ID: 1084788576

View in Genome Browser
Species Human (GRCh38)
Location 11:71458693-71458715
Sequence GTGGCTTACGGGGCTGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 240}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084788576_1084788580 -5 Left 1084788576 11:71458693-71458715 CCTATCTCAGCCCCGTAAGCCAC 0: 1
1: 0
2: 0
3: 10
4: 240
Right 1084788580 11:71458711-71458733 GCCACCTCATTTCCCCTGCAAGG 0: 1
1: 0
2: 1
3: 38
4: 240
1084788576_1084788584 -1 Left 1084788576 11:71458693-71458715 CCTATCTCAGCCCCGTAAGCCAC 0: 1
1: 0
2: 0
3: 10
4: 240
Right 1084788584 11:71458715-71458737 CCTCATTTCCCCTGCAAGGAGGG 0: 1
1: 0
2: 3
3: 26
4: 284
1084788576_1084788588 15 Left 1084788576 11:71458693-71458715 CCTATCTCAGCCCCGTAAGCCAC 0: 1
1: 0
2: 0
3: 10
4: 240
Right 1084788588 11:71458731-71458753 AGGAGGGAGCTCCTGAAAGCAGG 0: 1
1: 0
2: 1
3: 32
4: 313
1084788576_1084788582 -2 Left 1084788576 11:71458693-71458715 CCTATCTCAGCCCCGTAAGCCAC 0: 1
1: 0
2: 0
3: 10
4: 240
Right 1084788582 11:71458714-71458736 ACCTCATTTCCCCTGCAAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084788576 Original CRISPR GTGGCTTACGGGGCTGAGAT AGG (reversed) Intronic
900591230 1:3460920-3460942 GTGGCTCCCGGGGCTGAGCAGGG + Intronic
901929446 1:12587593-12587615 GTGGCTTAGGAGGCTGAGGTGGG + Intronic
902352061 1:15863727-15863749 GCTGCTTAGGAGGCTGAGATAGG + Intronic
902370798 1:16005759-16005781 GCTACTTAGGGGGCTGAGATGGG + Intronic
902858346 1:19225705-19225727 GCTGCTTAGGAGGCTGAGATGGG + Intronic
903229249 1:21911791-21911813 GCAGCTGAGGGGGCTGAGATGGG - Intronic
904645618 1:31963960-31963982 GCTGCTTAGGAGGCTGAGATGGG - Intergenic
906170341 1:43719684-43719706 GTGGCTTGGGAGGCTGAGGTGGG + Intronic
906347481 1:45027788-45027810 GTGGCTTGGGAGGCTGAGGTGGG - Intronic
906513500 1:46424589-46424611 GTGGCTGGCTGGGCTGAGACTGG + Intergenic
907277374 1:53324331-53324353 GGGGCTTACGTGGCTGTGTTGGG - Intronic
908190331 1:61696754-61696776 GTGGGTTATGGGGCAGGGATAGG - Intronic
910382643 1:86645081-86645103 GCTACTTAGGGGGCTGAGATGGG + Intergenic
910936273 1:92486123-92486145 GTGGTTTTGGGGGCTGAGCTCGG - Intronic
910983506 1:92981999-92982021 GTTACTTATGAGGCTGAGATGGG - Intergenic
911011528 1:93286205-93286227 GCGGCTTAGGAGGCTGAGGTGGG + Intergenic
913132396 1:115853039-115853061 GTGGCTCAGGAGGCTGAGGTGGG + Intergenic
913509808 1:119551324-119551346 TTGGCTTAAGGGGCTGCCATGGG + Intergenic
913513668 1:119584497-119584519 TTGGCTTAAGGGGCTGCCATGGG + Intergenic
913517293 1:119615415-119615437 TTGGCTTAAGGGGCTGCCATGGG + Intergenic
915216047 1:154341379-154341401 GTGACTCAGGAGGCTGAGATGGG + Intronic
915319481 1:155048401-155048423 GTGGAGTGGGGGGCTGAGATAGG - Intronic
915414395 1:155729531-155729553 TTGGCTCACGAGGCTGAGGTGGG + Intronic
921100176 1:211921974-211921996 GTTGCTTAGGAGGCTGAGGTGGG + Intergenic
921217835 1:212951823-212951845 GTGGCTTCCAGGGCGGAGTTGGG + Intronic
921622420 1:217340546-217340568 GTGCCTTGGGGGGCTGAGGTGGG - Intergenic
922131080 1:222779291-222779313 GTGGCTCAGGAGGCTAAGATAGG + Intergenic
922306361 1:224348650-224348672 GTGACTCAAGAGGCTGAGATGGG - Intergenic
923083910 1:230687216-230687238 GGGCCTTACGGGGCTTAAATTGG + Intronic
924439020 1:244071279-244071301 GGGGCTTTCGGGCCTGACATTGG + Intergenic
924537724 1:244951752-244951774 GCTACTTAGGGGGCTGAGATGGG - Intergenic
1062805912 10:419327-419349 GTGGCAGATGCGGCTGAGATCGG - Intronic
1063290170 10:4736828-4736850 GTGGCTGAGACGGCTGAGATGGG - Intergenic
1065142761 10:22735429-22735451 GTTGCTTACGAGGCTGAGGCAGG - Intergenic
1065416814 10:25497062-25497084 GTGCATTAAGAGGCTGAGATAGG + Intronic
1066460279 10:35607489-35607511 GTGTCTATTGGGGCTGAGATTGG - Intronic
1068537580 10:58256951-58256973 GCTACTTAAGGGGCTGAGATGGG + Intronic
1069948737 10:72005011-72005033 GTGACTAAGGGGGCTGAGGTGGG + Intronic
1070173451 10:73950409-73950431 GCAGCTTACAGGGCTGAGCTTGG - Intergenic
1070547566 10:77464611-77464633 GTGGCTTCTGGGGCTCAGAGAGG + Intronic
1071854161 10:89606633-89606655 GTGACTCAGGAGGCTGAGATGGG - Intronic
1072945939 10:99809989-99810011 ATAGCTTCCGGGGCTGAGTTCGG + Intronic
1076749247 10:132534039-132534061 TTGGCATGCGGGGCAGAGATGGG + Intergenic
1078064699 11:8070705-8070727 TTGGCTTGCGGGGCAGGGATGGG + Intronic
1078775886 11:14393215-14393237 GTGGTTTGGGAGGCTGAGATGGG + Intergenic
1078892925 11:15573560-15573582 GTTGCTGCCAGGGCTGAGATAGG + Intergenic
1079046615 11:17110062-17110084 GCTGCTTAGGAGGCTGAGATGGG - Intronic
1079685415 11:23353100-23353122 GTGGCTTACAAAGCTGAAATAGG - Intergenic
1083378158 11:62242978-62243000 GCTACTTAGGGGGCTGAGATGGG + Intronic
1084278836 11:68072743-68072765 GTGACTTAGGAGGCTGAGACAGG + Intronic
1084788576 11:71458693-71458715 GTGGCTTACGGGGCTGAGATAGG - Intronic
1084865764 11:72055731-72055753 ATGGCTCAGGAGGCTGAGATGGG + Intronic
1085131847 11:74046573-74046595 GTGCTTTAGGAGGCTGAGATGGG - Intronic
1085795133 11:79532524-79532546 GTGGCTTACCAGGCAGAGTTAGG + Intergenic
1089227301 11:116936289-116936311 GTGACTTGGGAGGCTGAGATAGG - Intronic
1090367626 11:126220601-126220623 GCTGCTTAGGAGGCTGAGATAGG + Intronic
1091082431 11:132683286-132683308 GTTACTTACGAGGCTGAGGTAGG + Intronic
1091705209 12:2688832-2688854 TTGGCATGCGGGGCTGAGAAGGG + Intronic
1092211371 12:6648470-6648492 GTTTCTTGGGGGGCTGAGATGGG + Intergenic
1094735138 12:33225569-33225591 GTGCTTTACAGGGCTGGGATGGG - Intergenic
1097290276 12:57908685-57908707 GTGGCTCCCGCGGCTGAGGTAGG + Intergenic
1097516697 12:60616534-60616556 GGGGCTTACAGGGATGAGCTTGG - Intergenic
1101283280 12:103281765-103281787 GTGACTTGGGAGGCTGAGATGGG - Intronic
1102770555 12:115472399-115472421 GTGCCTAAGAGGGCTGAGATTGG - Intergenic
1103766885 12:123286629-123286651 GTGCCTTACTGGGTTGAGAGGGG - Intergenic
1103801238 12:123538891-123538913 GTTACTTAGGGGGCTGAGACAGG + Intergenic
1104513480 12:129402680-129402702 CTGACTTAGGAGGCTGAGATGGG - Intronic
1107933641 13:45326749-45326771 GTTACTTAGGGGGCTGAGGTGGG + Intergenic
1110233080 13:73186647-73186669 GCTGCTTGTGGGGCTGAGATGGG + Intergenic
1112009654 13:95283479-95283501 GTTGCTTGGGAGGCTGAGATGGG - Intronic
1112264169 13:97907460-97907482 GTGACTTGGGGGACTGAGATGGG + Intergenic
1112302504 13:98242565-98242587 GCTGCTTAGGAGGCTGAGATGGG + Intronic
1117261145 14:54034871-54034893 GTGACTTGGGAGGCTGAGATGGG - Intergenic
1117415419 14:55490955-55490977 GTGCCTTGAGAGGCTGAGATGGG - Intergenic
1118695024 14:68376270-68376292 GTGGTTTGGGGGGTTGAGATGGG - Intronic
1121904058 14:97723629-97723651 GTGGCTTGCGGGGCTGCGGATGG + Intergenic
1122739591 14:103864195-103864217 GTTGCTTGGGAGGCTGAGATGGG - Intergenic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1125005656 15:34813787-34813809 GGGGCTAACGTGGCTGAGAGAGG + Intergenic
1125974912 15:43942869-43942891 GTTACTTGGGGGGCTGAGATAGG - Intronic
1128388337 15:67166078-67166100 TTAGTTTACTGGGCTGAGATTGG + Intronic
1128988276 15:72237017-72237039 ATGGCATATGGGGATGAGATGGG + Intergenic
1133133025 16:3689726-3689748 GTGACTCAGGGGGCTGAGGTGGG + Intronic
1135117627 16:19737048-19737070 GCTGCTCATGGGGCTGAGATGGG + Intronic
1136141214 16:28289972-28289994 GTTACTTAGGGGGCTGAGGTGGG + Intergenic
1137719345 16:50618776-50618798 GTGGCTTTCTGAGCTGGGATGGG + Intronic
1138579438 16:57930842-57930864 GTGGCTGCCGGGGCTGGGGTGGG + Intronic
1140600375 16:76468594-76468616 GTGACTCAGGAGGCTGAGATAGG - Intronic
1141814394 16:86399909-86399931 GAGGCTTCCAGGGCTGAGAATGG - Intergenic
1142999270 17:3781459-3781481 GAGGCTTAAGAGGCTCAGATGGG - Intronic
1143072135 17:4305200-4305222 GTGGCTCACGAGGCCGAGGTGGG - Intronic
1143149837 17:4801086-4801108 CTGGGTTATGGGGCTGAGATGGG - Intergenic
1143523222 17:7457488-7457510 GTGACTTAGGAGGCTGAGGTGGG + Exonic
1143837271 17:9702255-9702277 GTTGCTCAGGAGGCTGAGATAGG + Intronic
1144607533 17:16680314-16680336 GTTACTTAAGAGGCTGAGATGGG + Intergenic
1144750800 17:17646994-17647016 GTGGGTTCAGGGGCTGAGAGGGG + Intergenic
1145197297 17:20905797-20905819 GTTACTTAAGAGGCTGAGATGGG - Intergenic
1147762527 17:42808620-42808642 GTGGACTACTTGGCTGAGATGGG + Intronic
1147922041 17:43923688-43923710 GTGGCTCTGGAGGCTGAGATGGG + Intergenic
1149621494 17:58048755-58048777 GCTGCTTGCGGGGCTGAGACAGG - Intergenic
1154012901 18:10590718-10590740 GTTACTTAGGAGGCTGAGATGGG - Intergenic
1154152085 18:11914310-11914332 GAGGGTCACTGGGCTGAGATTGG - Intergenic
1154472624 18:14719929-14719951 GTGACTCAGGAGGCTGAGATGGG - Intergenic
1155307121 18:24489369-24489391 GTTGCTCGGGGGGCTGAGATGGG - Intergenic
1155514118 18:26606709-26606731 CTGGCTTACAGAGCTGAGGTCGG - Intronic
1156432864 18:37094255-37094277 GTGGCTAACAGGCCAGAGATTGG + Intronic
1160696157 19:485611-485633 GTGCTTTAGGGGGCTGAGGTGGG - Intergenic
1160855748 19:1216754-1216776 GCTACTTGCGGGGCTGAGATGGG + Intronic
1161091348 19:2361325-2361347 GTGGGGTGCGGGGCTGGGATGGG + Intergenic
1161091399 19:2361501-2361523 GTGGGTGAAGGGCCTGAGATGGG + Intergenic
1161744434 19:6046873-6046895 GTTCCTTAGGAGGCTGAGATGGG - Intronic
1163003444 19:14383089-14383111 GTGGCTCAGGAGGCTGAGGTGGG + Intronic
1163983051 19:20919894-20919916 GAGGCTTGGGAGGCTGAGATGGG - Intergenic
1164027836 19:21369218-21369240 GTTACTTAAGGGGCTGAGGTAGG - Intronic
1165196784 19:34110439-34110461 GTGCTTTAGGGGGCTGAGGTGGG - Intergenic
1165353320 19:35289031-35289053 GTGGTTTACGAGGCTGAGACGGG + Intergenic
1166744179 19:45132415-45132437 GTGACTTGGGAGGCTGAGATGGG - Intronic
1166954527 19:46454536-46454558 GCTGCTTAGGGGGCTGAAATGGG - Intergenic
1166989259 19:46681364-46681386 GCTGCTTAGGAGGCTGAGATGGG - Intronic
1167260594 19:48455665-48455687 CTGCCTCACGGGGCTGAGGTGGG + Exonic
1168043821 19:53779785-53779807 GTTGCTCAGGGGGCTGAGGTGGG + Intergenic
925690133 2:6513711-6513733 GCGGCTTCGGGGGCTGAGGTAGG - Intergenic
928955813 2:36866184-36866206 GCTGCTTAGGGGGCTGAGGTGGG - Intronic
929473318 2:42218908-42218930 GCTGCTTGCGAGGCTGAGATGGG - Intronic
930923412 2:56786133-56786155 ATGGCTTAGGGTGCTGAGGTTGG - Intergenic
932522912 2:72432280-72432302 GTGGCTTGGGAGGCTGAGGTGGG - Intronic
935288743 2:101590815-101590837 GTTGCTTAGGAGGCTGAGACAGG - Intergenic
935293407 2:101628260-101628282 GTGCCTTATGGGGCTGACATTGG + Intergenic
936610956 2:114001516-114001538 GTAGCTCAGGAGGCTGAGATGGG - Intergenic
937091409 2:119208950-119208972 GTGGCTGAGGGGTATGAGATGGG - Intergenic
937098334 2:119249974-119249996 CTGGCCTACAGGGATGAGATGGG - Intronic
937707863 2:124941905-124941927 GTGGCTTACGGTGAGGGGATGGG + Intergenic
937893047 2:126954633-126954655 GTGACTTAGGAGGCTGAGATGGG - Intergenic
940626839 2:156186187-156186209 GTTACTTAGGGGGCTGAGACAGG - Intergenic
941823933 2:169871495-169871517 GTGGCTCACGGGGCCGAGGCGGG + Intronic
945658436 2:212654457-212654479 GTGTTTTGCGGGGCAGAGATGGG + Intergenic
947415664 2:229892752-229892774 GCGACTTTCGGGGCTGAGGTGGG + Intronic
947845339 2:233239285-233239307 GTGGCTGACTGGGCTCAGAAGGG + Intronic
1168942670 20:1726794-1726816 GCTACTTAGGGGGCTGAGATGGG + Intergenic
1169028621 20:2390925-2390947 GTGGCTTAAAGGGATGAGAGAGG + Intronic
1169049993 20:2567641-2567663 GTGTCTTGCGAGGCTGAGGTGGG - Intronic
1169066298 20:2695949-2695971 GTGGCTGAGGGCACTGAGATTGG - Intronic
1169300892 20:4441102-4441124 GTAACTTAGGAGGCTGAGATGGG - Intergenic
1172363757 20:34333090-34333112 GAGGCTTGGGAGGCTGAGATGGG + Intergenic
1174163482 20:48568145-48568167 ATGGGTTAGGGGGCTTAGATGGG + Intergenic
1175547389 20:59787309-59787331 CTGGCTTCCGGGGCTGGGCTGGG + Intronic
1175804236 20:61818564-61818586 GCTGCTTGCGGGGCTGAGACAGG + Intronic
1176801865 21:13437962-13437984 GTGACTCAGGAGGCTGAGATGGG + Intergenic
1177142277 21:17370142-17370164 CTGGCTTGCGAGGCTGAGGTGGG - Intergenic
1179929747 21:44559346-44559368 GTGTCTTCCTGGGCAGAGATTGG + Intronic
1180993028 22:19949707-19949729 GTGCTTTAGGGGGCTGAGGTTGG - Intronic
1182608705 22:31528310-31528332 GTTGCTTGGGAGGCTGAGATGGG + Intronic
1182854228 22:33502811-33502833 GTGGCTTGGGAGGCTGAGGTGGG - Intronic
949469034 3:4375022-4375044 GTTACTTAGGAGGCTGAGATGGG + Intronic
949880919 3:8660017-8660039 GTGGCTGATGGGGATGAGATGGG - Intronic
950067959 3:10128487-10128509 GCTGCTTAAGGGGCTGAGGTAGG + Intergenic
950447514 3:13046821-13046843 GTGGCTTAGAGGGCTGTGTTCGG - Intronic
950512417 3:13439089-13439111 CTGTATTGCGGGGCTGAGATTGG + Intergenic
951855039 3:27186807-27186829 GGAGCTGATGGGGCTGAGATAGG + Intronic
953981387 3:47414870-47414892 GCGGCTTTCAGGGCTGTGATGGG + Exonic
954566322 3:51603195-51603217 GTTGCTTAGGAGGCTGAGGTGGG + Intronic
955240720 3:57175666-57175688 GTGACTCAGGGGGCTGAGGTGGG - Intergenic
958512923 3:95072189-95072211 GTGGTTGACAGGGCTGAGAGGGG + Intergenic
959062361 3:101627503-101627525 GCTACTTAGGGGGCTGAGATGGG - Intergenic
960249246 3:115434136-115434158 GTGCTTTAGGGGGCTGAGGTAGG + Intergenic
961770887 3:129249333-129249355 GTGGCTTTCGGGTGTGAGGTTGG - Intergenic
966433478 3:179857242-179857264 GTGGCTTGCTGGGGTGAGATGGG + Intronic
967933750 3:194709925-194709947 GTTGCTTGGGAGGCTGAGATAGG - Intergenic
968285379 3:197505550-197505572 GGGACTTCCGGGGCTGTGATGGG - Intergenic
968979941 4:3841835-3841857 GTGGCGTGGGAGGCTGAGATGGG + Intergenic
969403803 4:6975318-6975340 GTTACTCACGAGGCTGAGATGGG - Intronic
969541369 4:7791739-7791761 TTTGCTTAGGAGGCTGAGATGGG + Intronic
969969151 4:11028164-11028186 GTGACTCAGGGGGCTGAGGTGGG - Intergenic
970559562 4:17269412-17269434 GAGGCTTAGGGGGATGAAATAGG - Intergenic
975049153 4:69838480-69838502 CTGGCTTACGAGGCTAAGGTAGG + Intronic
975788070 4:77915520-77915542 CTGGGTTAAGGAGCTGAGATGGG - Intronic
977468024 4:97406233-97406255 GTGCCTTCCTGGGCTGAGGTAGG + Intronic
978581198 4:110232839-110232861 GTGACTCCCGTGGCTGAGATGGG + Intergenic
979826072 4:125234054-125234076 GGGGCTTGCTGGGCTGAAATTGG - Intergenic
980028132 4:127790987-127791009 GTTGCTCAGGAGGCTGAGATAGG + Intronic
983854182 4:172621299-172621321 GTGCTTTAGGAGGCTGAGATGGG - Intronic
987118812 5:14747446-14747468 GTGGCTTAGGAGGCTGAGGCAGG + Intronic
987227882 5:15862670-15862692 GTGGCTTCATGGGCTGAGTTGGG + Intronic
988512327 5:31875472-31875494 GCGACTTAGGAGGCTGAGATGGG + Intronic
989193893 5:38697007-38697029 GTGGTTGACAGGGCTGAGCTTGG + Intergenic
990206321 5:53433435-53433457 ATGGCTTAGGGGGCTGATAATGG + Intergenic
992557923 5:77921439-77921461 GTGGCTGACTGGGCTCAGCTAGG + Intergenic
994056097 5:95417410-95417432 GTGGTTTAGGGGGCTGACTTGGG + Intronic
994453096 5:99968583-99968605 GTGGCATGCGAGGCTGAGGTGGG + Intergenic
998438444 5:142134943-142134965 GTGCTTTACGAGGCTGATATAGG - Intronic
1003887240 6:10532713-10532735 GTGGCTCACGAGGCTGAGGCAGG - Intronic
1004189873 6:13454700-13454722 GTGGGTTGCGGGGCAGAGAGTGG - Intronic
1004494970 6:16154814-16154836 ATGGCTTCCTGGGCTGGGATGGG - Intergenic
1004726593 6:18316835-18316857 GCTACTTACGGGGCTGAGGTGGG + Intergenic
1008642830 6:53482450-53482472 GTTGCTCAGGAGGCTGAGATGGG + Intergenic
1009956831 6:70465529-70465551 GTGACTCATGGGGCTGAGGTAGG - Intronic
1014314788 6:119850218-119850240 GCTACTTACGGGGCTGAGGTGGG + Intergenic
1015586176 6:134778928-134778950 GCTGCTTAGGGGGCTGAGGTGGG - Intergenic
1016784783 6:147998702-147998724 GTAACTTATGGGGCTGAGACAGG + Intergenic
1017128319 6:151086637-151086659 GTTACTTAGGGGGCTGAGGTGGG - Intronic
1018314121 6:162540339-162540361 GTGGCTTAGGAGGCTGAGGCAGG - Intronic
1018692291 6:166356654-166356676 GTGACTTGGGAGGCTGAGATGGG + Intergenic
1020164658 7:5798350-5798372 GTGCTTTGAGGGGCTGAGATGGG + Intergenic
1020649269 7:10855108-10855130 GTGGCTTATGGGCCTCAGAGGGG - Intergenic
1023487365 7:40701312-40701334 GTGGCTGCCGTGGCTGAGATAGG - Intronic
1024455495 7:49601197-49601219 GCTGCTTAAGAGGCTGAGATGGG - Intergenic
1025261996 7:57425885-57425907 TTGGCTTCCGGTGCTGACATGGG + Intergenic
1025936591 7:66042869-66042891 GCTACTTACGAGGCTGAGATGGG - Intergenic
1025947615 7:66116381-66116403 GCTACTTACGAGGCTGAGATGGG + Intronic
1028221076 7:88197477-88197499 CTGGCTCACTGGGATGAGATGGG - Intronic
1028922227 7:96321658-96321680 GTGCCTGACGGGGCTGAGCCAGG - Intronic
1029183145 7:98719348-98719370 GTGGCTGACAGGGCTGGGCTTGG - Intergenic
1029262607 7:99313434-99313456 GTTACTTAGGAGGCTGAGATGGG - Intergenic
1029876003 7:103752518-103752540 GTTACTTTGGGGGCTGAGATGGG - Intronic
1029983292 7:104898989-104899011 GCTACTTACGGGGCTGAGGTGGG + Intronic
1033082269 7:138309524-138309546 GTTACTTAGGAGGCTGAGATAGG - Intergenic
1034106417 7:148494617-148494639 GCTACTTGCGGGGCTGAGATGGG - Intergenic
1037339334 8:17826028-17826050 GTTGCTTAGGAGGCTGAGACAGG + Intergenic
1039933146 8:42013365-42013387 GTGGCATGCGCGGCTGAGACAGG - Intronic
1041259204 8:56005496-56005518 GTGCCTTCCTGGGCTGAGTTGGG + Intronic
1041800367 8:61791478-61791500 GTGCTTTAAGAGGCTGAGATGGG + Intergenic
1042640445 8:70928289-70928311 GTGCCTTGGAGGGCTGAGATGGG - Intergenic
1044810384 8:96055357-96055379 GAGGCTTATGGGGCTGAGCTTGG - Intergenic
1044818229 8:96134744-96134766 GTGGCTGACTCTGCTGAGATGGG + Intergenic
1046803391 8:118453630-118453652 GTTGCTTGTGGGGCTGAGATAGG - Intronic
1047451622 8:124970043-124970065 GTTACTTAAGAGGCTGAGATGGG + Intergenic
1052835628 9:33248027-33248049 GTGGTTTCATGGGCTGAGATGGG + Intronic
1053136258 9:35652005-35652027 GCTGCTTAGGTGGCTGAGATGGG - Intergenic
1055082099 9:72277476-72277498 GTGACTCAGGAGGCTGAGATTGG + Intergenic
1056080236 9:83085521-83085543 GCTGCTTAGGAGGCTGAGATGGG + Intergenic
1056619512 9:88199857-88199879 GTGGCTCACGGGGCCAAGGTGGG + Intergenic
1056720737 9:89069639-89069661 TTGGCTCAAGGGTCTGAGATGGG + Intronic
1059153429 9:111969191-111969213 GTCCCTTAGGAGGCTGAGATGGG + Intergenic
1059218973 9:112593974-112593996 GTTGCTTAGGAGGCTGAGGTGGG - Intronic
1061206458 9:129166801-129166823 GTGGCTTTGGAGGCTGAGCTTGG + Intergenic
1061527160 9:131175555-131175577 GCTGCCTGCGGGGCTGAGATGGG - Exonic
1062321605 9:135993051-135993073 GGGGCTGTGGGGGCTGAGATGGG + Intergenic
1062657406 9:137611445-137611467 GCTACTTGCGGGGCTGAGATGGG + Intronic
1062696734 9:137879529-137879551 GTGCCCTGCTGGGCTGAGATGGG + Intronic
1187536345 X:20144820-20144842 GTGACTCAGGAGGCTGAGATGGG + Intergenic
1187612086 X:20954029-20954051 CTGGCTCATGGCGCTGAGATTGG - Intergenic
1187950018 X:24462534-24462556 GTTACTTGGGGGGCTGAGATGGG - Intergenic
1192428850 X:71099286-71099308 GTGGCCCAGGGAGCTGAGATTGG - Intronic
1192618761 X:72655299-72655321 GTGACTCAGGGGGCTGAGGTGGG + Intronic
1195891743 X:109702633-109702655 GTTGATTACGGGGCTGAGGCAGG + Intronic
1195956985 X:110341945-110341967 GAGGCTTGGGGGGCTGAGGTGGG + Intronic
1197902703 X:131391122-131391144 GACACTTACTGGGCTGAGATAGG + Intronic
1199602754 X:149552371-149552393 GTGGCTAACGAGGCTGGGAAAGG - Intergenic
1199647635 X:149927104-149927126 GTGGCTAACGAGGCTGGGAAAGG + Intergenic
1200386791 X:155900201-155900223 GTGACTTGTGGGGCAGAGATTGG - Intronic
1202601602 Y:26598764-26598786 GTTACTTAGGAGGCTGAGATGGG + Intergenic