ID: 1084789721

View in Genome Browser
Species Human (GRCh38)
Location 11:71466134-71466156
Sequence AGGTTTTTAAAAATTGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1116
Summary {0: 1, 1: 0, 2: 9, 3: 117, 4: 989}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084789721 Original CRISPR AGGTTTTTAAAAATTGAGAA TGG Intronic
900282173 1:1877507-1877529 ATTTTTTTAAAAATAGAGACAGG + Intronic
900843891 1:5080656-5080678 ATGATTTTAAAAAATGAAAAAGG + Intergenic
900924621 1:5696527-5696549 CTGTTTTTAAAAATTGAGACAGG - Intergenic
901386580 1:8913434-8913456 AAGTTTTTAAAATTTGAGTCAGG + Intergenic
901589512 1:10328503-10328525 ATTTTTATTAAAATTGAGAAAGG + Intronic
902327143 1:15708592-15708614 AAGTTTTTTAAAATAGAGATGGG + Intronic
903109127 1:21114008-21114030 AGATTTAAAAAAATTGAGACAGG - Intronic
903196373 1:21691685-21691707 ATGTTTTTACAAATTCAGAAAGG + Intronic
903204872 1:21773964-21773986 AGTTTTTTAAAAATAGAGATGGG - Intronic
904071604 1:27803062-27803084 AGATTATGAAAAATGGAGAATGG + Intronic
904075740 1:27840809-27840831 AGCTTTTTAAAAAATGAAAATGG - Intronic
904476973 1:30771620-30771642 AGATTGTTAAAAAATCAGAAAGG + Intergenic
904648397 1:31985991-31986013 AAGTTTTTAAAAAATGAGCTGGG - Intergenic
905248887 1:36634983-36635005 AACTATATAAAAATTGAGAAGGG - Intergenic
905878290 1:41447550-41447572 ATGTTCTTAAAAATGGAGATGGG + Intergenic
905908828 1:41639957-41639979 GGGCATTTAAAAATAGAGAATGG + Intronic
907282235 1:53358025-53358047 AAGTTTTTAAAAATCAGGAATGG + Intergenic
907876734 1:58496708-58496730 AGACTTTTAAAAAATCAGAACGG - Intronic
908185991 1:61653985-61654007 AACTTTCTAAAAATTGAGCAAGG + Intergenic
908634253 1:66144933-66144955 TGGTTTTTAAAAGTGGAGATGGG - Intronic
908642939 1:66245376-66245398 AGGTTCTTAAAAAGTGAAGAGGG - Intronic
908787127 1:67746332-67746354 ACTTTTTAAAAAATTAAGAATGG - Intronic
908946365 1:69502747-69502769 GTATTATTAAAAATTGAGAAAGG + Intergenic
908994034 1:70129987-70130009 ATGATTTTAATAATTTAGAAAGG - Intronic
909121414 1:71608965-71608987 AGGTTATCAAAATCTGAGAAAGG + Intronic
909133274 1:71766508-71766530 TGGTTTTTATTAATTGATAAAGG - Intronic
909462285 1:75930739-75930761 AAATTTTTAAAAATTAAAAATGG - Intronic
909661066 1:78082799-78082821 AATTTTTTAAAAATTGGGAGAGG + Intronic
909839326 1:80298720-80298742 ACAATTTTAAAAATTAAGAAAGG - Intergenic
909964079 1:81885921-81885943 AGTTTTTTGAAAATTTAGACAGG + Intronic
909986005 1:82161198-82161220 AGGGTTTTAAAACTGGGGAAGGG - Intergenic
910130967 1:83905254-83905276 ATATTTTTAAAAAGTGAAAATGG - Intronic
910227575 1:84951714-84951736 TGGTTTTTAAAAGTTGAAAAGGG + Intronic
910428316 1:87137680-87137702 AGTTTGTTAAAAATTGGGAAGGG - Intronic
910479274 1:87640657-87640679 TGGTTTTTAAATATAGAGATGGG + Intergenic
910523827 1:88154582-88154604 AGAATTTTAATAATTGAAAATGG - Intergenic
910956239 1:92709448-92709470 CGGTTTTAAAAAGTTCAGAAGGG - Intronic
911252948 1:95599267-95599289 AGGTCTTTAAAAGTGGAGAAGGG + Intergenic
911359559 1:96860136-96860158 AGGTTATTAAATAATGATAAAGG - Intergenic
911375773 1:97049062-97049084 AGGTTCATGAAAATTGTGAAAGG + Intergenic
912553709 1:110500861-110500883 AAGTTTCTAAAAATTTAGATAGG + Intergenic
912631819 1:111252936-111252958 AGGGATTTAAAAATTGACATGGG + Intergenic
912828500 1:112928723-112928745 AGATTTTTAAAAATTGATGTTGG - Intronic
912946202 1:114087076-114087098 AATTTTTTAAAAATAGAGATGGG + Intergenic
914359708 1:146923074-146923096 AGGTATTTGGAAATTGAGACTGG + Intergenic
914437279 1:147670970-147670992 ATTTTTTTAAAAACAGAGAAGGG - Intergenic
914494043 1:148176820-148176842 AGGTATTTGGAAATTGAGACTGG - Intergenic
914721807 1:150295297-150295319 CGCTTTTTAAAAATTGAGACAGG + Intronic
914831250 1:151172534-151172556 AGTTTCTAAAACATTGAGAAAGG + Intronic
915153068 1:153850608-153850630 AATTTTTTAAAAATTAAGTATGG - Intronic
915561061 1:156688356-156688378 ATGTTTTTAAAAATAGAGATAGG + Intergenic
916672158 1:167031563-167031585 GGATTTTTAAAAACTCAGAATGG - Intergenic
916762358 1:167828603-167828625 AGAGTTTTAAAAAATGAAAATGG + Intronic
917155053 1:171988045-171988067 AAGCTTTTAGAATTTGAGAAGGG + Intronic
917241420 1:172952565-172952587 AGGGTTTTGAGAATTGGGAAAGG + Intergenic
917354171 1:174108604-174108626 TGTTTTTTAAAAATTAATAAAGG + Intergenic
917390078 1:174526684-174526706 AAATTTTTAAAAAATGAAAAAGG - Intronic
917568656 1:176238816-176238838 AGAGTTTTAAAAATTGTAAATGG + Intergenic
918175214 1:182037588-182037610 TGGCCTTTAATAATTGAGAAAGG - Intergenic
918510138 1:185303688-185303710 AGGTTTTAAAAAAATGATGAGGG - Intronic
918558952 1:185841244-185841266 AGTTTTTTAAAAATAAAAAATGG + Intronic
918772247 1:188576227-188576249 ATGTTTTTAGAAAGTGAGTAGGG - Intergenic
918908910 1:190539529-190539551 AGATTTTTAAAAAATGAGCATGG + Intergenic
919150671 1:193693638-193693660 AGGTTTTTGAACATTGTCAATGG - Intergenic
919219789 1:194612477-194612499 AGAATTTTAAAAATTAAAAATGG - Intergenic
919405576 1:197178030-197178052 AGACTTTTGAAAATTGAGAATGG + Intronic
919431518 1:197497955-197497977 TGATTTTTAAAATTTGACAATGG - Intergenic
919481120 1:198091286-198091308 AGGATAAAAAAAATTGAGAAAGG + Intergenic
919720549 1:200829380-200829402 AATTTTTTAAAAATAGAGATGGG - Intronic
920000348 1:202793892-202793914 GGGTTTTTAAAAATTGTGCTTGG - Intronic
920018572 1:202935339-202935361 CATTTTTTAAAAATTGAAAATGG + Intergenic
920407221 1:205725051-205725073 ATATTTTTAAAAATAGAGATGGG + Intronic
920770574 1:208881094-208881116 AGGTTTTTGGAAATCTAGAAGGG + Intergenic
920817310 1:209346644-209346666 AGCTTTTTAAGTATTGGGAAGGG - Intergenic
920969288 1:210729135-210729157 AGGAATTTAAAAATGCAGAATGG - Intronic
921310436 1:213837182-213837204 AGTTTTTTAAAAATAGAAAGGGG + Intergenic
921365655 1:214371247-214371269 AAATTTTTAAAAATGGAAAAAGG - Intronic
921524476 1:216200725-216200747 AGGTTTTTAAAAAATAAGATAGG + Intronic
921649985 1:217665853-217665875 AGCTTTCTAAAAATTGAGCTAGG + Intronic
921680292 1:218023196-218023218 AGGTTTTTAAAAGTAAAGAGGGG + Intergenic
921697869 1:218232660-218232682 TTATTTTTAAAAATTGAGACAGG - Intergenic
921809048 1:219491042-219491064 ACGTTTCAAAAAATTGAGGAAGG + Intergenic
921815907 1:219563216-219563238 TGGTTTTTAAAAAGAGACAAGGG + Intergenic
921847284 1:219897661-219897683 GTGTTTTTAAAAACTGTGAAGGG - Intronic
922299460 1:224284020-224284042 ATATTTTTAAAAGTTGATAAGGG + Intronic
922474112 1:225895081-225895103 AATTTTTTAAAAATCAAGAACGG + Intronic
922642478 1:227247316-227247338 ATTTTTTTAAAAATAGAGATAGG - Intronic
923356857 1:233165345-233165367 TGGTTTTTACAATTTGAGGAAGG + Intronic
923513767 1:234676019-234676041 GGATTTTTAAAAAGAGAGAAAGG + Intergenic
923785935 1:237069613-237069635 AGGTTTTAAAAAATTATGAAAGG - Intronic
923791262 1:237113105-237113127 CGGTTTTCATAAATTCAGAAAGG + Intronic
923948381 1:238918413-238918435 ATATTTTTAAAATTTGAGATGGG + Intergenic
924173464 1:241365416-241365438 GGGTCTTTAAAAATTGATCAGGG + Intergenic
924910264 1:248503488-248503510 ATTATTTTAAAAATTGAGAAGGG + Intergenic
924913837 1:248544550-248544572 ATTATTTTAAAAATTGAGAAGGG - Intergenic
1062770656 10:98045-98067 AGGTGTTTAAATAAAGAGAATGG - Intergenic
1062798218 10:360030-360052 ATGTTTTTAAGAATTCAGACTGG + Intronic
1063259148 10:4365242-4365264 AAATATTTACAAATTGAGAATGG + Intergenic
1063346644 10:5318195-5318217 AGGTTTTAAGCAATAGAGAAAGG - Intergenic
1063809175 10:9683172-9683194 AGGTTTTAAAAAAGTGACAAGGG + Intergenic
1064173259 10:13052365-13052387 ATGTTTTTAAATTTTGAGATAGG - Intronic
1064331046 10:14394537-14394559 AGAATTTTAAAAATGGAGGAAGG + Intronic
1065604324 10:27401428-27401450 AGATTTTTAAAAATAGAAAAAGG - Intronic
1065757126 10:28941152-28941174 ATGTTTTTAAAAATTGCTCATGG + Intergenic
1065769902 10:29068616-29068638 TGGGTTTTTAACATTGAGAAGGG + Intergenic
1066283420 10:33940581-33940603 AATTTTTTAAAAATTAAAAATGG - Intergenic
1067027277 10:42855065-42855087 CGGTTTTTAAAAATTTATTAAGG + Intergenic
1067800567 10:49355646-49355668 ATCTTTTTAAAAAGTGGGAAAGG + Intergenic
1068066763 10:52141682-52141704 AGCATATTAAAAATTGAGACTGG - Intronic
1068232420 10:54186166-54186188 AGGCTTTGAAAAAGAGAGAAAGG + Intronic
1068322350 10:55435617-55435639 AAATTTTTAAAAATTAAGAGTGG + Intronic
1068537646 10:58257538-58257560 ACATTTTTAAAATGTGAGAAAGG + Intronic
1068787687 10:60994572-60994594 AACTTTTTAAAAAAAGAGAAGGG - Intronic
1068963216 10:62886282-62886304 AGGTCCTTAAAAATAGAGTAAGG + Intronic
1069258540 10:66364369-66364391 ATTTTTTAAAAAATTGAGATGGG - Intronic
1069279145 10:66632250-66632272 AGTTTTATAAAAATGGGGAATGG + Intronic
1069408894 10:68132183-68132205 AGATTTTTAAAAATCATGAAAGG + Intronic
1069965902 10:72116225-72116247 AGGTTTTTAAAAAAGAAGGAAGG - Intronic
1070338014 10:75472077-75472099 AGGATTTTAAGCATAGAGAATGG - Intronic
1071184881 10:83030938-83030960 AGAATTTTAAATATTGACAAAGG + Intergenic
1071216525 10:83409026-83409048 AGTTTTTTAAAAATATAGAAAGG - Intergenic
1071226439 10:83535472-83535494 AGATTTTTAAAAACTGTGACAGG + Intergenic
1071276195 10:84057772-84057794 AGGTTTTTAAAAAATGATCAAGG - Intergenic
1071314205 10:84377222-84377244 AGTTTTTTAAAAAGTGGTAACGG - Intronic
1071465066 10:85932216-85932238 ACTTTTTTAAAAATTGAGACAGG + Intronic
1071588827 10:86851894-86851916 AGGTTTTTAAGCAGAGAGAATGG + Intronic
1071964311 10:90836515-90836537 ATTTTTTTAAAATTTGAGACAGG + Intronic
1072095540 10:92175598-92175620 AGATATTTAACAACTGAGAAAGG + Intronic
1073285640 10:102386064-102386086 ATATTTTTAAAAATAGAGATGGG - Intergenic
1073710610 10:106033935-106033957 AGATCTTTAAAAATTGATCATGG - Intergenic
1073767624 10:106700550-106700572 AGCTTTTCAAAAATAGAGTATGG - Intronic
1073898983 10:108197207-108197229 GCGTTTTTAAAAAGAGAGAACGG - Intergenic
1073981654 10:109160861-109160883 TTGTCTTCAAAAATTGAGAAAGG - Intergenic
1074173187 10:110965871-110965893 CAGTTTTGAAAAATTGATAAAGG + Intronic
1074319738 10:112391075-112391097 ATTTTTTTAAAAATTGAGGAAGG + Intronic
1074568651 10:114604437-114604459 AGGTTTTTGATAACTGAGCATGG + Intronic
1074592393 10:114825171-114825193 ATTTTTTTAAAAATTGAGTGTGG - Intronic
1074672791 10:115813251-115813273 AAATTTTTAAAAAATGAGAGAGG + Intronic
1074733544 10:116403174-116403196 AGTTTTTTAAAAATTGGAAATGG + Intergenic
1074741684 10:116490977-116490999 TTGTTTTTAAAAAGTGACAAAGG + Intergenic
1074815988 10:117140837-117140859 AGCTTTTTAAAAAATAAAAATGG + Intergenic
1074895120 10:117770735-117770757 AGGTTTTTGACAAATGATAATGG - Intergenic
1074998061 10:118774680-118774702 ACCTTTTTAAAAATTCAGATTGG + Intergenic
1075132477 10:119751800-119751822 AGCTTTTTAAAATTAGAGATGGG + Intronic
1075321088 10:121492284-121492306 AGGATTTTATAAATTGTGTAAGG + Intronic
1075541087 10:123314994-123315016 AGATTTTTCAAAAATGGGAATGG + Intergenic
1076599472 10:131647617-131647639 GAGTTTTTAAAATTTCAGAACGG - Intergenic
1076755287 10:132567446-132567468 AGGTTTTTAAAAGTTGCCCAAGG - Intronic
1077323400 11:1952642-1952664 ATGTTTTTAAAAACTCAAAAAGG - Intronic
1077345238 11:2045380-2045402 TGGATTATAAAAATGGAGAATGG - Intergenic
1077778912 11:5303451-5303473 AGGTTTTTATAAAATAAAAAAGG - Intronic
1078075915 11:8160377-8160399 AGTTTTTTAAAAATCAAGAATGG + Intronic
1078084868 11:8227838-8227860 TGATTTTTAAAAATAGAGATGGG + Intronic
1078167083 11:8896939-8896961 AGGATTTTGAAAACTGAGACTGG + Intronic
1078625435 11:12951658-12951680 AAGTTTTTAAAAATCATGAATGG - Intergenic
1078712628 11:13809540-13809562 AGGTTTCTAAAAAGAGACAAAGG - Intergenic
1078823024 11:14901614-14901636 GTGATTTTAAAAATTGAAAATGG + Intergenic
1078875557 11:15391656-15391678 GGGAATTTAAAAGTTGAGAATGG - Intergenic
1078969576 11:16391907-16391929 AGGTATTTAAATATTGAGGATGG - Intronic
1079312215 11:19377161-19377183 AGATCTTTAAAAAGTTAGAAGGG + Intronic
1079404714 11:20134630-20134652 AGGTTTTTAAAATTAGAGAATGG - Intergenic
1079495340 11:21036849-21036871 ATGTTTTTAAAAATTTAACATGG - Intronic
1079507040 11:21164650-21164672 TGGCTTTTAAAAATAGAGTAAGG + Intronic
1079516878 11:21280244-21280266 TGGTTATAAAAAATGGAGAATGG + Intronic
1079578959 11:22038112-22038134 ATATCTTTAAAAGTTGAGAAAGG - Intergenic
1079706248 11:23623078-23623100 AAGATTTTAAAAATAGGGAAAGG - Intergenic
1079949869 11:26788161-26788183 AGTTCTTAAAAAATTTAGAAAGG - Intergenic
1080285978 11:30612632-30612654 AAATTTTTAAAAATGCAGAAAGG - Intergenic
1080549844 11:33363353-33363375 ATATTTTGAAAAAGTGAGAAAGG + Intergenic
1080857244 11:36122845-36122867 ATTTATTTAAAAATTGAGATAGG - Intronic
1081184526 11:40025837-40025859 GATTTTTTAAAAATTGAGATGGG - Intergenic
1081302296 11:41467365-41467387 AGTTTTTTAAAGGGTGAGAATGG + Intergenic
1081551627 11:44118722-44118744 AGATTTTCATAAATTCAGAAAGG + Intronic
1081926843 11:46837215-46837237 AGGTTTTTCACTATTGTGAATGG + Intronic
1081965627 11:47167477-47167499 AGGGTTTTAAAAAATAAGAAGGG + Intronic
1082226707 11:49716184-49716206 AGTATTTTAAAAATTAATAATGG + Intergenic
1082650882 11:55791291-55791313 TGGCTTTTAAAAAATGAGATGGG - Intergenic
1082908226 11:58336916-58336938 AAGTTTCTAAAAATTAATAAAGG - Intergenic
1082917647 11:58455047-58455069 AGGTTATTATAAAATGATAAAGG + Intergenic
1083344218 11:61978313-61978335 ATTTTTTTAAAAATAGAGACAGG + Intergenic
1083484122 11:62972443-62972465 TTGTGTTTAAAAATTGTGAAAGG - Intronic
1083984606 11:66204968-66204990 AGTTTTTAAAAAATAGAGATGGG - Intronic
1084059776 11:66663633-66663655 TGTTTTTTAAAAATTAAAAAAGG + Intronic
1084680802 11:70665144-70665166 AGTTTTTTAAAATTAGAGACGGG + Intronic
1084757165 11:71246880-71246902 AGATTTTTAGAAATGGAAAAGGG - Intronic
1084789721 11:71466134-71466156 AGGTTTTTAAAAATTGAGAATGG + Intronic
1085195095 11:74665700-74665722 TGTTTTTTAAAAATTATGAAAGG - Intronic
1085592356 11:77775632-77775654 AGGTATTTAAAACTTGAGCAGGG + Intronic
1085725087 11:78948069-78948091 AGATTTTTCAAAATAGAAAATGG - Intronic
1086321268 11:85650349-85650371 AGGTGTTTTTAAATTAAGAAGGG - Intronic
1086362815 11:86076737-86076759 AGGTTTTCAAAACTGGACAATGG - Intergenic
1086498354 11:87426750-87426772 TGGTTGTTAAAAGTTGGGAAGGG + Intergenic
1086602549 11:88652297-88652319 AAGTTTGTAAAAATTGACAAAGG - Intronic
1086622718 11:88906897-88906919 AGTATTTAAAAAATTGATAATGG - Intronic
1087917447 11:103827503-103827525 AGATTTTTAAAAAAGGAGGAGGG + Intergenic
1088207549 11:107411733-107411755 AGGTTTTTAAAATATCCGAAGGG - Intronic
1088782679 11:113151304-113151326 TGGCTTTTGAAAATTGACAAGGG - Intronic
1089000583 11:115048807-115048829 AGATTTTTAAAAATTTAGCTGGG + Intergenic
1089048456 11:115524919-115524941 AGCTCTTTTAAAATGGAGAATGG + Intergenic
1089427285 11:118389118-118389140 ATCTTTTTAAAAAATGAGATGGG - Intronic
1089785867 11:120906731-120906753 AGGTGTTTAAGAACTGAGGAGGG + Intronic
1090061425 11:123467309-123467331 ATTTTTTAAAAAATTGAGACAGG - Intergenic
1090416738 11:126545595-126545617 TTATTTTTAAAAATTGAGACAGG - Intronic
1090517451 11:127444170-127444192 AGGTTTTTAAAATCAGAGATAGG + Intergenic
1091019246 11:132083901-132083923 AAGTCTTTAATAATTGAGTAAGG - Intronic
1202806388 11_KI270721v1_random:7837-7859 ATGTTTTTAAAAACTCAAAAAGG - Intergenic
1091430431 12:429049-429071 AGGTTTCTAAACATTGAAATGGG - Intronic
1091734529 12:2908726-2908748 AAGTTTTTAAATGTTCAGAAGGG + Intronic
1091903392 12:4163861-4163883 TGGATTTTAAAAATAGAGACAGG + Intergenic
1092377498 12:7967975-7967997 AGTTTTTTAAAGATAGAGATTGG + Intergenic
1092582986 12:9866799-9866821 ATGTTTCTGAAAATTGTGAAGGG + Intronic
1092634586 12:10428976-10428998 ACATTTTAAAAAATTGATAAGGG + Intronic
1092635632 12:10444398-10444420 ACATTTTAAAAAATTGATAAGGG + Intronic
1092683189 12:11011970-11011992 AAGTTTATAAATATTGAAAATGG - Intronic
1092760974 12:11810962-11810984 AGGTGTTTAAAAATTGGAATTGG - Intronic
1094125635 12:27020009-27020031 AGTTATTTAAAAATTGCTAAAGG + Intergenic
1094406101 12:30117870-30117892 AGTTCGTTAAAAATTGATAATGG - Intergenic
1094696304 12:32822433-32822455 AGTTTTTGAAAGAATGAGAAAGG - Intronic
1095040935 12:37439956-37439978 TCATTTTTAAAAATTGAGATGGG - Intergenic
1095051951 12:37562390-37562412 TGGTTTTTAAAAATAGAGATGGG - Intergenic
1095211681 12:39501697-39501719 GGGTTTTTAAAAATTCATATAGG - Intergenic
1095377920 12:41553417-41553439 ATGTTTTTAAAAATTAAGGCTGG + Intronic
1095540342 12:43302600-43302622 AAATATTTAAAAATTGACAAAGG + Intergenic
1096379355 12:51142582-51142604 AGGTTCTTGAGAATTGAGAAGGG - Intronic
1096703552 12:53403732-53403754 ATGCTTTGAAAATTTGAGAAAGG + Intronic
1096705315 12:53417585-53417607 AGGTTTTTTAAAATGGGGGAAGG - Intergenic
1096967449 12:55639547-55639569 AGGTAATTATAAATTTAGAAAGG + Intergenic
1096998059 12:55851984-55852006 ATTTTTTTAAAATTTGAGACAGG + Intergenic
1097705605 12:62865527-62865549 AGATTTTAAAAAAATGACAAAGG - Intronic
1097754568 12:63395392-63395414 AGGTTTTTAAAAGATTAGACAGG + Intergenic
1097840512 12:64317131-64317153 AGCCATTTAAAAATTTAGAAAGG + Intronic
1098881668 12:75923808-75923830 AGGTTGTTATAAATGGAAAATGG - Intergenic
1098903451 12:76136943-76136965 AAATTTTAAAAAATTAAGAAAGG + Intergenic
1099222212 12:79928462-79928484 AGGTTTTTAAAAATGGATTTAGG + Intronic
1099594394 12:84640911-84640933 AGGTTTTTAAACAATGTTAATGG - Intergenic
1099942419 12:89204358-89204380 AGTTTCCTAAAAAGTGAGAAAGG + Intergenic
1099985172 12:89653682-89653704 TGGTTTTTAAAATTTGAGAAGGG - Intronic
1100438009 12:94589539-94589561 GAGTTTTTAACAATTAAGAAAGG - Intronic
1100514922 12:95318117-95318139 AGGAATTTAAACATTGAGGATGG - Intergenic
1100515020 12:95319216-95319238 AAATTTTTAAAAATTAAAAATGG + Intergenic
1100525404 12:95414828-95414850 AATTTTTCAAAAATTTAGAAAGG - Intergenic
1100639626 12:96470182-96470204 AATTTTTTAAAAATTCAGATTGG + Intergenic
1100857544 12:98771477-98771499 CTTTTTTTAAAAATTGAGACAGG + Intronic
1101069266 12:101056775-101056797 AGGGTTTTAAAAATCATGAATGG + Intronic
1101243744 12:102864517-102864539 TGCTTTTTAAAAATTGACCAAGG - Intronic
1101410581 12:104464486-104464508 AAATTTTAAAAAATTGAAAAAGG - Intronic
1101947286 12:109147113-109147135 AGATTTTTTAAATGTGAGAAAGG - Intronic
1102032317 12:109748069-109748091 AGGATTTTAAAAATCAAGAATGG + Intronic
1102143339 12:110635346-110635368 TGGTTTTTAATCATTGAAAAAGG - Intronic
1102267876 12:111503889-111503911 TGGTTTTTAAAAAATGAGAGTGG - Intronic
1102666086 12:114574126-114574148 AGTTTTTTTAAAAATCAGAATGG - Intergenic
1102673187 12:114637432-114637454 AGTGTTTTAGAAATTGACAAAGG + Intergenic
1103171769 12:118826738-118826760 TGATTTTTAAAAATAGAGATGGG - Intergenic
1103693687 12:122796723-122796745 ATATTTTTAAAAATAGAGATGGG - Intronic
1104152544 12:126097382-126097404 AACATTTAAAAAATTGAGAAGGG + Intergenic
1104264123 12:127214835-127214857 ATATTTTTAAAATGTGAGAATGG + Intergenic
1104624642 12:130340974-130340996 AGGTTTTTAAAATTGAAAAATGG + Intronic
1105281785 13:18968152-18968174 AGAGTTTTTAAAATTGAGCACGG - Intergenic
1106536832 13:30652406-30652428 AGCTATTTAAATATTGGGAAAGG + Intronic
1106595812 13:31135277-31135299 AGATTTTTAAAAACTGTGAATGG - Exonic
1106717073 13:32401743-32401765 TGGTTATTAAAAATTGTAAATGG - Exonic
1106828847 13:33556268-33556290 AAATTTTAAAAAAGTGAGAAAGG - Intergenic
1107158897 13:37202211-37202233 AGGTTTTTAATAATACAGATGGG + Intergenic
1107351289 13:39517698-39517720 AATTTTTTAAAAATTGAGATAGG + Intronic
1107374793 13:39791248-39791270 AAGATTTTAAAAATCTAGAATGG + Intronic
1107375705 13:39801967-39801989 AGGATTGTAAAAATTGCGGAAGG + Intergenic
1107700009 13:43037592-43037614 AGGTTATTAAAAAAAGAAAAAGG - Intronic
1107856312 13:44618622-44618644 AACTTTTTAAAAATAGAGATGGG + Intergenic
1107884123 13:44860256-44860278 AGGTTTTTATCAATTTGGAAGGG - Intergenic
1108429231 13:50337266-50337288 CAATTTTTAAAAATTGATAATGG - Intronic
1108780552 13:53825940-53825962 ATGGTTTTAAAATTTGAAAATGG + Intergenic
1108822771 13:54374160-54374182 ACATTTTTAAAAATTAAAAATGG + Intergenic
1108833162 13:54504747-54504769 TGGATTTTTAAAAATGAGAATGG - Intergenic
1108835390 13:54539904-54539926 AGGTGTTACAAAATTTAGAATGG + Intergenic
1108929292 13:55795401-55795423 ATGGTTTGAAAAAGTGAGAAAGG + Intergenic
1109008986 13:56915120-56915142 AGATTTTTAAAATCTGAGACAGG - Intergenic
1109198147 13:59401886-59401908 AGGATTTTAAAAAATAAAAATGG - Intergenic
1109598896 13:64596804-64596826 GGATTTTTAAAAATTGATAGAGG - Intergenic
1109690395 13:65880671-65880693 ATGTTATTAAAAAATGAGAAAGG - Intergenic
1109752311 13:66710762-66710784 AGGCTTTAAAAAAATGAAAAAGG - Intronic
1109932456 13:69233906-69233928 AGATTTTTAAAAAATGAACAAGG - Intergenic
1110074752 13:71225928-71225950 AGATGTTTATAATTTGAGAAAGG - Intergenic
1110212710 13:72992018-72992040 AGTTTTAAAAAAATTGAGACGGG - Intronic
1110244101 13:73301994-73302016 AGGTTTTTAACAATATAGTATGG + Intergenic
1110596188 13:77323138-77323160 AGTTTTTTAAATATGTAGAATGG - Intronic
1110656862 13:78010588-78010610 AATTTTTTAAAAATTAACAATGG + Intergenic
1110803544 13:79728440-79728462 AGGTTGATAAAAATTTAAAATGG - Intergenic
1110887452 13:80656873-80656895 AGTTTTCTAAAAAGTGAGAAAGG - Intergenic
1110899761 13:80806790-80806812 AAATTTTTAAAAATTAAAAATGG + Intergenic
1111655369 13:91145101-91145123 ATTTTTTTAAAAATTAATAATGG + Intergenic
1111710608 13:91808151-91808173 AGGTTTTTAAACTTTTACAATGG - Intronic
1112002056 13:95219810-95219832 AGATTTTTAAAAAATGATGATGG - Intronic
1112381349 13:98893763-98893785 AGATTTTTAAAAAATGAAAAAGG + Intronic
1112407491 13:99134249-99134271 AAGATTTTAAAAAATGAGACTGG + Intergenic
1112711160 13:102130447-102130469 AGGTCTTTAAAATTGGAGAAGGG - Intronic
1112788446 13:102977560-102977582 ATGTACTTAAAAATTGTGAATGG + Intergenic
1113040920 13:106103135-106103157 ATGTTTTTAAAAATAGACAGTGG - Intergenic
1113513873 13:110875816-110875838 TGGTTTTTTTAAATTGAGACGGG - Intergenic
1114258398 14:21021145-21021167 TGGCTCTTGAAAATTGAGAATGG - Intronic
1114377981 14:22169774-22169796 ATGTTGATAAGAATTGAGAATGG + Intergenic
1114509385 14:23244821-23244843 AGGTTATTGAAAAGTGAGAATGG - Intronic
1114783493 14:25567603-25567625 AGGTTTTTATATAATGATAAAGG - Intergenic
1114839458 14:26246496-26246518 CAGTTTTTAAAAACTGATAAAGG - Intergenic
1115016229 14:28617623-28617645 AGGATTTTAAAAACTTAAAATGG - Intergenic
1115167324 14:30463675-30463697 TGATTTTTAAAAATGGAGATGGG - Intergenic
1115787969 14:36847660-36847682 AGGTTCCTAGAATTTGAGAAGGG + Intronic
1116075909 14:40110620-40110642 AAGTTTTTAAAAAATGATTATGG + Intergenic
1116483753 14:45421753-45421775 AGGTTTAAACAAATTGTGAAAGG + Intergenic
1116876510 14:50117126-50117148 AGTCTTTTAAAAATTAAGACTGG + Exonic
1116886102 14:50223376-50223398 AGTTTTTTAAAAATTGGGGCTGG + Intronic
1117190095 14:53280888-53280910 AGGTTTTGAAAATTGGGGAAAGG + Intergenic
1117251013 14:53937562-53937584 AGTTTTTTAATATTTGAGAATGG - Intergenic
1117307715 14:54492693-54492715 CGGCTTTTAACAATTGAGTAAGG - Intergenic
1117321714 14:54630505-54630527 CTGATTTTAAAAATTGGGAAAGG - Intronic
1117535983 14:56703932-56703954 AGCCTTTTAAAAATTGAGCTAGG + Intronic
1117542746 14:56764276-56764298 ACGTTTTTTAAAAATGAGGAGGG - Intergenic
1117567669 14:57011765-57011787 ATGTTTTTAAAAATTAAAATAGG + Intergenic
1117659519 14:57988834-57988856 AGGTTTTTAAAATTTGGAGAGGG + Intergenic
1117885733 14:60360394-60360416 AGGTTTTTAACAAATGAAAAGGG - Intergenic
1117995337 14:61472686-61472708 GGTTTTTAAAAAATTGAGACAGG - Intronic
1117998884 14:61504593-61504615 GTGTTTTTACAAATTGAGAGGGG + Intronic
1118089334 14:62455833-62455855 AGGTGTTTAAAATTAGAAAAAGG + Intergenic
1118131280 14:62966846-62966868 AGGTTTTTAAAAACAGGGAGTGG - Intronic
1119560672 14:75586878-75586900 AGGTTTTAAAAAATTGTGCCAGG + Intronic
1120392512 14:83926297-83926319 ATTTTTTTAAAAAATGAGCAAGG + Intergenic
1120546303 14:85815857-85815879 ATGTCATTAAAAATTGAGTAGGG - Intergenic
1120584082 14:86289310-86289332 AGGTTTGTAAATATTAAGACAGG + Intergenic
1120656979 14:87202382-87202404 AGGTTTTTAATAAATGAATAAGG - Intergenic
1120665665 14:87303739-87303761 AGGTGTTTAAGAATTTAGATTGG + Intergenic
1120756370 14:88248182-88248204 AGTTTTTTAAAAATAGAAATTGG - Intronic
1120916917 14:89718601-89718623 AGGTTTTTTAAATTTGTGGAGGG - Intergenic
1120961454 14:90128790-90128812 AGATTTTTAAAAAAGGGGAATGG - Intronic
1121062271 14:90923834-90923856 AGAATTTTAAAAATTCAAAAGGG + Intronic
1121369500 14:93344240-93344262 TGCTTTTTAAAAATTAAAAATGG + Intronic
1121487974 14:94333590-94333612 TGATTTTTAAAAATGGACAAAGG - Intergenic
1121490693 14:94357399-94357421 TGCATTTAAAAAATTGAGAATGG + Intergenic
1121557016 14:94845859-94845881 TTATTTTTAAAAATTGAGACCGG - Intergenic
1121660169 14:95629155-95629177 AGGGTCCTAAAAATTGAAAAGGG - Intergenic
1121762080 14:96454481-96454503 ACTTTTTTAAAAATTGAGACAGG + Intronic
1122964177 14:105113624-105113646 ACATTTTTAAAAATTAAAAATGG + Intergenic
1123753425 15:23376891-23376913 AGGTTTTTAAACTTTTACAATGG + Intergenic
1124157985 15:27244943-27244965 AGGTTTTTAAAAATTTCCACGGG + Intronic
1124396344 15:29305364-29305386 AGGTTTTTAAAAGTTCATCATGG + Intronic
1125209555 15:37197383-37197405 TGGTCTTTGAAAATGGAGAAAGG - Intergenic
1125987857 15:44072956-44072978 CATTTTTTAAAAATTGAGATGGG - Intronic
1126417811 15:48436620-48436642 AATTTTTTAAAAATTGTTAATGG - Intronic
1126575807 15:50195160-50195182 AGCTTTTAAAAAATTGACAGTGG + Intronic
1126727789 15:51650410-51650432 ACATTTTTAGAAATAGAGAAAGG + Intergenic
1127132928 15:55886464-55886486 ACGTTTTAAAAAATTGAAATGGG + Intronic
1127416943 15:58767471-58767493 AGGTTTTGAAAAATGGTGAAGGG + Intergenic
1127445421 15:59057539-59057561 TGGTTGCTTAAAATTGAGAACGG - Intronic
1127755830 15:62091029-62091051 GGGTTTTTAAATATTGAGTCTGG + Intergenic
1128040838 15:64572067-64572089 AGGTATGCAAAAGTTGAGAAAGG + Intronic
1128834056 15:70794897-70794919 AGTTCTTTAACAATTGAGAGGGG + Intergenic
1128865279 15:71110505-71110527 ATTTTATTAACAATTGAGAAAGG - Exonic
1129142869 15:73617328-73617350 GGATTTTTAAAAATTATGAAAGG - Intronic
1129695644 15:77739369-77739391 AGCTTTTAAAAAATTTAAAAGGG + Intronic
1130250466 15:82297209-82297231 AGTTTTTTTAAAATAGAGATGGG - Intergenic
1130634101 15:85599862-85599884 ATTTTTTTAAAAATAGAGATGGG - Intronic
1130685477 15:86033417-86033439 ATCTTTTTAAAAATTGAGGCCGG + Intergenic
1130840129 15:87691496-87691518 AGTTTTTTAAAAATGGGCAAAGG + Intergenic
1131355618 15:91743201-91743223 GGGCTTTGAAAAATTGAGACTGG - Intergenic
1131867350 15:96725293-96725315 AGGTTTACTAAAATTGAAAAAGG - Intergenic
1132102946 15:99040049-99040071 AGCTTTTGAAAAATGGAGAGAGG + Intergenic
1132165007 15:99578205-99578227 AGAATTTTAATAAATGAGAAAGG - Intronic
1132256884 15:100383894-100383916 AGGTTTTTAAAGAGAGAGAGGGG - Intergenic
1132258440 15:100399584-100399606 AGATTTTTAAAAATCGAGCCTGG + Intergenic
1132460470 16:51438-51460 AGGTTTCTAAAAATAGAAAATGG - Intronic
1132507393 16:318238-318260 AGGTTTTCCAAAAATGTGAAAGG - Intronic
1133897717 16:9945149-9945171 AAATTTTTAAAATTTGAGATGGG - Intronic
1135275482 16:21108735-21108757 ACTTTTTAAAAAATTGAGACAGG - Intronic
1135459025 16:22625028-22625050 AGATTTTAAATAACTGAGAAAGG - Intergenic
1136053411 16:27669856-27669878 AAGTTTTTAAAAATAGAGTTGGG + Intronic
1137882274 16:52062485-52062507 AGGGGTTTAAAAATGGAAAAGGG - Intronic
1138032024 16:53566935-53566957 CATTTTTTAAAAATTGAGACAGG - Intergenic
1138101662 16:54256776-54256798 ATTTTTTTAAAAATTGAGGCAGG + Intronic
1138954821 16:61958480-61958502 AGGCTTTGACAAATTGACAAGGG - Intronic
1139162014 16:64521391-64521413 AATTTTTTAAAAATTGCTAAGGG - Intergenic
1139183930 16:64781032-64781054 AGGTTTTAACAAATTGTGATGGG - Intergenic
1139815841 16:69671100-69671122 AGGTTTTTAAAAATACACAAAGG - Intronic
1139894585 16:70278205-70278227 ATTTTTATAAAAATAGAGAAGGG - Intronic
1140226228 16:73079508-73079530 AATTTTTTAAAAATAGAGATGGG + Intergenic
1140732819 16:77871732-77871754 AAGTTTTTAATCATTGAGACTGG - Intronic
1141014623 16:80437462-80437484 AGGTTCTTAAAAACGGAAAAAGG + Intergenic
1141137803 16:81478031-81478053 AGGATTTTTATTATTGAGAAGGG + Intronic
1142899808 17:3004807-3004829 AGGTGTTTAAAAATACAGACTGG - Intronic
1143237688 17:5417486-5417508 ACGTTTTTAAAAAATGACAAGGG + Intronic
1143534865 17:7531827-7531849 TGCTTTTTTAAAATTGAGATAGG - Intergenic
1143981831 17:10876746-10876768 AGCTCTTCAAAAATTGAGAAAGG - Intergenic
1144380900 17:14697011-14697033 AGGATTTTAAAATTTAAAAATGG + Intergenic
1144466326 17:15500391-15500413 CAGTTTTTAAAAAATCAGAATGG - Intronic
1144547316 17:16209547-16209569 AATTTTTTAAAAATAGAGATGGG - Intronic
1144594237 17:16553551-16553573 TGGTCTTTAAAACTTGGGAAAGG + Intronic
1145086293 17:19944014-19944036 AGGTGTTAAATATTTGAGAAAGG - Intronic
1145299059 17:21617804-21617826 AACTTTTTAAAAATAGAGATAGG + Intergenic
1146794218 17:35769891-35769913 AGGTTTTTCAGATTTGAGGAGGG + Intronic
1146959750 17:36964003-36964025 TAATTTTTAAAAATTGAGACAGG - Intronic
1147235572 17:39055056-39055078 GGGTTTTTAAAGACTGGGAAGGG + Intergenic
1147244680 17:39112064-39112086 ATTTTTTTAAAAATTGAGATAGG - Intronic
1147493081 17:40889556-40889578 AGTTTTTTAAATGTTGAAAATGG - Intergenic
1148180995 17:45604716-45604738 AATTTTTTTAAAATTGAGATGGG + Intergenic
1148249732 17:46066014-46066036 AAGTATTTAAAAATTAAGCATGG - Intronic
1148255292 17:46125805-46125827 GGGGTTTTAAAGCTTGAGAATGG - Intronic
1148267913 17:46241203-46241225 AATTTTTTTAAAATTGAGATGGG - Intergenic
1148659663 17:49319080-49319102 AGCTTTTTAAAAATTAATATTGG - Intronic
1149132745 17:53325740-53325762 AGGTGTTTAAATATTTATAATGG - Intergenic
1149337551 17:55651956-55651978 AGGTTCTGACAGATTGAGAAAGG + Intergenic
1150322242 17:64224919-64224941 AGGTTTATAAAAAATAATAATGG + Intronic
1150924446 17:69517852-69517874 AGTTTTGTAAAAATTAAAAATGG - Intronic
1151124360 17:71828659-71828681 AGACTTTTAAAAAATGAGAGTGG - Intergenic
1151130035 17:71886999-71887021 AGTATTTTAAACAATGAGAAAGG + Intergenic
1151145734 17:72039172-72039194 AAGTTTTTGAAAATTGTGAGGGG + Intergenic
1151374465 17:73676429-73676451 ATTTTTTTTAAAATCGAGAATGG - Intergenic
1151502110 17:74497166-74497188 AAATTTTTAAAAAATCAGAATGG - Intergenic
1152413595 17:80144453-80144475 GGTTTTTTAAAAATAGAGATTGG - Intronic
1152932528 17:83117203-83117225 AGTTTTTGAAAAATAGAGATGGG + Intergenic
1153046405 18:859250-859272 ATCTTTTTAAAAATAGAGACAGG + Intergenic
1153406488 18:4746586-4746608 AGCATGTTAAAAATTGAGATAGG - Intergenic
1153555001 18:6303012-6303034 ATGTACTTAAAAATTGGGAACGG + Intronic
1153583094 18:6594910-6594932 AGATTTTTAAATGTTGAGCATGG - Intergenic
1153623836 18:7004816-7004838 AGGATTTGAAAAACTGAGGATGG + Intronic
1153711208 18:7801274-7801296 AAATTTTTAAAAATTGAAAAAGG - Intronic
1153725556 18:7950782-7950804 ACATTTTTAAAAAGTCAGAAAGG - Intronic
1153861738 18:9217691-9217713 AGGTTTGTACAAATTGCCAAAGG - Intronic
1154059776 18:11048241-11048263 ACTTTTTAAAAAATGGAGAAAGG + Intronic
1154183311 18:12156775-12156797 ATGTTTTTAAAAATTAATATAGG - Intergenic
1154936903 18:21069152-21069174 AGATATTTTAAAATTGTGAATGG + Intronic
1155301572 18:24434036-24434058 AGGTTTTTAAAAATTAAACATGG + Intronic
1155478917 18:26264101-26264123 AGGTTTTTAAAAGCAGAAAAAGG + Intronic
1155612879 18:27687329-27687351 AAGCTCTTAAAAATTAAGAATGG + Intergenic
1156507695 18:37608860-37608882 AATTTATTAAAAATTGATAAAGG - Intergenic
1156807113 18:41197879-41197901 AGATTCTTATAAATTGAGTAAGG + Intergenic
1156871502 18:41951048-41951070 AGATTTTTAAAAAATGAAAGTGG + Intergenic
1157872078 18:51239366-51239388 AGGTTTTTGAACATTGTCAAAGG - Intergenic
1158016198 18:52787062-52787084 AAGCTTTTAATAATTGAGTAAGG - Intronic
1158641115 18:59204853-59204875 TGGTCTTTAATAATTGAGTAAGG + Intergenic
1158988371 18:62842696-62842718 TGGTTTTTAAAATTGGAGAAGGG - Intronic
1159100504 18:63952814-63952836 ATGTTTTTATAAATGGAGGAAGG - Intronic
1159168414 18:64731472-64731494 AGGTTTTCAGGAATAGAGAAAGG - Intergenic
1159361966 18:67416998-67417020 AGCATTTTAAAAATTTAGAGAGG + Intergenic
1159446572 18:68548006-68548028 AGGTTAAAAAAAATTGACAATGG - Intergenic
1159882537 18:73872670-73872692 AGATTTTTAAAAAGTGAGATGGG + Intergenic
1160055780 18:75478796-75478818 AGATTTTTAGACTTTGAGAAAGG - Intergenic
1161141210 19:2649105-2649127 AATTTTTTAAAAATAGAGACAGG + Intronic
1161763771 19:6194502-6194524 AGTTTTTTAAAAATAGAGACAGG + Intronic
1161763892 19:6195768-6195790 AATTTTTTAAAAATAGAGACAGG + Intronic
1161964894 19:7542493-7542515 AGATTTTTAAAAAATGAGCCAGG - Intronic
1162205330 19:9051593-9051615 ATGTATTTAAACATAGAGAAAGG + Intergenic
1162207023 19:9063814-9063836 ATTTTTATAAAAATAGAGAAAGG - Intergenic
1162402657 19:10455153-10455175 AGGCTTTTTAAAGTTTAGAAGGG - Intronic
1163983561 19:20923908-20923930 GTATTTTTAAAAATTGAGACGGG - Intronic
1165344327 19:35234644-35234666 AGTTAGCTAAAAATTGAGAAGGG - Intergenic
1165571992 19:36783173-36783195 TTGTTTTTAAAAATAGAGATGGG + Intergenic
1166614093 19:44227555-44227577 TTATTTTTAAAAATTGAGACAGG + Intronic
1167017633 19:46851224-46851246 ATTTTTTTAAAAATAGAGACAGG + Intergenic
1167574490 19:50311553-50311575 CTTTTTTAAAAAATTGAGAAAGG + Intergenic
1167864242 19:52311310-52311332 ATATTTTAAAAAATTGAGATGGG - Intronic
1168700427 19:58435775-58435797 ATTTTTTTAAAATTTGAGATGGG + Intronic
925115504 2:1375106-1375128 AAGTTTTTAAAATTTAAAAAGGG + Intronic
925368577 2:3327481-3327503 ATTTTTTTAAAAATGGAAAAGGG - Intronic
926173629 2:10569841-10569863 GGGGTTTTAAAAATTTAGAGAGG - Intergenic
926400945 2:12495944-12495966 AGGTTTTTAAAAATGGCCACAGG - Intergenic
926825348 2:16900842-16900864 AGGTTTTTAATAATAGAAACAGG + Intergenic
926936409 2:18090127-18090149 AGGGTTTTTCAAATTCAGAATGG - Intronic
927590764 2:24355891-24355913 AATTTTTTAAAAATAGAGACAGG - Intronic
928350286 2:30546160-30546182 ATGTCTTGAAAAACTGAGAATGG - Intronic
928550203 2:32362846-32362868 AGGTGTTTAAAAATTTAGACAGG - Intronic
928592219 2:32828782-32828804 ATATTTTTAAAGATTGATAAAGG + Intergenic
928845529 2:35667152-35667174 AGGTTTTTCAAATTTCTGAATGG + Intergenic
928865646 2:35914823-35914845 ACTTTTTTAAAAATTTAGAGAGG + Intergenic
928876146 2:36042254-36042276 AGGTTTTTAAAATTGCAGATGGG + Intergenic
929389790 2:41456950-41456972 AACTTTTTAATAATTGGGAAGGG - Intergenic
929436617 2:41933504-41933526 AGGTTTTTAAGAAAGGATAAAGG - Intergenic
929503268 2:42508247-42508269 AGATTTTTAAAAATAGGGTAAGG - Intronic
930259007 2:49123479-49123501 ATTTTTTTAAAATTTGAGACAGG - Intronic
930314998 2:49786592-49786614 AGGTATTGAAAACTAGAGAAAGG - Intergenic
930464102 2:51723012-51723034 AGATTTGTAAAAATTGAATATGG + Intergenic
930558654 2:52931152-52931174 TGATTTTTAAAAATAGAAAAAGG + Intergenic
930665764 2:54096879-54096901 TGTTTTTTAAAAATAGAGACGGG + Intronic
930956019 2:57203997-57204019 ACATTTTTTAAAAATGAGAATGG + Intergenic
931056068 2:58472830-58472852 TGGTTTTTAAAAGTAGAGGAAGG - Intergenic
931136502 2:59408163-59408185 AAGATTTTAAAAATGGACAAGGG + Intergenic
931414140 2:62064777-62064799 AAACTTTTAAAAATTTAGAAAGG - Intronic
931586105 2:63830851-63830873 AGTTTTTTAAACCATGAGAATGG - Intergenic
931656662 2:64515440-64515462 AGGATTTTAAAGATGTAGAAAGG - Intergenic
931745199 2:65285878-65285900 TGCTTTTTAAAAATAGAGATGGG + Intergenic
932334049 2:70919508-70919530 TTGTTTTTAAAAAATGAGATGGG - Intronic
932542986 2:72676156-72676178 AGGTTTTCAACTTTTGAGAAGGG + Intronic
932615265 2:73227442-73227464 TGGTTTTTAAATTTTGAGACAGG + Intergenic
932842025 2:75092262-75092284 AGGTTTTTAAAATTGGGGGAGGG - Intronic
933342834 2:81044373-81044395 AGGATTTCAGAAATTGGGAAGGG + Intergenic
933401191 2:81797656-81797678 AGGCTTGTACAAATTGAGTATGG + Intergenic
933577419 2:84085444-84085466 AGGTTTTTTAAAAAAGAGATGGG + Intergenic
933732090 2:85464658-85464680 ACATTTTTAAAAATTAAAAAGGG - Intergenic
934058770 2:88274754-88274776 AGGTTTTTAAAAGAAAAGAAGGG + Intergenic
934996032 2:98961398-98961420 AGCTTTTTAAAAAATAAAAAAGG - Intergenic
935016334 2:99186095-99186117 AGTTTTTTAATACTAGAGAAGGG + Intronic
935636918 2:105256103-105256125 AGTTTTTTAAAACATAAGAAAGG - Intergenic
935941224 2:108241412-108241434 TGGCTTTTAATAATTGAGTAAGG - Intergenic
935971100 2:108531693-108531715 AAGTTTTTTAAAATTGAAAATGG - Intergenic
936272962 2:111065668-111065690 AGGTTTTTAAAAATCCAGTTAGG + Intronic
936406630 2:112210346-112210368 AGGTTGTTAAAAATAAGGAAAGG + Intergenic
936485471 2:112921832-112921854 AGATTTTTATAAATGAAGAAAGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936680513 2:114765167-114765189 CAATTTTTAAAAATTGATAATGG - Intronic
936746181 2:115579335-115579357 AGGTTTTCAATAAATGAGACAGG - Intronic
936794726 2:116191215-116191237 AGGTTGTTATAAAATGATAAAGG - Intergenic
936846918 2:116846364-116846386 ATGTTTTTAAAAAATTAGCAGGG + Intergenic
936938870 2:117862471-117862493 CAGTTTTTCAAAGTTGAGAAGGG + Intergenic
937022490 2:118670939-118670961 AGGTTTTTAATGATTGAAAAAGG + Intergenic
937147754 2:119661888-119661910 AATTTTTAAAAAATTGAGACAGG - Intronic
937190447 2:120091985-120092007 ATGTTTTTAAAAATTCCTAAGGG - Intronic
937557643 2:123179373-123179395 CTATCTTTAAAAATTGAGAAAGG + Intergenic
937567790 2:123316323-123316345 GGGTTTTGAAAAATACAGAAAGG + Intergenic
937610215 2:123852239-123852261 AGTAGTTTTAAAATTGAGAAAGG - Intergenic
937661781 2:124438272-124438294 AGATGTGTAAAAAGTGAGAAAGG - Intronic
937723875 2:125136000-125136022 GGATTTTTAAAAAATGAGATAGG - Intergenic
937759433 2:125582619-125582641 AGTTCTTTCAACATTGAGAAGGG - Intergenic
938672039 2:133595885-133595907 TGATTTTTAAAAATTGTAAAAGG - Intergenic
939152875 2:138493932-138493954 AGTTTTTTTAAAATAGAAAATGG + Intergenic
939672880 2:145035232-145035254 ATGTTTTGGAAAATTCAGAATGG + Intergenic
939686146 2:145203116-145203138 AGTTTGTGAAAAATTGAAAATGG + Intergenic
939907709 2:147938158-147938180 AGGTTTTTCAAAATTATAAACGG + Exonic
940187191 2:150998878-150998900 AGCTTTTTAAAGATTTAAAAAGG - Intergenic
940213445 2:151279865-151279887 AGGTTTATAAAAAATGAGAAGGG + Intronic
940376154 2:152961269-152961291 ATGGTTTTATAAAATGAGAATGG + Intergenic
940630094 2:156227648-156227670 AGGTTTTAAAAAATTATTAATGG - Intergenic
940863746 2:158796246-158796268 ATGTTTTTGTAAATGGAGAAAGG - Intronic
941291746 2:163684358-163684380 AGGATTTTAAAAATGCAAAAAGG - Intronic
941443588 2:165570494-165570516 AAGTTTTTAGAAAGTGAGAGTGG - Intronic
941472191 2:165901692-165901714 AGGTATTTAAAATTTTATAAAGG + Intronic
942005669 2:171697315-171697337 AGATTTTTAAAAATTAGGAAGGG - Intronic
942412583 2:175726719-175726741 AGGTTTTTGCAAATTGGAAATGG - Intergenic
942644853 2:178099123-178099145 ATGTTTTTAAAAATACAGTACGG + Intronic
943146349 2:184050508-184050530 GGGTTTTGAAAAACTGAGATGGG + Intergenic
943492930 2:188579686-188579708 AGGTTTTTTCAATTTCAGAATGG - Intronic
943659302 2:190540766-190540788 CTCTTTTTAAAAATTGAGGAGGG - Intergenic
943767763 2:191679794-191679816 AAGTCATTAAAAATGGAGAAGGG - Intronic
943985141 2:194609115-194609137 AGGTCTTTAATAATTGAGTAGGG + Intergenic
944027552 2:195189794-195189816 ATGGCTTTAAAAATAGAGAAAGG + Intergenic
944232006 2:197405095-197405117 TTGCTTTTAAAAATTAAGAATGG - Exonic
944363902 2:198893683-198893705 AGGATTTTAAAAAGACAGAAGGG + Intergenic
944515352 2:200507843-200507865 AAATTTTTAAAAAATGAGACAGG + Intronic
944708711 2:202316486-202316508 TGGTTTTTAAAAAATGAAACAGG - Intergenic
945089386 2:206164682-206164704 AGGTGGTCAAAAATTTAGAATGG + Intergenic
945545687 2:211148388-211148410 AGGTCTGCAAAAATTGACAATGG + Intergenic
945598521 2:211827856-211827878 AGACTTTTAAAAAGTGAAAATGG - Intronic
945639848 2:212411561-212411583 AGGATTTTAAAAATTGGCATTGG - Intronic
945826904 2:214731885-214731907 AAGTTTTTAAAAATTCACTATGG + Intronic
946511501 2:220361716-220361738 AGTTTTTTATAAAGTGGGAAGGG + Intergenic
946522385 2:220480869-220480891 TGGATTTTAAATTTTGAGAAGGG + Intergenic
946825476 2:223673217-223673239 TCGTTTTTAAAAATTGACCAAGG + Intergenic
946979753 2:225196886-225196908 AGGTTTTTAAATAATTAAAAGGG - Intergenic
947419591 2:229930174-229930196 TTATTTTTAAAAATAGAGAAGGG - Intronic
947561523 2:231157926-231157948 AGGATATTAAAAAGTGAAAAAGG - Intronic
947697768 2:232206757-232206779 AGATTTTTAAAAAGTGTTAAAGG + Intronic
947789854 2:232858980-232859002 AAATTTTTAAAAATTGGGAGTGG + Intronic
947827022 2:233113381-233113403 ATGTTTTTAAAAAAAGAGAAGGG + Intronic
948023817 2:234759731-234759753 AAGTTTTTAAAAAATGGGTAAGG - Intergenic
948938390 2:241183297-241183319 AATTTTTAAAAAATTGAAAATGG - Exonic
948938485 2:241183890-241183912 AGCCTTTTAAAACTTGAGACAGG - Intergenic
1169608550 20:7352055-7352077 AGGTTGTTTAATACTGAGAATGG - Intergenic
1169922444 20:10749708-10749730 AGCATTTTATAAATTGAAAAAGG + Intergenic
1170035907 20:11989589-11989611 AGGTTTTCAAAAACAAAGAATGG + Intergenic
1170287407 20:14725317-14725339 TGGTTTATAAGTATTGAGAATGG + Intronic
1170474170 20:16698483-16698505 AAATTTTTAAAAATAGAGACAGG + Intergenic
1170662771 20:18359048-18359070 AGGCATTTAAAAATAGACAATGG + Intergenic
1170858848 20:20083863-20083885 ATGATTTTAAAAATTATGAAGGG - Intronic
1170923878 20:20704919-20704941 AGGTTTTGAATAATGGATAAAGG - Intronic
1171441266 20:25165234-25165256 CAGCTTTTAACAATTGAGAAAGG - Intergenic
1171526588 20:25817482-25817504 TCATTTTTAAAAATTGAGATGGG - Intronic
1171535524 20:25884880-25884902 TCATTTTTAAAAATTGAGATGGG - Intergenic
1171546487 20:26005911-26005933 TGGTTTTTAAAAATAGAGATGGG - Intergenic
1171550239 20:26038403-26038425 TCATTTTTAAAAATTGAGATGGG + Intergenic
1171572335 20:26265017-26265039 TCATTTTTAAAAATTGAGATGGG + Intergenic
1171805561 20:29676306-29676328 TCATTTTTAAAAATTGAGATGGG + Intergenic
1171838497 20:30180110-30180132 TCATTTTTAAAAATTGAGATGGG - Intergenic
1171949608 20:31409105-31409127 AGTTTTTTTAAAATAGAGAAGGG - Intronic
1172282244 20:33716147-33716169 ATGTTTTTAAAAGATGAGACTGG - Intronic
1173863779 20:46301067-46301089 AGATTTTTAAAAAATAAAAATGG - Intronic
1174045812 20:47732065-47732087 TGTTTTTTAAAAATTGAGAAGGG + Intronic
1174365861 20:50055832-50055854 AATTTTTTAAAAATAGAGACAGG + Intergenic
1174903813 20:54528554-54528576 AGGCTTTTTTAAAATGAGAAGGG - Intronic
1174929804 20:54800748-54800770 GGGATGTTAAAATTTGAGAAGGG + Intergenic
1175091730 20:56510549-56510571 AAGTTTTTAAAAATAAAAAATGG - Intronic
1175209768 20:57345924-57345946 TAATTTTTAAAAATTGAGATGGG - Intergenic
1175253892 20:57627153-57627175 AGATTTTTAAAAATAGAACAAGG + Intergenic
1175436570 20:58955649-58955671 AATTTTTTAAAAATAGAGATAGG - Intergenic
1175607348 20:60321890-60321912 AGGTTTTTAACAGTCAAGAAGGG + Intergenic
1175706607 20:61183235-61183257 AGGTCATTAAAAAATGAAAAAGG - Intergenic
1176649776 21:9534833-9534855 AACTTTTTAAAAATAGAGATGGG + Intergenic
1176871849 21:14089579-14089601 AGGTTATTATATATTGATAAAGG - Intergenic
1176936499 21:14874001-14874023 AGAATATTAAAAATTGAGCAAGG - Intergenic
1177433591 21:21021702-21021724 GTGTTTTTAAAAATTAAGTATGG - Intronic
1177448962 21:21239819-21239841 AGCATTTTAAAAATTGAGGTTGG + Intronic
1177604965 21:23366361-23366383 AGATTTTAAAAAAATTAGAAAGG + Intergenic
1178014449 21:28327822-28327844 TGGTATTTAAAAATTGAAAGTGG - Intergenic
1178060320 21:28846623-28846645 AGGTTAAAAAAAATTGACAAAGG - Intergenic
1178149483 21:29777544-29777566 AGCATTTGAAAAATTGAAAAAGG + Intronic
1178556928 21:33600419-33600441 AGGTGTTGAAAGATAGAGAAAGG - Intronic
1179210382 21:39319918-39319940 AGGTTTTTAAAAGTAGTGACAGG - Intronic
1179240079 21:39582122-39582144 GGGTTTTTAAAAGTGGAGGAGGG + Intronic
1179255098 21:39709075-39709097 CAGTCTTTAAAAATTCAGAAGGG + Intergenic
1179516406 21:41911114-41911136 AAGTTTTTAAAAATTAAGAATGG + Intronic
1180574890 22:16764146-16764168 TGATTTTTAAAAATTGAAATGGG - Intergenic
1181611438 22:24015643-24015665 ATGTTTTTAAAAATTAATGAGGG - Intronic
1181658659 22:24323039-24323061 ATATTTTTAAAACTTGGGAATGG + Intronic
1182903104 22:33915274-33915296 AGAGTTTTGAATATTGAGAATGG - Intronic
1183619174 22:38962656-38962678 AGATTTTTAAAAAATCAGAGTGG + Exonic
1183800377 22:40158488-40158510 AGGTTTTTAAAGATAAAGACTGG - Intronic
1184943759 22:47786742-47786764 GTGTTTTTAAAAATTCAGGAAGG + Intergenic
1185145728 22:49135017-49135039 AGGTATTTAATAATAAAGAAAGG - Intergenic
1185174588 22:49316327-49316349 ATGTTGTTAAAAAGTGAAAATGG - Intergenic
1185308519 22:50138380-50138402 AACTTTTTAAAAATAGAGACAGG - Intronic
949496007 3:4632858-4632880 ATGTTTTTAAAAAATAAAAAAGG + Intronic
949840046 3:8310688-8310710 AGTTTATTAAACATTTAGAATGG + Intergenic
950036265 3:9888111-9888133 ATTTTTTTAAAATTTGAGACAGG + Intergenic
950092631 3:10307057-10307079 TTTTTTTTAAAAATTGAGACAGG + Intronic
950205863 3:11080345-11080367 AAATTTTAAAAAATTGACAAGGG - Intergenic
951281888 3:20760886-20760908 AAATTTTTAAAAATTGAGGAAGG + Intergenic
951666723 3:25133690-25133712 AGGCTTGTAAAGATTCAGAAAGG + Intergenic
951801900 3:26605168-26605190 AGGTTAATAAAAACTGAAAAGGG + Intergenic
951878237 3:27453199-27453221 AAGTTATTACAAGTTGAGAAGGG - Intronic
952052515 3:29401881-29401903 AATTTTTTAAAACTTGAAAAGGG + Intronic
952208977 3:31210077-31210099 ATAATTTTAAAAATTGAAAAAGG + Intergenic
952474398 3:33691867-33691889 AGGTTTTTAATAATTTATACTGG + Intronic
953360086 3:42288327-42288349 TGGTCTTCATAAATTGAGAAAGG - Intergenic
953475332 3:43201190-43201212 AAGTTTTTAAAGAATGAGGAAGG - Intergenic
953955705 3:47230404-47230426 AATTTTTTAAAAATAGAGACTGG - Intronic
955203895 3:56877666-56877688 CAGTTTTTAAAAATTGAGATCGG - Intronic
955589311 3:60517219-60517241 TCATTTTTAAAAATTGATAAAGG + Intronic
956027524 3:64999369-64999391 AGGTTTGTAAAACTTGTCAAGGG - Intergenic
956065389 3:65392202-65392224 AGCTTTTTGTAAAATGAGAAGGG - Intronic
956192364 3:66620246-66620268 AGGAATTTAAAAATTGGAAAAGG - Intergenic
956508361 3:69967474-69967496 GGGTTTTTAAAAATAAAGCAAGG + Exonic
956574853 3:70740988-70741010 AGCTTTTAAAAAATTCAAAACGG - Intergenic
956832597 3:73067545-73067567 AATTTTTTAAAAATTTACAATGG - Exonic
956907299 3:73779925-73779947 AGGTCTTTATAAATAGAAAACGG + Intergenic
957263868 3:77935374-77935396 ATTTTTTTAAAAAGTCAGAATGG + Intergenic
957590342 3:82189042-82189064 ATGTTTTTAAAAATTTTGCAAGG + Intergenic
957591099 3:82199092-82199114 AGGGTTTTTAAAATTAATAATGG - Intergenic
957749147 3:84389471-84389493 TAATTTTTAAAAATTTAGAATGG - Intergenic
957882184 3:86232279-86232301 CAGTTTTTAAAAATAGAGACAGG - Intergenic
957981473 3:87516907-87516929 AGATTTTTAAAAATTATTAAAGG + Intergenic
958116294 3:89222648-89222670 TGTTTCTAAAAAATTGAGAAGGG + Intronic
958183680 3:90090943-90090965 TGGATTTTACAAATAGAGAAAGG + Intergenic
958494808 3:94830793-94830815 AGATTTTTAAAAATTGCCCAAGG + Intergenic
958659738 3:97051097-97051119 AGAATTGTGAAAATTGAGAATGG + Intronic
958750624 3:98190637-98190659 AGGTCATTAAATATTGAGGATGG - Intronic
958961699 3:100516824-100516846 AGTTTTTGAAAAGTTGGGAATGG + Intronic
958964871 3:100548021-100548043 AGTTATTTAAACATTGAGAGGGG + Intronic
959118747 3:102208315-102208337 AGAATATTAAAAATAGAGAAAGG - Intronic
959695291 3:109243224-109243246 AGGATTTTCTAAATTAAGAAAGG - Intergenic
959732830 3:109623401-109623423 ATGTTTTTAAAAAATCAGAATGG + Intergenic
960066276 3:113376919-113376941 AGTTTTTGAGAAAATGAGAAGGG + Intronic
960130585 3:114051659-114051681 AGTATAGTAAAAATTGAGAAAGG - Intronic
960337129 3:116431681-116431703 TGGATTTTAAAAATTGCAAAGGG + Intronic
960440961 3:117688506-117688528 AGTGTTTTCAAACTTGAGAATGG - Intergenic
960690811 3:120344572-120344594 TGGTTTTGAAAGATTGAGATAGG - Intronic
961121159 3:124371948-124371970 AGGTTTTTAGAAGCTGGGAAGGG - Intronic
961400228 3:126635493-126635515 ATATTTTTAAATACTGAGAAAGG + Intronic
962057958 3:131892967-131892989 AGGTTGTTAATAATGGATAAAGG - Intronic
962662390 3:137616534-137616556 ATTTTTTTAAAAATTGAGACAGG - Intergenic
962663655 3:137631556-137631578 TGGTTTTTAAAAACAGAGAAGGG + Intergenic
963188595 3:142444271-142444293 ATCTTTTTAAAAATAGAGATGGG - Intronic
963500315 3:146117474-146117496 TTGTTTTTAAAAAATAAGAAGGG + Intronic
963807502 3:149739481-149739503 AGGTTGATAAAAATTAAAAAAGG + Exonic
963891416 3:150640012-150640034 AAATTTTTAAAAATAGAGACAGG + Intergenic
964142114 3:153415502-153415524 AAGCTATTAAAAATTGACAAAGG - Intergenic
964462332 3:156947839-156947861 ATGTATTTAAAAAGTAAGAATGG - Intronic
964774534 3:160261479-160261501 AAGATTTTGAAAATAGAGAAGGG + Intronic
964857064 3:161158076-161158098 ATTTTTTTAAAAATAGAGATGGG - Intronic
964922358 3:161912711-161912733 AGGTACTTAACAATTGTGAAGGG - Intergenic
965299505 3:166992109-166992131 AAATTTTTAAAAATTGAGAATGG + Intergenic
965384445 3:168029420-168029442 AGGTTTTTAAAAATTTTTCATGG - Intronic
965391848 3:168114168-168114190 AGGTTTTAAAAAAATGGAAATGG - Intergenic
965591905 3:170368975-170368997 CGTTTTGTAAAAAATGAGAAAGG - Intronic
965642252 3:170842080-170842102 AGTTTTTTAAAAATATAAAATGG - Intronic
965946318 3:174246423-174246445 ATTTTTTTAAAAATAGAGACAGG + Intronic
966083168 3:176030892-176030914 AGGAATTTCAAAATTCAGAAAGG - Intergenic
967231464 3:187341461-187341483 AGGTTTTAGAAAATTGAAAAGGG + Intergenic
967526660 3:190502947-190502969 AGGTTCTTGAAAGTTGATAAGGG - Intergenic
967584463 3:191195248-191195270 ATGTTTTTAAATATTGAGTTGGG - Intergenic
967927728 3:194664570-194664592 TGATTTTGACAAATTGAGAATGG - Intronic
968876998 4:3275675-3275697 TTGTTTTAAAAAATTAAGAAAGG + Intergenic
970032533 4:11692976-11692998 ATATTTTTAAAAATTGACATTGG + Intergenic
970817208 4:20170999-20171021 ATGTTTTTAAAAATTGTGAATGG - Intergenic
970829227 4:20316329-20316351 ACGTATTTAAAAGTTAAGAATGG - Intronic
970846959 4:20551782-20551804 CGATTTTACAAAATTGAGAAAGG + Intronic
971512199 4:27440655-27440677 AGGGTTTTAAGTCTTGAGAAAGG + Intergenic
971675884 4:29628841-29628863 AGGGTTTTAAAACTTTTGAATGG + Intergenic
972046484 4:34671421-34671443 ATATTTTTAAAAATGGAGATAGG + Intergenic
972112629 4:35584373-35584395 AGGTTCTTATTAATTGAGATTGG - Intergenic
973000900 4:44948734-44948756 AGATTTTAAAAACTTAAGAAGGG - Intergenic
973148242 4:46856740-46856762 TTGTTTTGAATAATTGAGAAAGG + Intronic
973664843 4:53148633-53148655 AAGTTTTTAAAAAAAGAAAAGGG - Intronic
974077580 4:57181574-57181596 AGATTTTTAAAAAGTAAAAATGG + Intergenic
974222845 4:58998517-58998539 ATCGTTTTAAAAATAGAGAAGGG - Intergenic
974360340 4:60870115-60870137 AAGTTTTCAAAAATTCATAATGG + Intergenic
974365089 4:60936174-60936196 TTTTTTTTAAAGATTGAGAATGG + Intergenic
974383580 4:61175198-61175220 AGTTTTTTACAAATCAAGAAAGG - Intergenic
974579078 4:63771429-63771451 AGGATATAAAAAATTGAGTAAGG - Intergenic
975135611 4:70871356-70871378 AGAATTTTAAAAATTGAGGATGG + Intergenic
975279554 4:72545175-72545197 AGATTTTTAAAAAATGAAAAAGG + Intronic
975602070 4:76111891-76111913 ATCTTTTTAAAAATAGAGATGGG + Intronic
975948403 4:79737484-79737506 AGATTTTTAAAATTTGGAAAAGG - Intergenic
975948429 4:79737867-79737889 AGGTTTTTAAGATTTGGAAAAGG - Intergenic
975964203 4:79950340-79950362 AGGTTTTTGTAAATCGACAAGGG - Intronic
976088579 4:81431000-81431022 CTGTTTTTAAAAATACAGAAAGG + Intronic
976483915 4:85577875-85577897 AAGTTGTTAGAAATTGATAATGG + Intronic
976812982 4:89116778-89116800 AGGATTCTAAAACTTGATAAGGG + Intergenic
976886482 4:89991000-89991022 AGGTTTATGAAAATTGTCAAAGG + Intergenic
977861586 4:101967472-101967494 AGATTTAAACAAATTGAGAAAGG + Intronic
977867575 4:102048034-102048056 AGATTTTTAAAAATTCTGTAGGG + Intronic
978280652 4:107008425-107008447 TGGTTTTGAGAAATTAAGAAAGG + Intronic
978692158 4:111526715-111526737 CTATTTTTAAAAATAGAGAAGGG - Intergenic
978954863 4:114599923-114599945 AGGGTTTATAAAATTGAGTACGG + Intronic
979234333 4:118382919-118382941 AATTTTTTAAAAATAGAGACAGG + Intergenic
979298186 4:119056394-119056416 AGATTTTTAAAAATTTAGCCAGG + Intronic
979364840 4:119809317-119809339 ATTTTTTTAAAAATTGAGATAGG + Intergenic
979675084 4:123401101-123401123 ACCTTTTAAGAAATTGAGAATGG - Intronic
980024857 4:127753368-127753390 AGATTTTTAAAAACTAAGAGTGG + Intronic
980025398 4:127760268-127760290 AGTTTTTTAAAAAATGGTAAGGG + Intronic
980036598 4:127890603-127890625 AGTTTTTTAAAATTTGAGATGGG - Intronic
980296142 4:130920425-130920447 ATGTTTTTAAAAATAAAAAAGGG - Intergenic
980722730 4:136719078-136719100 TGGTCTTTAATAATTGAGTAAGG + Intergenic
980778568 4:137466862-137466884 AGGTTTGAAAAAATTGTGCAAGG + Intergenic
980983509 4:139673714-139673736 GGGTTTTTAAAATTTGAGATAGG + Intronic
981057668 4:140382248-140382270 AAATTTTTAAAAATTGTTAAAGG - Exonic
981080035 4:140630686-140630708 AGGTTTTTAAAAATTATGATAGG - Intronic
981334124 4:143549515-143549537 TGGTTTTCCAAAATTGGGAAAGG + Intronic
981430353 4:144650401-144650423 CGGCTTTTAAAAATTGAAACAGG + Intronic
981523076 4:145684773-145684795 AAGTCTTTAAAAATTGAGGCAGG + Intronic
981600575 4:146483884-146483906 AGGTTTTTATTAAATGATAAAGG + Intronic
981754022 4:148121526-148121548 GGATTTTTAAAAATTAAAAATGG + Intronic
982063522 4:151628599-151628621 AGATTTTAAAAAATGGAAAAGGG + Intronic
982577922 4:157140176-157140198 AGGTTTTTAAAAGTAAAAAATGG + Intronic
982696463 4:158607761-158607783 AACATTTTAAAAATTGAAAAAGG - Intronic
982719278 4:158842679-158842701 AAGGTTTTAAAAATTTATAAGGG - Intronic
982831166 4:160062502-160062524 ATGTTTTTAAACATAGGGAAAGG - Intergenic
983111759 4:163758926-163758948 AGGTTTTTAAATATTAGGAAAGG + Intronic
983356402 4:166663699-166663721 AGGTTTTCAAAAACTGATGAAGG + Intergenic
983691136 4:170470439-170470461 AGGTTTCTTAAAATTTATAAGGG + Intergenic
984153740 4:176167800-176167822 AGGGTTTTAAAAATATAAAATGG - Intronic
984226220 4:177038219-177038241 TGGTTTTTAAAAATTATGTAGGG + Intergenic
984286419 4:177735544-177735566 ATTTTATTAAAAATTGAAAATGG + Intronic
984345669 4:178521581-178521603 AGATTTTTAAAAATTGAGGTTGG + Intergenic
984573057 4:181416219-181416241 AAGTTTTAAGAAATTGAGCAAGG + Intergenic
984683425 4:182638255-182638277 ATGTTTTTAAAAACTGGTAAAGG + Intronic
984695369 4:182774167-182774189 AGGCTTTTTCAAATTTAGAAAGG - Intronic
984965002 4:185131898-185131920 ACCTTTTTTTAAATTGAGAATGG - Intergenic
985005647 4:185532742-185532764 AGGATTTTTAAGAATGAGAAAGG + Intronic
985161035 4:187045153-187045175 AGTATTTTAAAAATTGATAAAGG - Intergenic
985205598 4:187532136-187532158 GTTTTTTTAAAAATAGAGAAGGG - Intergenic
985722823 5:1499570-1499592 AGAATTTTAAAAATCTAGAAAGG + Intronic
986009783 5:3701764-3701786 ATGTATTTAAAAATTGCTAAGGG - Intergenic
986540183 5:8836946-8836968 AGGGTTCTAAAAATTGATACAGG - Intergenic
986630141 5:9763919-9763941 ATGTTTGTAGAAATTCAGAAAGG + Intergenic
986873985 5:12083538-12083560 AGGTTTTTATATAATGATAAAGG + Intergenic
986990132 5:13542700-13542722 AAATTTTTAAAAAATCAGAAAGG - Intergenic
987224872 5:15830178-15830200 AGGTTTTTGAAAACTTAGCAAGG + Intronic
987470959 5:18326831-18326853 ATGTTTTTAGAAATTAAAAAAGG - Intergenic
987474159 5:18370149-18370171 AAGTTTTTAAAAATAGAGGATGG + Intergenic
987480133 5:18443824-18443846 AACTTTTTAAAAATTTATAATGG - Intergenic
987517530 5:18932516-18932538 AGATTTTTAGAAATTAAGCAGGG - Intergenic
987728543 5:21736235-21736257 ATGTTTTTAAAATTTATGAATGG + Intergenic
987804573 5:22746963-22746985 AAAACTTTAAAAATTGAGAATGG + Intronic
988008188 5:25447417-25447439 GGTTTTTTAAAAATTAAAAAAGG + Intergenic
988062336 5:26187627-26187649 AGGTTTTTAAAGTTTGTGAATGG - Intergenic
988115112 5:26876983-26877005 TTATTTTTAAAAATAGAGAAAGG + Intergenic
988733088 5:33992818-33992840 CGGATTTTAAAAAGTAAGAAGGG - Intronic
988749245 5:34177961-34177983 AGTTTCTTAAGAATTCAGAACGG + Intergenic
989014189 5:36910206-36910228 AGGCTTTCAAAGGTTGAGAAAGG + Intronic
989030109 5:37110050-37110072 AGGGTTTTAACAATGGAGATGGG - Intronic
989202424 5:38777165-38777187 AGATTTTTAAAAATGAACAAGGG + Intergenic
989233484 5:39115730-39115752 AGGTTTGTACAAATTAAGAAAGG + Intronic
989610877 5:43290225-43290247 ACTTTTTTAAAAATTTAAAATGG - Exonic
989646329 5:43636842-43636864 ATGTTTATAAAAATTTTGAAAGG - Intronic
989692088 5:44156871-44156893 TGGCCTTTAATAATTGAGAAAGG + Intergenic
989720296 5:44520089-44520111 AGGTTTATCAAAATACAGAAAGG - Intergenic
990026784 5:51201641-51201663 ACATTTTTAGAAATTCAGAAAGG + Intergenic
990490761 5:56300725-56300747 AGGTTCTTAGAAATTGGGACAGG - Intergenic
990520879 5:56579564-56579586 TGGTTTTTAAAAAATAAAAAGGG - Intronic
990690747 5:58361073-58361095 AGCCTTTTACAAATTTAGAATGG - Intergenic
990810613 5:59718395-59718417 AGTGTTTTAAAAATTAAGGAAGG - Intronic
990816775 5:59794612-59794634 AAATTTTTAAAAATAGAGAAGGG - Intronic
991124928 5:63059647-63059669 AGATTTTTTAAAATTCAGAAAGG + Intergenic
991178110 5:63714476-63714498 AGATTATTAAAAATTAAGGATGG - Intergenic
993247559 5:85469705-85469727 AGGTTTTTAAAATATCAGAGAGG + Intergenic
993510245 5:88762281-88762303 TGGTTTTTTAAATTTGAGACAGG + Intronic
993678922 5:90851065-90851087 AGTTTTTTAAAGATTGAACATGG + Intronic
993691007 5:91000342-91000364 AGATTTTTAAATATTAAAAATGG - Intronic
994293383 5:98058183-98058205 ATATTTTTAAAAATTGATTAGGG - Intergenic
994426867 5:99600907-99600929 AGATGTTAAAAAAATGAGAAGGG + Intergenic
994493333 5:100476609-100476631 AATTTTTTAAAAATAGAGATAGG - Intergenic
994654830 5:102579119-102579141 AGATTTTTAAAAATTAAATATGG + Intergenic
994678128 5:102850604-102850626 AGGCTTTTAAAACTTCAGAGTGG + Intronic
994703984 5:103176408-103176430 ATTTTTTTCAAAATTGATAAGGG - Intronic
995038733 5:107564300-107564322 AGGATTTTGAAAATGCAGAATGG - Intronic
995173161 5:109141223-109141245 GGCTTATAAAAAATTGAGAAAGG - Intronic
995638259 5:114220541-114220563 TGTTTTTTAAAAAAAGAGAAAGG + Intergenic
995680153 5:114707663-114707685 AATTTTTTAAATTTTGAGAATGG - Intergenic
995815457 5:116162994-116163016 AGGTTTCTAGAAACTGAGAGAGG - Intronic
995857915 5:116613301-116613323 AGGTTTTTAAAAATTTTGTTTGG - Intergenic
996364882 5:122690559-122690581 ATGTTATAAAAAATTGAAAATGG - Intergenic
996583344 5:125056582-125056604 ATGGTTTTAAAACTTGAAAATGG + Intergenic
996864114 5:128099666-128099688 AAATTTTTAAAAATAGAAAAAGG - Intronic
996870564 5:128187757-128187779 AAGTTTTAAAATATTAAGAATGG - Exonic
997061625 5:130511681-130511703 AGGTGTTTAAAATATCAGAAAGG + Intergenic
997061661 5:130512491-130512513 CAGTTTTTAACAATTGTGAATGG + Intergenic
997151583 5:131501750-131501772 AGGTATTTACAAATATAGAAGGG + Intronic
997192454 5:131950124-131950146 CGATTTTTAAAAATTGAAAGTGG + Exonic
997991513 5:138548067-138548089 AGGTTTTTATAAATTGACCTAGG + Intergenic
998313874 5:141161618-141161640 ACTTTTTTAAAAATTGAGTTTGG + Intergenic
998866831 5:146513840-146513862 AGTATTTTAAAAGTTGAGTAGGG + Exonic
998893965 5:146778271-146778293 TGGCTTTTAAAAATTCAGAGTGG + Intronic
999011013 5:148040584-148040606 TGGATTTTAAAAATGAAGAAAGG + Intronic
999402428 5:151275898-151275920 ATATTTTTAAAAATAGAGACAGG - Intergenic
999559657 5:152787054-152787076 AGGTCTTTACATATTGATAAAGG + Intergenic
999633031 5:153591287-153591309 TGGTTTTGAAAAGTTAAGAATGG - Intronic
999971374 5:156867237-156867259 AATTTTTTAAAAATAGAGATAGG - Intergenic
999994233 5:157076866-157076888 TGTTTTTTAAAAATAGAGATGGG - Intergenic
1000023867 5:157342327-157342349 TGGTTTTAAAAAATAGAGAGCGG + Exonic
1000217168 5:159171377-159171399 ATGTTTCTAAATATGGAGAAAGG - Intronic
1000467688 5:161600355-161600377 TGGTTGTTAGAAATTGAAAAGGG + Intronic
1000615061 5:163417244-163417266 GGGCTGGTAAAAATTGAGAAGGG + Intergenic
1000661507 5:163944844-163944866 AAGTGTTTTTAAATTGAGAATGG + Intergenic
1000695176 5:164371883-164371905 ATGTTTTAAAAAATTAAAAAAGG + Intergenic
1000986095 5:167862137-167862159 AGGCTTGTAAAAAGTGAGGAAGG + Intronic
1001857134 5:175022719-175022741 AGATTTTTAAAAATTTACTAAGG - Intergenic
1002152771 5:177249301-177249323 AATTTTTTAAAAATAGAGACAGG - Intronic
1002331661 5:178446391-178446413 ATATTTTTAAAAATTCAGATAGG + Intronic
1002984359 6:2174448-2174470 AAGTTTTAAAAAATTTAGCATGG - Intronic
1003062403 6:2873999-2874021 TAATTTTTAAAAATTGAGACGGG - Intergenic
1003194225 6:3900806-3900828 ATTTTTATAAATATTGAGAAGGG - Intergenic
1003208330 6:4035665-4035687 AGGTTTTTATTAAATGAGGAAGG + Intronic
1003382130 6:5634608-5634630 ACTATTTTAAAAATTGAGCAAGG - Intronic
1003597604 6:7488084-7488106 CAATTTTTAAAAATTGAGGATGG + Intergenic
1004057303 6:12152632-12152654 AGGTTTTTAAACTTTGACAGTGG + Intronic
1004226501 6:13789541-13789563 AGGCTTTCAAAATTCGAGAATGG - Exonic
1004538506 6:16526330-16526352 ACATTTTTCAAGATTGAGAAAGG + Intronic
1004709164 6:18154326-18154348 AGCTTTTGAAAAGGTGAGAATGG - Intronic
1004730074 6:18349215-18349237 AGGTTCTTAGAAAATGAGATTGG + Intergenic
1005116972 6:22349533-22349555 AGGATTATAAAAATGGAAAAGGG + Intergenic
1005752791 6:28899050-28899072 TGGGTTTTAAAAATTGACATGGG - Intergenic
1006281192 6:33054919-33054941 ATGTTATTAAAAGTTGGGAAGGG - Intergenic
1006776789 6:36599509-36599531 AGTTTTTTTATAATTGAAAATGG + Intronic
1006827722 6:36948468-36948490 AAGTTTTTAGAAATAGAGAAAGG + Intronic
1007880215 6:45156713-45156735 AGGGTTTTAAAAATATAGAATGG - Intronic
1008920324 6:56837262-56837284 AGTTTTTTAAAAACTTAAAAAGG + Intronic
1009521877 6:64693279-64693301 ATGTTTTTAAAAATAGAAATTGG + Intronic
1009615302 6:65997791-65997813 AGATTTTTAAAAATTGATCTGGG + Intergenic
1009768860 6:68119308-68119330 AGGTTTTCAAAAATGGAGGGCGG + Intergenic
1009955921 6:70453309-70453331 AGTTTTTTAAAATTTCAAAATGG - Intronic
1010213294 6:73379750-73379772 TGGTTTTTAAAAATTGAGACAGG + Intronic
1010693403 6:78938990-78939012 ACATTTTTAAAAAGTGAGGATGG - Exonic
1010704259 6:79089288-79089310 ATGTCTTTGAAAACTGAGAAGGG + Intergenic
1010705054 6:79098286-79098308 ATGTTTTTAAAGTTTAAGAATGG - Intergenic
1010770381 6:79821795-79821817 AAGTTTTTAAAAAATAAGCATGG + Intergenic
1010849760 6:80758490-80758512 AGGTTGTTAAATAATGATAAAGG - Intergenic
1010906471 6:81496632-81496654 AGGTTATAATAAATTGGGAAGGG + Intronic
1010940630 6:81912687-81912709 ACATTTCTAAAAATTGAGCAGGG - Intergenic
1011001765 6:82597712-82597734 AGGTTTTTAAAAATGGAGTAGGG + Intergenic
1011456332 6:87554077-87554099 AGATTTTTAAAAATTGATATGGG - Intronic
1011461379 6:87608631-87608653 ATCTTTTTAAAAATTGAGATTGG + Intronic
1011743570 6:90387515-90387537 AGGTTTTTGAAAAGAGAGAAAGG - Intergenic
1011841228 6:91501552-91501574 TGATTTTTAAAAATTAAGATTGG - Intergenic
1012035469 6:94132556-94132578 AAGTTTTTAAAAATTGTTTATGG + Intergenic
1012197781 6:96365987-96366009 ATATTTTTAAAAATGGACAAAGG + Intergenic
1013711392 6:112904183-112904205 AAGCTTTAAAGAATTGAGAAGGG - Intergenic
1013967540 6:115972578-115972600 AGCTTGTTAATAATTTAGAAAGG - Intronic
1014036562 6:116772852-116772874 AAGTTTTTCAAAATTGAAACTGG + Intergenic
1014477599 6:121892471-121892493 AAGTGTTTAAAAAGTGGGAACGG - Intergenic
1014619250 6:123645606-123645628 ATGTCTTTAAAAAATGTGAATGG - Intergenic
1014812106 6:125898691-125898713 GGGTTTTTAAAAATACAGAAGGG - Intronic
1014901686 6:126973315-126973337 AGGTTTTAAGAAATGGAGAATGG + Intergenic
1015556346 6:134465386-134465408 ACATTTTTAAAAATTGAGGAAGG - Intergenic
1015851893 6:137582736-137582758 AAGTTTTTAAGAGTGGAGAATGG + Intergenic
1016218615 6:141636162-141636184 CATTTTTTAAAAATTGATAATGG + Intergenic
1016220342 6:141661539-141661561 AGGTTGTTGAAAATTGAGATGGG - Intergenic
1016487190 6:144553962-144553984 ACCTTGTTAAAAATAGAGAAAGG + Intronic
1016803213 6:148187332-148187354 AGGTTTATTAAAAATGGGAAAGG - Intergenic
1016930986 6:149408999-149409021 TGGTTTTTAAAAATAAAGTATGG + Intronic
1017435253 6:154409679-154409701 TTATTTTTAAAAATTGAGATGGG - Intronic
1018466448 6:164050842-164050864 AGGCTGTTAAGAATTGAGATGGG + Intergenic
1018835207 6:167477969-167477991 AGGTTTGGAAAATTTGAGAGGGG - Intergenic
1020274058 7:6614577-6614599 AGGTTTTTAAAAAATTAGCTGGG - Intergenic
1020450715 7:8317623-8317645 ATGTTTTCATAAATTGAGAGAGG - Intergenic
1020507617 7:9013616-9013638 AGGTCTATAAAAATAGAGAAAGG - Intergenic
1020547606 7:9553536-9553558 AGATTTTTAAAATTTGAGATTGG - Intergenic
1020587651 7:10089430-10089452 TGCTATTTAAAAATTAAGAAAGG + Intergenic
1020615478 7:10454133-10454155 AGCTATTTAAAAATTGATAGGGG - Intergenic
1020726920 7:11827441-11827463 AGTATTTTAAAAGTTTAGAAAGG - Intronic
1020766704 7:12330905-12330927 AGTTTATTAAATATTGTGAATGG + Exonic
1021214901 7:17903640-17903662 AAGTTTTTAAAAATTGCCCAAGG + Intronic
1021217007 7:17928539-17928561 AGGTTTTTTAAAAGGGAGGATGG + Intronic
1021416340 7:20389595-20389617 ATGTTTCCAAAAATTAAGAAGGG + Intronic
1021938611 7:25656260-25656282 TGGCTTTTAAAAATGGTGAAGGG - Intergenic
1022691495 7:32660450-32660472 AGTTTTTTAAAAAATGACACGGG + Intergenic
1022968364 7:35495021-35495043 AGATTTTAAAAAATTGTAAAGGG - Intergenic
1023061686 7:36333663-36333685 AGATTTTTCAAAATTGAGCTGGG + Intronic
1023070584 7:36428528-36428550 AGGTTTTAAAGTATTGAGAGTGG - Intronic
1023347233 7:39283835-39283857 AAATTTTTAAAAAGTTAGAAAGG - Intronic
1023383580 7:39632808-39632830 AATTTTTTAAAAATTGAGATGGG - Intronic
1024197741 7:47076097-47076119 AGTTTTTTAAAAAATGAAATTGG - Intergenic
1024772832 7:52744699-52744721 AGGTTTTTAAAACTTGAGCTTGG - Intergenic
1025064268 7:55839841-55839863 AGGTGATTAAAAAGTGAGACTGG + Intronic
1025228711 7:57184550-57184572 ATTTTTTTAAAAACTGAGATGGG - Intergenic
1025286990 7:57671590-57671612 TCATTTTTAAAAATTGAGATGGG - Intergenic
1025636082 7:63320471-63320493 TAGTCTTTAAAAATGGAGAAAGG + Intergenic
1025646614 7:63427709-63427731 TAGTCTTTAAAAATGGAGAAAGG - Intergenic
1026042363 7:66878613-66878635 TGGTTTTTTAAAATTGTGATTGG - Intergenic
1026295584 7:69049121-69049143 AGATTTTTAAAGATTCACAAAGG - Intergenic
1026685392 7:72505185-72505207 ATTTTTTTAAAAATAGAGACGGG - Intergenic
1026877934 7:73890422-73890444 TGGTTTTTAAAAGGTGAAAATGG + Intergenic
1026910246 7:74087396-74087418 TCTTTTTTAAAAATTGAGACTGG - Intronic
1027781123 7:82521591-82521613 AAGATTTTAGAAATTGAGATTGG + Intergenic
1027808809 7:82865647-82865669 AGTTTTTAAAAAATGGTGAAGGG + Intronic
1027935944 7:84602906-84602928 AGATTTTTAAAAATAGAAGAAGG - Intergenic
1028011019 7:85644235-85644257 AGATGTTTAAAAAATGAAAATGG + Intergenic
1028098235 7:86788636-86788658 ACATCTCTAAAAATTGAGAATGG + Intronic
1028350086 7:89835718-89835740 AAAATTCTAAAAATTGAGAATGG - Intergenic
1028799953 7:94951429-94951451 ATGTGTTAAAAAATTGTGAATGG + Intronic
1028960646 7:96746166-96746188 AGATTTTTAAAAATTGTGTTAGG + Intergenic
1029190059 7:98765425-98765447 AGGTTTCTACAAACTGAGAAGGG - Intergenic
1029841317 7:103366351-103366373 AGGCTTTGAAAAAATGACAATGG - Intronic
1029986034 7:104924137-104924159 CGGTTTTAAAATGTTGAGAAGGG - Intergenic
1030552977 7:110987936-110987958 AAGCTGTTAAAAATTGATAACGG - Intronic
1030903811 7:115157702-115157724 AGGATTCTAAAAATGGTGAAAGG + Intergenic
1030922323 7:115407246-115407268 TGGTTTTAAAAAATATAGAAAGG - Intergenic
1030993295 7:116327606-116327628 AGGTTCTAAATAATTGAGATAGG + Intronic
1031032851 7:116753369-116753391 AGCTTTGTGACAATTGAGAAAGG - Intronic
1031036501 7:116793484-116793506 AGGTTTTTAAATGTTGAAAGTGG - Intronic
1031572737 7:123379111-123379133 AGGTTTTTAAAAAATTAAACTGG + Intergenic
1031576319 7:123419414-123419436 AGGTTTATGAAAATTGGAAAAGG + Intergenic
1031615368 7:123873201-123873223 AGGATTTTGAAAATTGTCAATGG - Intronic
1032331437 7:130984558-130984580 AAATTTTTAAAAAATGATAATGG + Intergenic
1032366247 7:131302740-131302762 AGATTTTTTAAAATTCTGAAAGG + Intronic
1032596268 7:133244191-133244213 AGTTTTTTAAAAATGTATAAAGG + Intergenic
1033349213 7:140548514-140548536 CAGTTTTTAAAAATAGAGACTGG - Intronic
1033357858 7:140615174-140615196 AGGTTTTAAAAAAATTAAAATGG + Intronic
1034030454 7:147757080-147757102 CTGTTTTTAATATTTGAGAATGG + Intronic
1034096997 7:148418684-148418706 ACATTTTTAAATATTAAGAAGGG - Exonic
1034395687 7:150823202-150823224 AGATTTTAAAAAAGTGAGTAAGG + Intergenic
1034788031 7:153943062-153943084 AGGCTTTTACAAAATCAGAACGG - Intronic
1034926097 7:155123382-155123404 ATGTTTTTAAAAGAGGAGAAAGG - Intergenic
1035089954 7:156301274-156301296 AGATTTTTAAAAATTATGAATGG - Intergenic
1035215689 7:157364955-157364977 TACTTTTTAAAAATTGAGAAGGG + Intronic
1035611328 8:966548-966570 AACTTTTTAAAAAATGACAATGG + Intergenic
1036042729 8:5103998-5104020 AGCTTTTTAAAAGTCTAGAAAGG + Intergenic
1036113776 8:5935358-5935380 AGTTTTATGAAATTTGAGAATGG + Intergenic
1036382781 8:8248830-8248852 ATTTTTTAAAAAATTGAAAATGG + Intergenic
1036922096 8:12866380-12866402 AGGTTATTGAAAAATTAGAAAGG - Intergenic
1037947872 8:23000332-23000354 AAATTTTTAAACATCGAGAAGGG - Intronic
1037992118 8:23328491-23328513 AGGTGCTCAAAAATGGAGAATGG - Exonic
1038083493 8:24167001-24167023 ATATTTTTAAAAATTGTAAACGG - Intergenic
1038422985 8:27445405-27445427 TGTTTTTTAAAAATTCAGATAGG - Intronic
1038466993 8:27773395-27773417 AGGTTTTTAAAGACGAAGAAGGG - Intronic
1038516370 8:28190881-28190903 TGGTTGTTATAAATGGAGAAAGG + Exonic
1038593214 8:28860383-28860405 AGGGCTTTAAAAGTTGGGAAAGG - Intronic
1038797228 8:30720818-30720840 AGATTTTTAAAAAGTGTGACTGG + Intronic
1038840432 8:31179993-31180015 ACTTTTTTAAAAATAGAGATGGG + Intergenic
1039596750 8:38797330-38797352 AGTTTTTTAAAAAGTGGAAAAGG - Intronic
1040347476 8:46520672-46520694 CTGTTTTTAGAAATTGTGAAGGG + Intergenic
1040433704 8:47368818-47368840 CGATTTTTAAAAACTGAAAAGGG + Intronic
1040479754 8:47813878-47813900 ACTTTTTTTAAAATAGAGAAGGG + Intronic
1040727974 8:50406988-50407010 AGGTTTTAAAAAACAGACAAAGG - Intronic
1041141504 8:54824864-54824886 AGAGTTTTAAAAATTATGAATGG - Intergenic
1041150451 8:54926703-54926725 ATGTTTTTAAAAAATGATACAGG + Intergenic
1041166554 8:55098159-55098181 AGGTGTTTAAAGCTTGAGAAAGG + Intergenic
1041779369 8:61560796-61560818 AGGTTTTAAAAAGGTGAGGAAGG + Intronic
1042403382 8:68375555-68375577 AGGTTTGAAAAAATTGTGAAAGG - Intronic
1042425056 8:68638025-68638047 GGGTCTTTAGAAAATGAGAATGG + Intronic
1042435043 8:68754444-68754466 GGGTTTTTAAGAATCTAGAAAGG + Intronic
1042986194 8:74585554-74585576 TATTTTTTAAAATTTGAGAATGG - Intergenic
1043156882 8:76793768-76793790 AGTGTTTAAAAAAATGAGAAAGG - Intronic
1043169240 8:76943868-76943890 AGGTTATTACAAAATGATAAGGG - Intergenic
1043196155 8:77294446-77294468 AGAATTTTAAAAATTCAGATTGG + Intergenic
1043217848 8:77618301-77618323 TGCATTTTAAAAATTGAAAAAGG - Intergenic
1043319367 8:78963249-78963271 AATTTTTTAAGAAGTGAGAAAGG - Intergenic
1043475835 8:80605463-80605485 ACTTTTTAAAAAATTGAGACGGG + Intergenic
1043499909 8:80842656-80842678 AGCTTTTAAAAGAGTGAGAATGG - Intronic
1043767910 8:84160818-84160840 TGGTTTTTAGGAATTAAGAAAGG - Intergenic
1043794216 8:84515282-84515304 AGCTTTTTAAAAAATTAGACAGG - Intronic
1044054182 8:87547751-87547773 AGCTTTATAAAAATACAGAAAGG - Intronic
1044153951 8:88819254-88819276 AGCTTTTTAAAGATGTAGAATGG - Intergenic
1044422886 8:92018995-92019017 AAGTTTTTAACAATAGATAAAGG - Intronic
1044484750 8:92738751-92738773 AACTTTCTACAAATTGAGAAAGG + Intergenic
1045024563 8:98074195-98074217 ACTTTTTTAAAAAGTGAGGAAGG - Intronic
1045417951 8:101985543-101985565 ATATTTTTAAAAACTGTGAAAGG + Intronic
1045762759 8:105629750-105629772 TGGTGTCTAAAAACTGAGAATGG - Intronic
1045892138 8:107169853-107169875 AGGATTCTCAAAAATGAGAAGGG - Intergenic
1045956218 8:107910884-107910906 AATTTTTTAAAAATAGAGATGGG - Intronic
1045964047 8:108002782-108002804 CTGTGTTTTAAAATTGAGAATGG + Intronic
1046011331 8:108551810-108551832 CTGTTTCAAAAAATTGAGAAGGG + Intergenic
1046017319 8:108620732-108620754 AGGATTCCAAAAATTGAAAAAGG - Intronic
1046066540 8:109203594-109203616 AAGTTTTTAAAAATTCAAAAAGG - Intergenic
1046068214 8:109220965-109220987 TGGTTTTTAATAATTAAGCAAGG + Intergenic
1046169252 8:110483895-110483917 AGGGATTTAAAACTTGAAAATGG - Intergenic
1046332102 8:112731290-112731312 CATTTTTTAAAAAATGAGAAAGG + Intronic
1046795541 8:118367427-118367449 AGGTTTTCAACAATTGATATTGG - Intronic
1046960467 8:120107214-120107236 AAGTTTTTAAAAATCCATAAAGG - Intronic
1047017759 8:120741670-120741692 ATGTTTTTAAAAATTAGGAGGGG - Intronic
1047265159 8:123300476-123300498 AGGTTTTTACAAAGTGATCATGG + Intergenic
1047588523 8:126301336-126301358 AGGGCTTTAAAAAATGAGCATGG + Intergenic
1047726252 8:127686494-127686516 AAGTTCTAAAAAATTGGGAAGGG + Intergenic
1048108646 8:131441813-131441835 AGATTTTATAAAAGTGAGAAAGG + Intergenic
1048449133 8:134516661-134516683 AATTTTTTAAAAATAGAGACAGG - Intronic
1048618091 8:136101311-136101333 TGGTTTTCAAACATGGAGAATGG + Intergenic
1048663014 8:136628495-136628517 ACGTTTTTAAAAATTGGCATTGG + Intergenic
1049652199 8:143775984-143776006 AGGTTGAAAAAAATTGAGGAGGG + Intergenic
1050149916 9:2609199-2609221 AGATTTTTAAAAATTAACCAGGG + Intergenic
1050316262 9:4404129-4404151 AGGTTATTAAATAATGACAAAGG + Intergenic
1050364978 9:4865612-4865634 AGTTTTTAAAAAATAGAGACAGG + Intronic
1050626984 9:7515219-7515241 ATGTTTTTAAAAAAAGAGAATGG + Intergenic
1050820177 9:9869144-9869166 ACTTTTTTATAAATTGATAAAGG + Intronic
1050934205 9:11374201-11374223 AGTATTATAAAAATTGAGTAGGG + Intergenic
1050993311 9:12180390-12180412 ATGTTTTCAAACATTTAGAAAGG - Intergenic
1051271799 9:15362779-15362801 AGGAGTATAAAAATTGTGAAAGG - Intergenic
1052229192 9:26126810-26126832 ATGTTTTTAAACATTGAGATTGG - Intergenic
1052295562 9:26893239-26893261 TCGTTTTTGAAAATTGAGAATGG + Intergenic
1052384557 9:27808154-27808176 AAGTTTTTAAAACTTGGGCAAGG + Intergenic
1052634214 9:31080297-31080319 AAATTTTAAAAAATTGAAAAAGG + Intergenic
1052756371 9:32546737-32546759 AGGCTTATAAAACTAGAGAAGGG - Intronic
1053615760 9:39764383-39764405 AGGTCATTAAATAATGAGAAAGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1053798318 9:41746234-41746256 TGGTTTTTAAAAATAGAGATGGG + Intergenic
1053898691 9:42770896-42770918 AGGTCATTAAATAATGAGAAAGG - Intergenic
1054146878 9:61568719-61568741 TGGTTTTTAAAAATAGAGATGGG - Intergenic
1054186733 9:61958285-61958307 TGGTTTTTAAAAATAGAGATGGG + Intergenic
1054237760 9:62578007-62578029 AGGTCATTAAATAATGAGAAAGG - Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054466616 9:65499774-65499796 TGGTTTTTAAAAATAGAGATGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054551891 9:66612515-66612537 AGGTCATTAAATAATGAGAAAGG - Intergenic
1054651772 9:67630235-67630257 TGGTTTTTAAAAATAGAGATGGG - Intergenic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054843782 9:69771031-69771053 TAGTCTTTAAAAACTGAGAAGGG - Intergenic
1055042462 9:71889910-71889932 ATTTTTTTAAAAAATGAGTATGG - Intronic
1055111309 9:72562687-72562709 TTTTTTTTAAAAATTTAGAAAGG + Intronic
1055134709 9:72814774-72814796 AAGCATTTGAAAATTGAGAATGG + Intronic
1055183955 9:73427591-73427613 AGGTTTTAAAAAATAAAGACAGG - Intergenic
1055326276 9:75133465-75133487 AGATTTACAAAAAATGAGAAAGG + Intronic
1055691313 9:78834385-78834407 AGAGATTTAAAAAATGAGAAAGG + Intergenic
1055762928 9:79628834-79628856 AAATTTTTAAAAGTTGAGAAAGG + Intronic
1055765690 9:79661097-79661119 ACATTTTTAAAAATTTAGAGGGG + Intronic
1055960842 9:81818779-81818801 AGGAATCTAAAAATGGAGAAGGG - Intergenic
1056178983 9:84063100-84063122 AGGTTTTTAAAATATGTGTAGGG + Intergenic
1056741845 9:89263300-89263322 TTGTTTTTAAAAATAGAGATGGG - Intergenic
1056900097 9:90590986-90591008 ATGTTTTTAAAAAATGTTAAAGG - Intergenic
1056994202 9:91440883-91440905 AGTTTTTTAAAATTTGTTAAGGG + Intergenic
1057667051 9:97054298-97054320 ATGTTTTTAAAAACTGATAAAGG + Intergenic
1057717633 9:97507333-97507355 AGAGATTTAAAAATTCAGAATGG + Intronic
1058103244 9:100939587-100939609 ATGTGATTAAAAATTGAGAATGG + Intergenic
1058891428 9:109364558-109364580 TGTTTTTTAAAAATAGAGACGGG - Intergenic
1058907428 9:109493228-109493250 TGTTTTTTAAATATAGAGAAAGG - Intronic
1059195178 9:112364625-112364647 AATTTTTTAAAAATAGAGACAGG - Intergenic
1059493382 9:114688714-114688736 AGTTTTTTAAAAAAGAAGAAAGG - Intergenic
1059872646 9:118595148-118595170 AGTTTTTAAAAAAGGGAGAATGG - Intergenic
1060167220 9:121428266-121428288 TGGTTATTAAAGGTTGAGAAAGG + Intergenic
1060382809 9:123192583-123192605 CCCTTTTTAAAAATTGAGATGGG - Intronic
1203483559 Un_GL000224v1:30163-30185 CGCTTTTTAAAAAATGAGACCGG + Intergenic
1203627518 Un_KI270750v1:38381-38403 AACTTTTTAAAAATAGAGATGGG + Intergenic
1186437378 X:9554175-9554197 ATATTTTTAAAAATTGAGACTGG - Intronic
1186820633 X:13284575-13284597 AGGGCTTCAAAAATTGATAAAGG + Intergenic
1187167359 X:16816475-16816497 AGTTTTTCAAAAATTCACAATGG - Intronic
1187474143 X:19595234-19595256 AGGCTGTTACAAATTTAGAAAGG - Intronic
1187480002 X:19646765-19646787 ATGTTTTTAAAAATTCATGAAGG - Intronic
1188096968 X:26035161-26035183 AGGGTTTTAAAAATAAAGGAGGG - Intergenic
1188613574 X:32129958-32129980 AAGTCTTTGAAAAATGAGAAAGG - Intronic
1188635320 X:32422878-32422900 CGGTTTTAAAAAGTTGAGAGTGG + Intronic
1189000845 X:36943339-36943361 ATGTTTTTATAAATTGAACATGG + Intergenic
1189185997 X:39055645-39055667 ACTTTTTTAAAAAGTGTGAAGGG - Intergenic
1189473478 X:41332558-41332580 TCGATTTTAAAAATTGAGAAGGG + Intergenic
1189966017 X:46374357-46374379 AGGTTTTTCAAAGTTGAGGCAGG - Intergenic
1190490826 X:50981492-50981514 AGCCTTTTAATAATTGAGTAAGG + Intergenic
1190760725 X:53435821-53435843 AGTTTTTTTCAATTTGAGAAAGG + Intergenic
1190933384 X:54970208-54970230 AGGTTTTTAAAAATAGATTTTGG - Intronic
1191100008 X:56716451-56716473 CGGTTTTGAAAAATTGAGGAGGG + Intergenic
1191179385 X:57543580-57543602 AGGTTATTATATATTGATAAAGG + Intergenic
1191798073 X:65044468-65044490 AGGCATTGAAAAATTGAGAGAGG + Intergenic
1191838566 X:65491776-65491798 TGATTTTAAAAAATTGAAAAAGG - Intronic
1191977406 X:66888723-66888745 AGTTTTTAAAAAGTTGATAATGG + Intergenic
1192367794 X:70489125-70489147 TGTTTTTTGAAAATTGTGAAAGG + Intronic
1192448393 X:71227112-71227134 AATTTTTTAAAAATAGAGATGGG - Intergenic
1192469489 X:71385259-71385281 AGGTTTTTAAAAATACACACTGG + Intronic
1192805953 X:74509385-74509407 AGTTTTTTTAAAATTTTGAATGG + Intronic
1193216567 X:78871134-78871156 GGGTTTTTTAGACTTGAGAAAGG + Intergenic
1193517550 X:82487673-82487695 AATTTTTTAAAAATTGAAAATGG + Intergenic
1193712675 X:84897315-84897337 AGGTTTTAAAAAATAAAGATGGG + Intergenic
1194116677 X:89908087-89908109 TGATTTTTAAAAATTGAGGCGGG + Intergenic
1194284799 X:91996447-91996469 TGATTTTTAAAAATGAAGAAGGG - Intronic
1194514638 X:94836936-94836958 ACATTTTTAAAAAATGAAAAGGG - Intergenic
1194613098 X:96067641-96067663 AGTTTTTTAAAGACTGAGAAGGG - Intergenic
1194699741 X:97099033-97099055 AGGTTTTGAAAAATTATGAATGG + Intronic
1194871574 X:99139148-99139170 ATGTATTTAAAAATTAATAAAGG + Intergenic
1194896718 X:99451337-99451359 AAGTCTTCAAAAACTGAGAAAGG - Intergenic
1195491146 X:105471380-105471402 ATGTTTTTGAAAGTTGAGAAAGG + Intronic
1195497489 X:105553920-105553942 ATGCTTTTCAAAATTGGGAAAGG - Intronic
1195561092 X:106284737-106284759 AGATTTTTAAAAATTCAGTCAGG + Intergenic
1195582266 X:106519151-106519173 AGTATTTTAAAAATTAAAAAAGG - Intergenic
1196044253 X:111240220-111240242 AGTTTTTTTAAAAATGTGAATGG - Intergenic
1196062284 X:111423031-111423053 AATTTTTTAAAAATTATGAATGG + Intergenic
1196550666 X:117020158-117020180 AGGTTATTACATATTGATAAAGG + Intergenic
1196704974 X:118709659-118709681 GGTTTTTTAAAACTTGAGATAGG - Intergenic
1197057180 X:122135231-122135253 AGGTTTTTATGAACTGGGAAGGG + Intergenic
1197237281 X:124081663-124081685 TGGTTCTTTAAAATTAAGAAAGG - Intronic
1197831150 X:130644826-130644848 GGGTTTTGAAAAATTTAAAATGG - Intronic
1198153815 X:133937306-133937328 AGGTTTATTATAATTAAGAATGG - Intronic
1198433862 X:136596109-136596131 TAATTTTTAAAAAATGAGAATGG - Intergenic
1198614159 X:138436123-138436145 AAGTTTTTAAAAATCATGAATGG - Intergenic
1200469472 Y:3565253-3565275 TGATTTTTAAAAATTGAGGCAGG + Intergenic
1200602366 Y:5221017-5221039 TGATTTTTAAAAATGAAGAAGGG - Intronic
1200981159 Y:9264414-9264436 TGGTTCTTGAGAATTGAGAAAGG + Intergenic
1202106260 Y:21370200-21370222 ATATTTTTAAAGATAGAGAAGGG + Intergenic