756 CGCCAAATAGTTTTCCAAAGTGG + Intergenic
1128530958 15:68447430-68447452 TGCCACATAGGGCCACACAGGGG + Intergenic
1128548581 15:68583546-68583568 GGGCAGATGGTGTCCCACAGAGG - Intronic
1128585367 15:68844631-68844653 TGCCAAGTTGTTTTCCACAGTGG - Intronic
1129241447 15:74254653-74254675 GGACAAAGAGTATCCCACAGTGG - Intronic
1129437959 15:75557579-75557601 TGCCAAAGTGTTTTCCACAGTGG + Intronic
1129805569 15:78454108-78454130 TGCCAAATTGTTTCCCAAAGTGG - Intronic
1131433061 15:92401866-92401888 TCCCAAATAGTGAGCCACAGAGG + Intronic
1131929161 15:97419525-97419547 TGCTAATTACTGTCCCTCAGAGG + Intergenic
1132033935 15:98464030-98464052 TGCCAAATTGTTTCACAAAGTGG - Intronic
1133410577 16:5565124-5565146 TGCCACTTAGTATCCCACTGAGG - Intergenic
1134513712 16:14869813-14869835 TGTCAAATTGTTTTCCACAGAGG + Intronic
1134701352 16:16268309-16268331 TGTCAAATTGTTTTCCACAGAGG + Intronic
1134970478 16:18526337-18526359 TGTCAAATTGTTTTCCACAGAGG - Intronic
1135326709 16:21530763-21530785 TGCCAAAGAGTTTTCCAAAGTGG - Intergenic
1135902317 16:26473880-26473902 TGCCATATTGTTTTCCACAGGGG - Intergenic
1136336966 16:29616178-29616200 TGCCAAAGAGTTTTCCAAAGTGG - Intergenic
1138033847 16:53582580-53582602 TGCCAAACAGTTTTCCAAAGTGG - Intergenic
1139201238 16:64979641-64979663 TGCCAAAGTGTTTTCCACAGTGG - Intronic
1139352523 16:66346296-66346318 TGCTAAAAGGTGGCCCACAGGGG + Intergenic
1139695845 16:68674103-68674125 TGCCAAACTGTTTTCCACAGTGG + Intronic
1140697533 16:77549821-77549843 TGCCAAACTGTCTTCCACAGTGG + Intergenic
1141013988 16:80430434-80430456 TGCCAAACAGTTTTCCAAAGTGG + Intergenic
1142039760 16:87885513-87885535 TGCCAAAGAGTTTTCCAAAGTGG - Exonic
1143232167 17:5366058-5366080 TGCCAAATAATTTTCCAGAGTGG + Intronic
1144151021 17:12446346-12446368 TGCCAAACTGTGTTCCAAAGTGG + Intergenic
1146147293 17:30431036-30431058 TGCCAAACTGTTTTCCACAGAGG + Intronic
1146838923 17:36136010-36136032 TGCCATGCAGTGACCCACAGAGG + Intergenic
1147275703 17:39314699-39314721 TGCCAAGCTGTGTTCCACAGTGG + Intronic
1148165430 17:45480986-45481008 TGCCAAACTGTGTGCCAAAGTGG + Intronic
1148452998 17:47792793-47792815 TGCCAAACAGTTTCCTAAAGTGG - Intergenic
1149409343 17:56388981-56389003 TGCCAAACAGTTTTCCAGAGTGG - Intronic
1150014718 17:61542747-61542769 TGCCAAAGTGTCTCCCAAAGTGG + Intergenic
1150537314 17:66056312-66056334 TGCCAAAGTGTTTTCCACAGTGG - Intronic
1150677350 17:67256073-67256095 TGCCAAACAGTTTTCCAAAGTGG - Intergenic
1150752505 17:67878460-67878482 TGCTAAACAGTTTTCCACAGGGG + Intronic
1151282297 17:73085695-73085717 TGCCAAATAGTTTGCCAAAATGG - Intronic
1152369016 17:79873728-79873750 TGCCAAATTGTTTTCCAGAGGGG + Intergenic
1152483028 17:80568714-80568736 TGCTAGATATTGTCCCACTGAGG + Intronic
1152806276 17:82357757-82357779 TGACAAATTGTCTCACACAGTGG - Intergenic
1153373990 18:4355046-4355068 TGCCAAACTGTTTCCCAGAGCGG - Intronic
1153569700 18:6456735-6456757 TGCCAAACTGTTTTCCACAGTGG + Intergenic
1153592554 18:6688895-6688917 TGCCAAACTGTCTTCCACAGTGG - Intergenic
1153734657 18:8052753-8052775 TGCCAACTTGTGTTCCATAGTGG + Intronic
1154467880 18:14667485-14667507 TGCCAAACCATTTCCCACAGGGG + Intergenic
1155019220 18:21879575-21879597 TGCCAAATTGTCTTCCACAGAGG - Intergenic
1155335389 18:24758831-24758853 TGACAAATAGTTTTCCAGAGTGG + Intergenic
1155717082 18:28957086-28957108 AGTCAAATAGTTTCCCAAAGAGG - Intergenic
1157019670 18:43765264-43765286 TGCCAAATATTTTTCCAAAGTGG - Intergenic
1157503823 18:48211759-48211781 TGCCAAACTGTCTTCCACAGTGG - Intronic
1157678381 18:49584321-49584343 TGCCAGCTAGTGTGGCACAGAGG - Intronic
1157944673 18:51965704-51965726 TGCCAAATTGTTTTCCAAAGTGG + Intergenic
1158348968 18:56545258-56545280 TGCCATATTGTTTTCCACAGTGG - Intergenic
1159296128 18:66491652-66491674 TGCCAAATAGTCTTCCGAAGTGG - Intergenic
1159892993 18:73970152-73970174 TGCCAAGTAGTTTTCCAAAGTGG - Intergenic
1163110385 19:15157148-15157170 TGAAGAAGAGTGTCCCACAGCGG - Intergenic
1163339158 19:16693301-16693323 TGCCAAATTGTCTTCCAAAGTGG - Intergenic
1163649835 19:18510781-18510803 TGCCAGATTGTTTTCCACAGCGG - Intronic
1163979216 19:20882904-20882926 TGACAAAGAGATTCCCACAGTGG - Intergenic
1164288869 19:23849367-23849389 TGCCAATTAGGGTCCCATAAAGG + Intergenic
1164697943 19:30260942-30260964 TGCAAAATAGTCTCACATAGTGG - Intronic
1164968987 19:32514294-32514316 TGCCAAATTGTCTTCCAAAGCGG - Intergenic
1165007146 19:32816676-32816698 TACCCAATAGTGTTCCAAAGTGG + Intronic
1165262495 19:34632668-34632690 TGACAAATTGTGTTCCAAAGTGG - Intronic
1165477877 19:36042197-36042219 TGCCATATTGTTTTCCACAGTGG - Intronic
1165642455 19:37401796-37401818 TGCCAAATTGTTTTCTACAGTGG + Intergenic
1166497854 19:43317067-43317089 GGCCAAAGACTGTCCCAGAGGGG + Intergenic
1167553272 19:50175772-50175794 GGAGAAATAGTGTCCCTCAGGGG - Intergenic
1168522972 19:57067295-57067317 TGCCAAATTTTATACCACAGGGG + Intergenic
926873732 2:17451850-17451872 CACCAAATAGTTTCCCAAAGTGG - Intergenic
926900325 2:17744149-17744171 TGCCAAAGTGTGTTCCAAAGTGG + Intronic
927659864 2:24983794-24983816 TGCCAAACAGTGTTCCAAAGTGG + Intergenic
927874516 2:26646332-26646354 TGCCAAATTCTTTCCCAAAGCGG - Intergenic
927911121 2:26900655-26900677 TGCCAAATAGTTTTCCAGACTGG + Intronic
928184634 2:29098781-29098803 TGCCAAGTGATGTTCCACAGAGG + Intronic
928219069 2:29387709-29387731 GGACAAATAATATCCCACAGAGG + Intronic
928452675 2:31390581-31390603 TGCCAAATTGTCTTCCACAGTGG + Intronic
928475242 2:31619233-31619255 TGCCAAATTGTTTCCCAAAGTGG - Intergenic
928627129 2:33151321-33151343 TGCCAAACTGTTTTCCACAGAGG + Intronic
929092127 2:38229260-38229282 TGCCAAATGGTCTTCCAAAGCGG - Intergenic
929446628 2:42007062-42007084 TGCCAAGTAGTTTTCCAAAGAGG - Intergenic
930413788 2:51063152-51063174 TGCCAAATTGTTTCCCACAGTGG - Intergenic
930565702 2:53017539-53017561 TGCCAAATAGTTTTCCTGAGTGG - Intergenic
930757942 2:54997424-54997446 TGCCAAATTGTTTTTCACAGTGG - Intronic
932085536 2:68754653-68754675 TACCAAATTGTTTCCCAGAGGGG + Intronic
933240182 2:79912278-79912300 TGCCAAATTGTATGACACAGAGG + Intronic
933343199 2:81048753-81048775 TGGAAAGCAGTGTCCCACAGTGG + Intergenic
935604144 2:104953308-104953330 TGTCAAATAGTTTTCCAAAGTGG - Intergenic
935997853 2:108793487-108793509 TGCCAAATTGTTTTCCAAAGTGG - Intronic
936239561 2:110775829-110775851 TGCCATATTGTGTTCCCCAGTGG - Intronic
936257786 2:110931843-110931865 TGCCAAATAATTTTCCAAAGTGG - Intronic
936459554 2:112703009-112703031 TGCCAAATTGTCTCCCAAAGTGG + Intergenic
936482313 2:112895247-112895269 TGCCAAATAATTTTCCACAGTGG + Intergenic
936704288 2:115053048-115053070 TGCCTAATTGTTTTCCACAGTGG - Intronic
937709191 2:124959769-124959791 TGCCAAAGTGTCTTCCACAGTGG - Intergenic
937964961 2:127498688-127498710 TGCCAAACTGTATTCCACAGAGG + Intronic
938321007 2:130363852-130363874 TGCCAAACTGTTTTCCACAGTGG + Intronic
938694649 2:133824328-133824350 AGCCCAACAGTGTCCCACATAGG - Intergenic
939019449 2:136941425-136941447 TGCCACATTGTCTTCCACAGTGG + Intronic
939071091 2:137544034-137544056 TGCCACACAGTGTTCCAAAGTGG - Intronic
939165140 2:138633057-138633079 TGTCAAATTGTTTTCCACAGTGG - Intergenic
939828322 2:147042680-147042702 TGCCAAATTGTCTTCCAAAGTGG - Intergenic
940130301 2:150373749-150373771 TGCCAAATTGTTTTCCAAAGTGG + Intergenic
940528534 2:154848376-154848398 TGCCAAATAGTGTGCTATATAGG - Intronic
940816956 2:158307469-158307491 TGCCAAATAGTTTTCCAAAGTGG - Intronic
940898117 2:159100657-159100679 AGCAAATTAGTGTCTCACAGTGG + Intronic
940977789 2:159965713-159965735 TGCCAAACTGTCTCCCACAGTGG + Intronic
941089537 2:161159113-161159135 TGCCAAATTGTCTTCCAAAGTGG - Intronic
941172858 2:162161101-162161123 TGCTAAAGTGTTTCCCACAGTGG + Intergenic
941378383 2:164759970-164759992 TGCCAAATTGCTTCCCAGAGTGG - Intronic
941931314 2:170942777-170942799 TGCCAAACTGTTTTCCACAGCGG + Intronic
942287076 2:174430177-174430199 TGCCAAACTGTCTTCCACAGTGG + Intergenic
942931731 2:181502009-181502031 TGGCAAAAAGAGGCCCACAGAGG + Intronic
943106517 2:183550552-183550574 TGCCACAAAGTGTTCCACAATGG - Intergenic
943542625 2:189236439-189236461 TGACAAATAGTTTTCCAAAGTGG + Intergenic
943857316 2:192814058-192814080 TGCCAAATGGTCTTCCATAGTGG + Intergenic
945141593 2:206692425-206692447 TGCCAAATTGTGCTCCAGAGGGG - Intronic
945415865 2:209571481-209571503 TGCCAAACAGTTTTCCAAAGTGG + Intronic
947046088 2:225986656-225986678 TGCCAAATTGTTTTCCACAGTGG - Intergenic
947050232 2:226033843-226033865 TGCCAAATTGTTTTCCAAAGTGG + Intergenic
947784019 2:232798481-232798503 TGCCAAACTGTTTCCCAGAGTGG + Intronic
947886067 2:233572743-233572765 TGCCAAATAATATTCCAAAGTGG - Intergenic
948102686 2:235387809-235387831 TGCCAAACTGTTTTCCACAGTGG + Intergenic
948254922 2:236560219-236560241 CCCCATATAGTGTCCCATAGTGG + Intergenic
948500908 2:238393118-238393140 TGCCAAACTGTGTTCCAGAGTGG + Intronic
1170389468 20:15856099-15856121 TGCCAAATAATTTTCCAAAGAGG + Intronic
1170590356 20:17766834-17766856 TGCTAAAGAGTGTTCCAGAGTGG + Intergenic
1170896732 20:20421710-20421732 TGCCAAACTGTTTTCCACAGTGG - Intronic
1171365683 20:24622382-24622404 TACAAAATAGTGTAACACAGGGG + Intronic
1171501739 20:25599041-25599063 TGCCAAATGGTTTTCCAAAGTGG + Intergenic
1171939685 20:31314067-31314089 TGTCAAATAGCTTCCCAAAGTGG + Intergenic
1172078532 20:32318897-32318919 TGCCAAACTGTTTGCCACAGTGG + Intronic
1172740790 20:37165220-37165242 TGCCAAATTGTTTTCCAAAGTGG + Intronic
1172905063 20:38363245-38363267 TGCCAAACAGTTTTCCAAAGTGG + Intronic
1173232595 20:41212450-41212472 TGCCAAACAGTTTTCCAAAGTGG - Intronic
1173261055 20:41436435-41436457 TGCCAAATTGTTTTCCAGAGTGG - Intronic
1173372887 20:42454415-42454437 TGCCAAATTGTTTTCCAAAGTGG + Intronic
1174055846 20:47797752-47797774 TGCCATATTGTTTTCCACAGTGG - Intergenic
1174263782 20:49317100-49317122 TGCCAAACTGTCTCCCACAATGG + Intergenic
1174371684 20:50093599-50093621 TGCCAAACTGTTTCCCAAAGTGG - Intronic
1175090336 20:56497912-56497934 TGCCAAACTGTTTTCCACAGTGG + Intronic
1175467564 20:59201053-59201075 TGCCAAATTGTTTTCCAAAGTGG + Intronic
1176036206 20:63038298-63038320 TGCCAAATCGTCTCCCACGGTGG + Intergenic
1176806632 21:13490168-13490190 TGCCAAACCATTTCCCACAGGGG - Intergenic
1178006558 21:28227150-28227172 TGAGAAATTGTGTCTCACAGAGG - Intergenic
1178674204 21:34616870-34616892 TGCCAAATTGTTTTCCAAAGTGG - Intergenic
1180931822 22:19597286-19597308 TTCCAAATTGTTTTCCACAGCGG + Intergenic
1182139781 22:27943665-27943687 TGCCAAATAGTTTTCAAAAGTGG + Intergenic
1182798449 22:33009198-33009220 TGTCAAAAAGTTTCCCATAGTGG + Intronic
1182992476 22:34781520-34781542 TGCCCAATATTGTCACACAAAGG - Intergenic
1183035991 22:35141404-35141426 GGCCAGAGAGTGCCCCACAGGGG - Intergenic
1183144503 22:35977250-35977272 TGCCAAACTGTTTCCCAAAGTGG - Intronic
1183815871 22:40299695-40299717 TGCCAAGTAGTGTAGCACAATGG - Intronic
1185185752 22:49398615-49398637 TGCCAAATTCTTTTCCACAGTGG - Intergenic
949629539 3:5908583-5908605 CTCCAAATTGTTTCCCACAGTGG + Intergenic
949964630 3:9345083-9345105 TGCCAAATACTCTCCCAGAAAGG + Intronic
949989730 3:9569335-9569357 TGCCAAATAGTTTTCCAGAGTGG + Intergenic
950034023 3:9871507-9871529 TGCCAAACTGTTTTCCACAGTGG + Intronic
950354178 3:12390243-12390265 TGCCAAATTGTTTTCCAAAGTGG - Intronic
950527887 3:13535328-13535350 TGCCAAACGGTTTCCCACAATGG + Intergenic
950760234 3:15216212-15216234 TGCCAAATTGTTTTCCAGAGTGG + Intronic
951094952 3:18618079-18618101 TGCCAAATTGTTTTCCAAAGTGG + Intergenic
951703238 3:25517564-25517586 TGCCAAACTGTTTCCCATAGTGG - Intronic
952868109 3:37871528-37871550 TGCCAAACTGTGTTCCAAAGTGG + Intronic
952921292 3:38285852-38285874 TGCCAAATTGTTTTCCAAAGTGG + Intronic
952971446 3:38653174-38653196 TGCCAGACAGTTTTCCACAGTGG + Intergenic
953059693 3:39417091-39417113 TTCCAAATGGTGGGCCACAGTGG - Intergenic
953063861 3:39451364-39451386 TGCCAAATTGTCTTCCAAAGTGG + Intergenic
953973573 3:47365856-47365878 TGCCAAACTGTTTCCCACAGAGG + Intergenic
954203581 3:49040789-49040811 TGCCAAATTGTCTTCCAAAGTGG + Intronic
954308567 3:49746123-49746145 TGCCAAACTGTTTCCCACAGTGG - Intronic
954473811 3:50724266-50724288 TGCCACACAGTCTTCCACAGTGG - Intronic
955329362 3:58034288-58034310 TGCCAAACTGTTTCCCAAAGTGG + Intronic
955944341 3:64177972-64177994 TGCCAAACAGTGCTCCAAAGTGG + Intronic
955994403 3:64664842-64664864 TGCCAAATTGTTTTCCAAAGTGG + Intronic
956133966 3:66080967-66080989 TGCCAAACAGTTTTCCAAAGTGG - Intergenic
956559025 3:70552891-70552913 TGCCAAACAGTTTTCCAAAGTGG + Intergenic
956656829 3:71560474-71560496 TGCCAAACAGTTTCCCAAAGTGG - Intronic
956990407 3:74756540-74756562 TGCTAAAAAGTGGCTCACAGTGG + Intergenic
957185966 3:76941460-76941482 TGCAAAATATTGTCCTAGAGAGG - Intronic
957383413 3:79464337-79464359 TGCCAAACAGTTTTCCAAAGTGG + Intronic
957486881 3:80872842-80872864 TGCCAGATAGTATCTCACTGTGG - Intergenic
957530193 3:81431099-81431121 TGCCATATTGTCTTCCACAGTGG - Intergenic
957876770 3:86156855-86156877 TGTTACATAGTGTGCCACAGTGG + Intergenic
959061174 3:101617856-101617878 TTCCAAGAACTGTCCCACAGTGG - Intergenic
959641424 3:108641609-108641631 TGCCAAATTGTTTTCCAGAGTGG + Intronic
959952475 3:112194702-112194724 TGCCATACTGTTTCCCACAGAGG + Intronic
961396717 3:126598490-126598512 TGCCAGATTGTTTTCCACAGTGG - Intronic
961513248 3:127417126-127417148 TGCCAAATTGTTTTCCAAAGTGG - Intergenic
961614407 3:128167460-128167482 GGCCAAATAGAGTTCAACAGTGG + Intronic
961957145 3:130815721-130815743 TGCCAAATTGTTTTCCAGAGTGG - Intergenic
962336187 3:134533233-134533255 TGCCTAAGAGTGTTCCACACAGG + Intronic
962838278 3:139208819-139208841 TGCCAAATAGTTTTCCAAAATGG - Intronic
962981249 3:140492248-140492270 TGCCAAATAGTTTTCTAAAGAGG - Intronic
963079490 3:141377522-141377544 TGCCAAACAGTTTCCTAGAGTGG - Intronic
963144947 3:141983881-141983903 TGCCATATTGTTTTCCACAGTGG - Intronic
963163662 3:142178840-142178862 TGCCAAATAGTTTTTCAAAGTGG + Intronic
963209500 3:142673572-142673594 TGCCAAATTGTTTTCCAAAGTGG + Intronic
964354471 3:155837461-155837483 TGCCAAATAGTTTTCCAAAGTGG - Intronic
964445754 3:156755611-156755633 TGCCAAACTGTTTCCCAAAGTGG + Intergenic
964506738 3:157407818-157407840 TGCTAAATACTGTTCCACATGGG + Intronic
964781881 3:160348507-160348529 TGCCAAATTGTTTTCCAAAGTGG - Intronic
965108999 3:164397693-164397715 TGCCAAGTAATGTCTAACAGTGG + Intergenic
965527733 3:169739511-169739533 TGCCACAAATTGTTCCACAGAGG - Intergenic
965798232 3:172464002-172464024 TGCCATATATTTTTCCACAGTGG + Intergenic
966245810 3:177806782-177806804 TGCCAAATAATCTTCCAAAGTGG + Intergenic
966477143 3:180362298-180362320 TGCCAAATTGTCTTCCAAAGTGG + Intergenic
966774215 3:183529820-183529842 TTCCAAATAGAGTCACACTGCGG - Intronic
967004046 3:185366507-185366529 TGCCAAATTGTTTTCCAAAGTGG + Intronic
967068360 3:185940448-185940470 TGCCAAACAGTTTTCCACAGTGG + Intergenic
967794604 3:193585904-193585926 TGCCAAATATTTTTCCAAAGTGG + Intronic
968063133 3:195741399-195741421 TGCCAAATTGTCTTCCAAAGTGG + Intergenic
970091779 4:12417211-12417233 TGACAAATAGTGTATCTCAGAGG + Intergenic
970100121 4:12511978-12512000 TGCCAAACTGTCTTCCACAGTGG + Intergenic
970288549 4:14546440-14546462 TGCCAAATAGTGTTCCAAATTGG + Intergenic
970376675 4:15464724-15464746 TGCCAAATTATTTTCCACAGTGG - Intergenic
970397992 4:15690274-15690296 TGCCAAATAATATCACCCAGTGG - Exonic
970751295 4:19365893-19365915 TGCCAAATGGTTTTCCAAAGTGG - Intergenic
972027057 4:34394661-34394683 TGCCATACAGTTTTCCACAGTGG - Intergenic
972069744 4:35002729-35002751 TACCAAAAAGTGTTCCAAAGTGG + Intergenic
972443928 4:39125260-39125282 TGCCAAACTGTTTTCCACAGTGG - Intronic
972551299 4:40137420-40137442 TGCCAAATTTTTTCCCAAAGTGG + Intronic
972736900 4:41851283-41851305 TGCCAAACAGTTTTCCAAAGTGG + Intergenic
972934048 4:44109487-44109509 CTCCAAACAGTTTCCCACAGTGG + Intergenic
973529705 4:51823662-51823684 TCCCAAATTATTTCCCACAGTGG + Intergenic
974179238 4:58362574-58362596 AGCCAAATTGTGTTCCACAGAGG - Intergenic
975526135 4:75352598-75352620 TGCCCAGTGGTGTCCCAGAGAGG + Intergenic
975641039 4:76500526-76500548 TACCAAATAGTTTCCCAAAGTGG + Intronic
975787939 4:77913564-77913586 TGCCAAATTGTTTGCCAAAGAGG - Intronic
976735335 4:88303171-88303193 TGCCAAACGGTTTTCCACAGTGG - Intergenic
977000850 4:91500044-91500066 TGCCAAATTGTCTTCCAAAGTGG + Intronic
977030894 4:91881741-91881763 TGCCAAACTGTTTCCCAAAGTGG + Intergenic
977305399 4:95317936-95317958 TGCGGAATGGTGTCCCACAAAGG + Intronic
977554313 4:98473247-98473269 TGCTAAATTGTTTCCCAAAGAGG + Intronic
978549394 4:109908821-109908843 TGCCAAATATTTTTCCAAAGTGG - Intergenic
978733069 4:112053301-112053323 TGCCAAATTGTTTTCCAAAGTGG + Intergenic
978998756 4:115190140-115190162 TGCCAAATTGTCTTCCAAAGTGG + Intergenic
979883240 4:125988744-125988766 TGGTAAATTGTGTGCCACAGGGG + Intergenic
979939889 4:126749069-126749091 TGCCAAATTGTTTTCCAAAGTGG - Intergenic
980517476 4:133882017-133882039 TGCCAAATTGTTTTCCAAAGTGG + Intergenic
980844829 4:138312193-138312215 TCCCAAATGGTGTACCACTGTGG + Intergenic
980915845 4:139032634-139032656 TGCCAAATAGAGTTCAGCAGAGG + Intronic
981053596 4:140336798-140336820 TGCCAAATTATTTTCCACAGTGG + Intronic
981445050 4:144826221-144826243 TGCCAAATAGTTTTCCAAACAGG - Intergenic
982207410 4:153006960-153006982 TGTCAAATAGCTTTCCACAGTGG - Intergenic
982756980 4:159232701-159232723 TGCCAAACTGTCTTCCACAGTGG + Intronic
983609644 4:169628718-169628740 TGCCAAATTGTTTTCCAGAGTGG - Intronic
983749108 4:171242238-171242260 TGCCAAACAGTTTTTCACAGTGG - Intergenic
984143023 4:176026144-176026166 TGCCAAACTGTTTTCCACAGCGG - Intergenic
984232949 4:177121307-177121329 GGCCAAATTATGTCCCAGAGTGG - Intergenic
984289330 4:177774012-177774034 TGCGAAATAGTATCCCAGACTGG - Intronic
984321134 4:178197869-178197891 TGCCAAATAGAGTCCCATATTGG - Intergenic
985040176 4:185883449-185883471 TGGCAAATTGTTTCCCAAAGTGG - Intronic
985700185 5:1366794-1366816 TGCCAAACTGTCTTCCACAGCGG - Intergenic
988123643 5:27000432-27000454 TTCCAAATAGTTTTCCAAAGTGG - Intronic
988877576 5:35464405-35464427 TGCCAAACTGTTTTCCACAGTGG - Intergenic
989754120 5:44931766-44931788 TGCTAACTTTTGTCCCACAGTGG + Intergenic
990464543 5:56059759-56059781 TGCCAAATTGTTTTCCAGAGTGG - Intergenic
991002182 5:61793501-61793523 TGCCACACTGTCTCCCACAGTGG + Intergenic
992785925 5:80170621-80170643 TGCCAAAAACTGACCCACGGTGG - Intronic
994552253 5:101251211-101251233 TGACAAACTGTTTCCCACAGTGG - Intergenic
995434124 5:112116544-112116566 TGGCAAATAATAACCCACAGAGG + Intergenic
995628638 5:114108937-114108959 TGCCAAAGAGTTTTCCAGAGTGG + Intergenic
995699894 5:114923563-114923585 TGCCAAATTGTCTTCCAAAGTGG - Intergenic
996242934 5:121225263-121225285 TGCCACACAGTCTCCCACAATGG - Intergenic
997558978 5:134827925-134827947 TGCTAAATAGTTTTCCAAAGAGG + Intronic
997620772 5:135291721-135291743 TGCAAAATTGTTTCCTACAGTGG + Intronic
997820310 5:137060019-137060041 TGCCAAATAGCTTTCCACAGTGG - Intronic
998047539 5:139001279-139001301 TGCCAAATTGTTTTCCAAAGTGG - Intronic
998748454 5:145289669-145289691 TGCCAAATAGTGTTCTAAAGTGG + Intergenic
998962234 5:147500887-147500909 TGCCAAATTGTCTTCCAAAGTGG - Intronic
999118736 5:149190008-149190030 TGCTAAATAGTATCCCTCTGTGG - Intronic
999391591 5:151196793-151196815 TGCCAAACTGTTTTCCACAGGGG - Intronic
999700387 5:154222534-154222556 TGCCAAATTGTTTTCCAAAGTGG + Intronic
999713146 5:154336405-154336427 TGCCAAATTGTCTTCCAAAGTGG + Intronic
1000220923 5:159213277-159213299 TGCCAGATAGTCTTCCAAAGTGG + Intergenic
1000520035 5:162283908-162283930 TGCCATATAGAGTCCCAAACTGG - Intergenic
1001531746 5:172467185-172467207 CGTCAAATAGTTTTCCACAGTGG + Intergenic
1001947497 5:175792338-175792360 TCCCAAATAGTTCCCCAAAGTGG - Intergenic
1002086912 5:176781717-176781739 TGCCAACTAGTGTTCCGGAGTGG + Intergenic
1002129287 5:177070122-177070144 TGCCAAACAGTTTTCCAAAGTGG + Intronic
1002858482 6:1058682-1058704 TGCCATACTGTGTTCCACAGTGG - Intergenic
1003826988 6:9963845-9963867 TGCCAAACAGTTTTCCAAAGGGG + Intronic
1004196304 6:13508892-13508914 TGCCAAATAGTTTTACAAAGTGG + Intergenic
1004215011 6:13694096-13694118 TGCCAAATTGTTTCACAAAGTGG - Intronic
1004301160 6:14458885-14458907 TGCCAAAGAGTTTTCCAAAGTGG + Intergenic
1004907118 6:20246539-20246561 TGCCAAACTGTTTCCCAGAGTGG - Intergenic
1005003529 6:21266024-21266046 CTCCAAATTGTTTCCCACAGTGG - Intergenic
1005234533 6:23744569-23744591 TGCCACATTGTCTTCCACAGTGG - Intergenic
1005311105 6:24560274-24560296 TGCCAAACTGTATTCCACAGTGG + Intronic
1005803816 6:29454533-29454555 TGCCAAATTGTTTTCCAAAGTGG - Intronic
1006486156 6:34344112-34344134 AACCAAATTGTTTCCCACAGTGG - Intronic
1006666337 6:35697004-35697026 TGCCAAACTGTTTTCCACAGAGG - Intronic
1007045331 6:38767869-38767891 TGCCAAACAATTTTCCACAGTGG + Intronic
1007233851 6:40376393-40376415 TGCCAAAATGCTTCCCACAGTGG - Intergenic
1008235446 6:49041513-49041535 TGCCAAATTGTCTTCCAAAGTGG + Intergenic
1009771399 6:68146672-68146694 TGCCACATTGTCTCCCACAATGG + Intergenic
1010079303 6:71840187-71840209 TGCCAAACTGTTTTCCACAGTGG + Intergenic
1010933333 6:81830409-81830431 TGCCAAATTGTTTTCCACAGTGG - Intergenic
1011100793 6:83719760-83719782 TGCTAAATAATGTCCCTCACTGG - Intergenic
1011503688 6:88018393-88018415 TGCCAAATTGTTCCCCAAAGTGG + Intergenic
1011988638 6:93483442-93483464 TGCCACATTGTCTTCCACAGTGG - Intergenic
1012253521 6:97006980-97007002 TCTCATATAGTGTCTCACAGGGG + Intronic
1012366735 6:98450129-98450151 TGCCAAATACTTTTCCAGAGTGG + Intergenic
1012822463 6:104103607-104103629 TGCCAAATGGTTTTCCAAAGTGG - Intergenic
1012972851 6:105750200-105750222 TGCCACTCAGGGTCCCACAGAGG + Intergenic
1013271315 6:108547860-108547882 TGCCAGATTGTTTTCCACAGTGG - Intergenic
1013826423 6:114216122-114216144 TGCCTAGTAGGGTCCCAGAGAGG + Intronic
1013858936 6:114610061-114610083 AGCAAAATACTGTCTCACAGTGG + Intergenic
1014160432 6:118161579-118161601 TGCCAAGTAATTTCCCACAAGGG - Intronic
1014228547 6:118875802-118875824 TGCCAAATTGTCTTCCAAAGTGG - Intronic
1014562201 6:122905023-122905045 TGACAAATAGTTTTCCAAAGTGG + Intergenic
1014727986 6:124996091-124996113 TGCCAAATTGTTTTCCAAAGTGG + Intronic
1014793169 6:125698095-125698117 TGGCAAATTGTTTCCCAAAGTGG - Intergenic
1015948240 6:138524755-138524777 TGCCAAAAAGTTTCCCAAATAGG + Intronic
1016937569 6:149458676-149458698 TGCCAAATTGTTTTCCAGAGTGG + Intronic
1017409066 6:154149998-154150020 TGGCAAATAATGTCCCACCAAGG + Intronic
1017780159 6:157709633-157709655 TTCCAAATACTGTCACACTGGGG + Intronic
1017966891 6:159274828-159274850 AGCTAAATAGTGTTCAACAGGGG + Intergenic
1018109856 6:160524666-160524688 TGTCAAATTGTTTTCCACAGTGG + Intergenic
1019949151 7:4357120-4357142 TGCCAAATTGTTTCCCACAGAGG + Intergenic
1020809773 7:12837276-12837298 TGCCAAATTGTTCCCCAAAGTGG - Intergenic
1020928987 7:14369490-14369512 TGCCACATTGTCTTCCACAGTGG + Intronic
1021222952 7:17994217-17994239 TGCCAAATAGTGAGTGACAGGGG - Intergenic
1021441277 7:20679834-20679856 TGCCAAATAGTTTTTCAAAGTGG - Intronic
1023276633 7:38526018-38526040 AGCCAAACTGTTTCCCACAGTGG + Intronic
1024178761 7:46867295-46867317 TGCCTAATTGTCTCCCAAAGTGG + Intergenic
1024448286 7:49508310-49508332 TGCCAAATAGTTTGCTATAGTGG - Intergenic
1025617407 7:63133571-63133593 TGGCATATAGTGGCTCACAGTGG - Intergenic
1026373549 7:69726619-69726641 TGCCAAACAGTTTTCCAAAGTGG + Intronic
1027296871 7:76783355-76783377 TGCCAAATAGTTTTCCAAAATGG + Intergenic
1027570310 7:79858386-79858408 TGCCAGACAGGGTCACACAGGGG + Intergenic
1028316867 7:89413317-89413339 TGCCAGATTGTTTCCCAAAGTGG + Intergenic
1028388494 7:90287383-90287405 TGCCAAACAGTTTTCCAGAGTGG + Intronic
1029042360 7:97590248-97590270 TGCCAGATAGTTGCTCACAGGGG + Intergenic
1029867915 7:103655791-103655813 TTGCAAAATGTGTCCCACAGTGG + Intronic
1029869585 7:103676461-103676483 TGCCACATTGTCTTCCACAGTGG - Intronic
1030009076 7:105148077-105148099 TGCCAAAGTGTCTTCCACAGTGG + Intronic
1030175994 7:106654231-106654253 TGCCAAACAGTTTTCCAAAGTGG - Intergenic
1030538116 7:110794069-110794091 TGCCAAATTGTCTTCCAAAGTGG - Intronic
1031404316 7:121366117-121366139 TGCCAGATAGTTTTCCAAAGTGG - Intronic
1031831498 7:126632453-126632475 TGCCAAACTGTCTTCCACAGTGG - Intronic
1032120519 7:129152156-129152178 TGCCAAACTGTTTTCCACAGCGG - Intronic
1032161942 7:129517524-129517546 TGCCAAACTGTCTTCCACAGCGG - Intergenic
1032573422 7:133026444-133026466 TGCCAAACTGTTTTCCACAGTGG - Intronic
1032655361 7:133923090-133923112 TGCCAAATAATTTTCCAAAGTGG + Intronic
1033269961 7:139921898-139921920 TGCCAAACAGTTTTCCAAAGGGG + Intronic
1033393574 7:140951854-140951876 GGCCAAATTGTTTTCCACAGTGG - Intergenic
1033487832 7:141808693-141808715 TGCCAAACTGTTTTCCACAGGGG - Intergenic
1033765411 7:144484394-144484416 TGCCAAATTGTTCTCCACAGGGG - Intronic
1033844952 7:145420558-145420580 TGCCAAATTGTCTTCCAAAGTGG - Intergenic
1036188484 8:6647345-6647367 TGCCAAATGGTGTTTCAAAGTGG - Intergenic
1036388154 8:8299620-8299642 TGCCAAATAGTTTTCCAAAGTGG - Intergenic
1036743254 8:11385875-11385897 TGCCAAATTGTATGCCAAAGTGG - Intergenic
1037296456 8:17406555-17406577 TGCCAAATTGTTTTCCAAAGTGG - Intronic
1037541436 8:19875740-19875762 TGCCAAATTGCTTTCCACAGTGG + Intergenic
1037562892 8:20090473-20090495 TGCCAAACTGTTTCCCAAAGTGG + Intergenic
1037777068 8:21842520-21842542 GGGCAAATATTGTCCCTCAGGGG - Intergenic
1038208624 8:25493821-25493843 TGCCAAATACTCCTCCACAGAGG - Intronic
1038321693 8:26532935-26532957 TGCCAAACTGTTTCCCAAAGTGG + Intronic
1039004682 8:33020985-33021007 TGCCAAACAGTTTTCCAGAGTGG + Intergenic
1039340459 8:36643755-36643777 TGCCAAATTGTTTTCCAGAGTGG - Intergenic
1039782800 8:40803648-40803670 TGCCAAATTGTCTTCCAAAGTGG - Intronic
1040757601 8:50798214-50798236 TGCCAAATTGCCTCCCAAAGTGG + Intergenic
1040806218 8:51399151-51399173 TGCCAAATTGTTACCCAAAGTGG - Intronic
1040921191 8:52619870-52619892 AGCCAAATTGTTTCCAACAGTGG - Intergenic
1041000544 8:53446241-53446263 TGCCACATTGTCTTCCACAGTGG - Intergenic
1041041172 8:53847552-53847574 TGCCAAATTGTTTTCCAAAGTGG + Intergenic
1041326843 8:56676557-56676579 TGCCAAATTGTTTTCCAAAGCGG - Intergenic
1041498686 8:58515889-58515911 TGCCAAATGGTCTTCCAAAGTGG + Intergenic
1041555097 8:59144960-59144982 TGCCAAACTGTTTTCCACAGTGG + Intergenic
1042157465 8:65860860-65860882 TGCCAAATTGTCTGCCAAAGTGG + Intergenic
1042257495 8:66820624-66820646 TGCCAAACTGTTTTCCACAGTGG + Intronic
1042297780 8:67241587-67241609 TGCCAAACGGTGTTCCACAAAGG - Intronic
1042771271 8:72385332-72385354 TGCCAAATTGTGTTCCAGAAAGG + Intergenic
1043066839 8:75583219-75583241 TGCCAAATTGTCTTCCAAAGTGG - Intergenic
1043282958 8:78491399-78491421 TGCCAAACTGTTTTCCACAGTGG - Intergenic
1043416591 8:80057268-80057290 ATCCAAATTGTGTTCCACAGTGG - Intronic
1045119164 8:99016290-99016312 TGCCAAATAGTCTTCCAAAGTGG + Intronic
1045130881 8:99150953-99150975 TGCCAAATTGTCTTCCAAAGTGG + Intronic
1045520900 8:102902115-102902137 AGCCAAACTGTTTCCCACAGTGG - Intronic
1045556118 8:103216331-103216353 TGACAAATAGTTTTCCAAAGTGG + Intronic
1046129493 8:109948827-109948849 TGCCAAATTGTCTTCCAAAGTGG + Intergenic
1046208305 8:111033434-111033456 TTCCAAATAGCTTTCCACAGTGG + Intergenic
1046311582 8:112444277-112444299 TGCCAAATAGTTTCCCAAAGTGG - Intronic
1046492969 8:114977189-114977211 TGCCAAATTGTATTCCAAAGTGG - Intergenic
1046935245 8:119879260-119879282 TGCCAAATATTTTTCCAAAGGGG - Intronic
1047204489 8:122792542-122792564 TGCCAAACAGTTCCCCAAAGTGG + Intronic
1047329171 8:123870220-123870242 TGTCAAATAGTCTTCCAAAGTGG - Intronic
1047677383 8:127217860-127217882 TGCCAAATTGTCTTCCAAAGGGG - Intergenic
1047777023 8:128080308-128080330 TGCCAAATTGTCTTCCAAAGTGG + Intergenic
1050187487 9:2990123-2990145 TGCCAAATTGTTTTCCAAAGTGG - Intergenic
1050328444 9:4520834-4520856 TGCCAAACAGTCTTCCACAGAGG + Intronic
1050499245 9:6277669-6277691 TGCCAAATTGTCTTCCAAAGTGG - Intergenic
1050755314 9:8995485-8995507 TGTAAAATAGTGACCCACTGTGG - Intronic
1050866829 9:10511338-10511360 TGCCAAATTGTCTTCCAAAGCGG + Intronic
1051112052 9:13650560-13650582 TGCCAAATGATGTCCCCAAGTGG - Intergenic
1051288213 9:15517992-15518014 TGCCAAACTGTTTCCCAAAGTGG + Intergenic
1051733131 9:20168775-20168797 TGCCAAATTGTTCTCCACAGTGG - Intergenic
1051984642 9:23068959-23068981 TTTCAAATAGTTTCCCAGAGTGG - Intergenic
1053271532 9:36752789-36752811 CGCCAAATTGTCTTCCACAGTGG - Intergenic
1053347270 9:37387144-37387166 TGCCATCTGGTTTCCCACAGTGG + Intergenic
1055164117 9:73170747-73170769 TGCCAAATTGTTTTCCAGAGTGG + Intergenic
1056872428 9:90294727-90294749 TGCCAAACTGTGTTCCAAAGTGG + Intergenic
1056921996 9:90799597-90799619 TGCCAAACTGTCTTCCACAGTGG + Intergenic
1057170080 9:92957271-92957293 TGCCAAACAGTTTTCCAAAGTGG + Intronic
1057372431 9:94486372-94486394 TGCCAAACCATTTCCCACAGTGG + Intergenic
1057636184 9:96769987-96770009 TGCCAAACTGTTTTCCACAGTGG - Intronic
1057762023 9:97883655-97883677 TGCCAAACTGTTTTCCACAGTGG - Intergenic
1058106823 9:100981604-100981626 TGACTAATGGTATCCCACAGAGG + Intergenic
1058401021 9:104619454-104619476 TGCCAAACAGTTTTCCAGAGTGG + Intergenic
1058609460 9:106759303-106759325 TGCCATATTGTTTTCCACAGTGG - Intergenic
1058827194 9:108785326-108785348 TGCCAAATAGTTTTCCCAAGTGG - Intergenic
1059528877 9:115017764-115017786 TGCCAATTAGATGCCCACAGAGG - Intergenic
1060169446 9:121449367-121449389 TGCCAAATTGTCTTCCAAAGTGG + Intergenic
1060191538 9:121596807-121596829 TGCCAAATTGTTTCCCAGAGTGG + Intronic
1060305527 9:122407611-122407633 TGCCAAATAGTTTTCCAAAGGGG + Intergenic
1060451519 9:123745499-123745521 TGCCAAATTGTTTCCTTCAGTGG - Intronic
1061190765 9:129081320-129081342 TGTCAAATAGTGAACCACGGAGG + Intronic
1061530169 9:131205410-131205432 TGCCAAATGGTTTTCCAAAGTGG - Intronic
1061999969 9:134211047-134211069 TGCCAAATAATTTCCCAAACAGG - Intergenic
1186133369 X:6493701-6493723 TTGCAAATGGTGTCCCTCAGAGG + Intergenic
1186597339 X:10997685-10997707 TGCCAAATTGTTTTCCAAAGTGG - Intergenic
1186677410 X:11833414-11833436 TGCCAAACTGTCTGCCACAGTGG + Intergenic
1186860937 X:13671845-13671867 TGCCAAACTGTTTCCCAAAGTGG - Intronic
1186933182 X:14417337-14417359 TGCCAAATTGTTTTCCAAAGTGG - Intergenic
1187123743 X:16434080-16434102 TGGTAAACAGTGGCCCACAGTGG + Intergenic
1187315847 X:18194195-18194217 TGCCAAACAGTTTCCTAGAGAGG - Intronic
1187365661 X:18663978-18664000 TGCCAAATAGTTTTCCAAAGAGG - Intronic
1187482495 X:19670710-19670732 TGCCAGCTAGGATCCCACAGAGG - Intronic
1187758521 X:22553236-22553258 TGCCAAATTGTTTCCCACAATGG - Intergenic
1188066761 X:25671313-25671335 TGCCAAAGAGTCTTCCAGAGTGG + Intergenic
1188700815 X:33260134-33260156 TGCCAAATTGTTTTCCAAAGAGG + Intronic
1189567062 X:42253977-42253999 TGCCAAATCATGTTCCAAAGTGG - Intergenic
1189887028 X:45557728-45557750 TGCCAAACTGTTTTCCACAGTGG + Intergenic
1189914767 X:45845932-45845954 TGCCAAACAGTTTCCCAAAGGGG - Intergenic
1189933640 X:46041425-46041447 TGCCAAACAGTTTTCCAAAGTGG + Intergenic
1190360128 X:49641041-49641063 TGCCAAATAATTTTCCAAAGTGG + Intergenic
1190515013 X:51214863-51214885 TGCCAAATAGTTTTCTAAAGTGG - Intergenic
1191035434 X:56021547-56021569 TGCCAAATAGATTTCCAAAGTGG + Intergenic
1191962301 X:66717051-66717073 TGCCAAACTGTCTTCCACAGTGG - Intergenic
1191968470 X:66787242-66787264 TGCCACACAGTCTCCCACAATGG - Intergenic
1192275610 X:69627779-69627801 TTCCAAATGGTATTCCACAGTGG - Intronic
1192375736 X:70559925-70559947 TGCCAAACAGTTTTCCAAAGTGG + Intronic
1192581817 X:72289324-72289346 TGCCAAATTCTATGCCACAGTGG + Intronic
1192747583 X:73955310-73955332 TACCAAACAGTTTCCCAGAGGGG - Intergenic
1192893948 X:75420376-75420398 TGCCACACAGTCTTCCACAGTGG - Intronic
1193097064 X:77562384-77562406 TGCCAAATTGTTTCCCAGAATGG + Intronic
1193136199 X:77973355-77973377 TGCCAAATGATTTACCACAGTGG + Intronic
1193609601 X:83613336-83613358 TGCCAAACTGTTTCCCACAGTGG + Intergenic
1194891031 X:99379000-99379022 TGCCAAACTGTCTCCCAAAGTGG + Intergenic
1195113654 X:101673400-101673422 TGCAAAATTGTATTCCACAGTGG + Intergenic
1195134112 X:101886465-101886487 TGCATACTAGTGTCCCTCAGGGG - Intronic
1195155663 X:102121316-102121338 TGCCAAATTGCTTTCCACAGTGG - Intergenic
1195425183 X:104721100-104721122 TGCCACACTGTCTCCCACAGTGG - Intronic
1195848645 X:109257481-109257503 TGCCAAATTGTTTTCCAAAGTGG + Intergenic
1195956605 X:110337638-110337660 TGCCATACTGTTTCCCACAGTGG - Intronic
1196406965 X:115373631-115373653 TGCCTAAGAGTGTCAAACAGGGG - Intergenic
1196466596 X:115978159-115978181 TGCCAAATCCTTTCCAACAGTGG - Intergenic
1196775869 X:119336657-119336679 TGCCAAATGGTTTTCCAAAGTGG - Intergenic
1197453297 X:126644697-126644719 TTCCAAATTGTTTCCCACAGTGG - Intergenic
1197791856 X:130263133-130263155 TGCCAAAGTGTTTTCCACAGTGG - Intronic
1197802259 X:130363617-130363639 TGCCAAATTGTTTTCCACAGTGG + Intronic
1198169763 X:134094145-134094167 GGCCAAAAGGTGGCCCACAGTGG + Intergenic
1198220168 X:134591717-134591739 TGCCAAAGAGTTTTCCAGAGTGG + Intronic
1198592124 X:138195530-138195552 TGCCAAACTGTTTTCCACAGGGG + Intergenic
1198632275 X:138653938-138653960 TGGCAAATAGCGTCCCAGATTGG + Intronic
1198648194 X:138832230-138832252 TGCCACATTGTCTTCCACAGTGG + Intronic
1199223943 X:145350048-145350070 TGCTAAATTGTTTCCCAAAGTGG - Intergenic
1199410678 X:147518942-147518964 TTCCAAACTGTTTCCCACAGTGG + Intergenic
1199507555 X:148582661-148582683 TACCAAACTGTTTCCCACAGTGG - Intronic
1199751307 X:150821941-150821963 TGCCAAATTGTTTTCCACAGTGG - Intronic
1199752010 X:150828813-150828835 TGCCAAATTGTTTTCCAAAGTGG - Intronic
1199813531 X:151375355-151375377 TGCCAAATTGTTTTCCAAAGTGG - Intergenic
1200179623 X:154142471-154142493 TGCCAAACTGTTTTCCACAGTGG + Intergenic
1200697884 Y:6377048-6377070 AGACATTTAGTGTCCCACAGTGG - Intergenic
1201036228 Y:9787651-9787673 AGACATTTAGTGTCCCACAGTGG + Intergenic
1201317154 Y:12658933-12658955 TGTCAAATAGTTTCCCAAAGTGG - Intergenic
1201991212 Y:20028963-20028985 TGTCAAATAGTTTTCCACAGTGG - Intergenic