ID: 1084790016

View in Genome Browser
Species Human (GRCh38)
Location 11:71469043-71469065
Sequence CTGAATCCACAGATCAACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 770
Summary {0: 1, 1: 4, 2: 16, 3: 118, 4: 631}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084790016_1084790017 4 Left 1084790016 11:71469043-71469065 CCTAAGTTGATCTGTGGATTCAG 0: 1
1: 4
2: 16
3: 118
4: 631
Right 1084790017 11:71469070-71469092 GTTTCCATAAGAATCTGAACAGG 0: 1
1: 0
2: 1
3: 8
4: 154
1084790016_1084790019 20 Left 1084790016 11:71469043-71469065 CCTAAGTTGATCTGTGGATTCAG 0: 1
1: 4
2: 16
3: 118
4: 631
Right 1084790019 11:71469086-71469108 GAACAGGAAATTCAATAAACTGG 0: 1
1: 1
2: 1
3: 27
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084790016 Original CRISPR CTGAATCCACAGATCAACTT AGG (reversed) Intronic
900296322 1:1952984-1953006 TTGAATCTATAGATCAATTTGGG - Intronic
900775868 1:4585186-4585208 CTGACTCCACACATCCACATGGG - Intergenic
900811906 1:4809818-4809840 TTGAATCTATAGATCAAGTTGGG - Intergenic
902140922 1:14353851-14353873 TGGAATTTACAGATCAACTTAGG - Intergenic
902157576 1:14501717-14501739 TTGAATCCATAGATCACTTTGGG - Intergenic
902903930 1:19540353-19540375 TTGAATCCATAGATCAAGTTGGG + Intergenic
903150959 1:21408418-21408440 TTGAATCTATAGATCAATTTGGG + Intergenic
903170545 1:21550025-21550047 TTAAATCCACAGATCAATGTGGG - Intronic
903644169 1:24882350-24882372 CTGAATCTATAGATCAGGTTGGG + Intergenic
904958823 1:34314033-34314055 TTGAATCTATAGATCAAATTGGG + Intergenic
905288080 1:36898607-36898629 TTGAATCTACAGATCACTTTGGG - Intronic
905483553 1:38278868-38278890 CTGAATCAATAGATCAGTTTGGG + Intergenic
905558102 1:38903650-38903672 TTGAATCTATAGATCAACTTGGG - Intronic
905713795 1:40130771-40130793 TTGAATCTGCAGATCAATTTGGG + Intergenic
905738891 1:40352186-40352208 CTGGGTCCACAGATGGACTTTGG - Intronic
905963893 1:42072231-42072253 TTGAATCTATAGATCAAATTGGG + Intergenic
906333367 1:44906899-44906921 CTGGATCCCCAAATGAACTTCGG + Intronic
906368735 1:45234257-45234279 TTGAATCTACAGATAAATTTGGG - Intronic
906951609 1:50339054-50339076 TTGAATCTATAGATCAAGTTAGG + Intergenic
907070363 1:51529077-51529099 CTGAATCAGTAGATCAATTTGGG - Intergenic
907154312 1:52319273-52319295 TTGAAGCTACAGATCAATTTGGG - Intronic
907656625 1:56349296-56349318 CTAAATCCATAGATCAATCTGGG + Intergenic
907800013 1:57755251-57755273 TTGAATCTATAAATCAACTTGGG + Intronic
908012693 1:59797333-59797355 CTGAATCTGTAGATCAATTTGGG + Intergenic
908576305 1:65463590-65463612 CTGAATCCATAAATTACCTTGGG + Intronic
908793613 1:67808866-67808888 CTGAATCTATAGGTCAAGTTAGG - Intronic
908803990 1:67910704-67910726 CAGAATCTACAGTTTAACTTAGG + Intergenic
908813146 1:68004690-68004712 CTGAATCCATAAATTACCTTGGG + Intergenic
908895867 1:68897636-68897658 CTGAATCCACACACCATTTTTGG - Intergenic
909589567 1:77330778-77330800 TTTAATCTACAGATCAATTTGGG + Intronic
909887013 1:80954525-80954547 CTGAATCTACAGATCAATTTGGG - Intergenic
910412321 1:86959867-86959889 CTGAATCTATAGATCACGTTGGG - Intronic
911250068 1:95565559-95565581 TTGAATCTATAGATCAATTTGGG + Intergenic
911342484 1:96655839-96655861 CTGAATCTACAAATTACCTTGGG - Intergenic
911425731 1:97708704-97708726 CTGAATCTATAGATCTAATTGGG + Intronic
912767149 1:112424584-112424606 TTGAATCTAGAGATCAATTTGGG + Intronic
912784574 1:112587881-112587903 CTGAATCCGTAGATCAATTTAGG + Intronic
913468449 1:119167489-119167511 TTGAATCCATAGATCAATCTGGG + Intergenic
913598516 1:120401018-120401040 TTGAATTCATAGATCAAATTAGG - Intergenic
914088811 1:144478300-144478322 TTGAATTCATAGATCAAATTAGG + Intergenic
914309802 1:146455911-146455933 TTGAATTCATAGATCAAATTAGG - Intergenic
914592309 1:149117229-149117251 TTGAATTCATAGATCAAATTAGG + Intergenic
915388250 1:155517024-155517046 TTGAATCTACAGATCACTTTAGG - Intronic
915707343 1:157858010-157858032 CTAAATCTATAGATCAATTTAGG - Intronic
915851520 1:159329124-159329146 CTGAATCTATAAATCACCTTGGG - Intergenic
915871728 1:159567802-159567824 TTAAATCTACAGATCAAGTTGGG - Intergenic
916559591 1:165922250-165922272 TTGAATCCATAGATCAATTTGGG + Intergenic
917001084 1:170360526-170360548 TTGAATCTACAGATTAATTTAGG - Intergenic
917008332 1:170441407-170441429 TTGAATCTATAGATCAATTTGGG - Intergenic
917060135 1:171028594-171028616 CTGAATCTATAAATTAACTTGGG + Intronic
917568572 1:176237710-176237732 CTGAATCTATAGATCATGTTAGG + Intergenic
917991919 1:180388977-180388999 TTGAATCTATAGATCAGCTTGGG - Intronic
918090041 1:181282700-181282722 TTGAATCTACAGATCAAGTTGGG + Intergenic
918115131 1:181489657-181489679 CTGAATCCTCTCATCATCTTGGG + Intronic
918227713 1:182500574-182500596 CTGAATCTATAGATCATTTTGGG + Intronic
918274127 1:182935245-182935267 CTGGATCTACAGATCAAGTTGGG + Intronic
918532120 1:185535041-185535063 GTGAATCTACAGATCATTTTGGG + Intergenic
918539895 1:185619727-185619749 ATGAATCTATAGATCAAGTTGGG + Intergenic
918665658 1:187147259-187147281 TTGAATCTATAGATCAAGTTGGG + Intergenic
918882200 1:190139045-190139067 CTAAATCCAAAGTTCAACTCTGG - Intronic
919004197 1:191873416-191873438 CTGAATCTATAGACCAATTTTGG - Intergenic
919459469 1:197858965-197858987 CTGAAGCCAGTGACCAACTTTGG - Intergenic
919644322 1:200078500-200078522 TTGAATGCACAGAACAACTGAGG + Intronic
920985013 1:210880162-210880184 TTAAATCTACAGATCAATTTGGG - Intronic
921093289 1:211863545-211863567 TTGAATCTACAGATCAAGTTGGG + Intergenic
922254521 1:223881893-223881915 TTGAATATACAGATCAATTTTGG - Intergenic
923013165 1:230104997-230105019 CTGAATCCACAGCGCCACTGTGG - Intronic
923059840 1:230461338-230461360 TTGAATCTATAGATCAAGTTAGG - Intergenic
923619071 1:235562721-235562743 TTGAATCTACAGATCAAGTTGGG + Intronic
924084108 1:240431015-240431037 TTGAATCCATAGAACAATTTGGG + Intronic
924505144 1:244675833-244675855 GTGAATCTTCAGGTCAACTTGGG + Intronic
1063732259 10:8711187-8711209 TTGAATCTCCAGATCAATTTGGG + Intergenic
1063927209 10:10992187-10992209 ATGAATCTACAGATCAACAATGG + Intergenic
1063954543 10:11254282-11254304 TTGAAACCACGGAGCAACTTTGG + Intronic
1064496429 10:15915356-15915378 CTGAATCCAAAGATCAACTAGGG + Intergenic
1064939795 10:20721064-20721086 TTGAATCTACAAATCACCTTGGG + Intergenic
1065365531 10:24932708-24932730 TTGAATCTATAGATCAATTTGGG - Intronic
1065573458 10:27095890-27095912 AGGAATCCACAGATCCACTTTGG + Intronic
1065574789 10:27106271-27106293 AGGAATCCACAGATCCACTTTGG + Intergenic
1065607549 10:27435006-27435028 ATAAATCTACAGATCAATTTGGG - Intergenic
1066424470 10:35293530-35293552 CTGAATCTGTAGGTCAACTTGGG + Intronic
1066519659 10:36201809-36201831 CTGAATCTACAGATCAAGTTGGG + Intergenic
1067347729 10:45448926-45448948 CTGTATTCACCCATCAACTTAGG - Intergenic
1068481939 10:57601088-57601110 CTGAATTCACAGACAAATTTGGG - Intergenic
1068824829 10:61424482-61424504 TTGAATCTAAAGATCAATTTGGG - Intronic
1069022891 10:63508547-63508569 TTGAATCTATAGATCAAGTTGGG + Intergenic
1069154287 10:65006192-65006214 CTGAATCTATAGATCAAGTTGGG + Intergenic
1069468633 10:68665340-68665362 TTGAATCTAGAGATCAATTTTGG + Intronic
1069644594 10:69984205-69984227 CTGAATATACAAATCAAGTTAGG - Intergenic
1069778072 10:70938304-70938326 CTGGATCCTCAGATCGATTTGGG - Intergenic
1070260241 10:74847814-74847836 CGGGATCCACAAATGAACTTGGG + Intronic
1070317198 10:75325683-75325705 ATGAATCTACAGATCAATTTGGG + Intergenic
1071036638 10:81255312-81255334 CTGAATCTGTAGATCAATTTGGG + Intergenic
1071047112 10:81393699-81393721 CAGAATCTACAGATCACATTGGG + Intergenic
1071156646 10:82697390-82697412 CAAAATCCAGAGATCACCTTGGG - Intronic
1071214340 10:83381849-83381871 TTGTATCTACAGATCAAGTTGGG - Intergenic
1072264120 10:93711206-93711228 CTGAAACCACAGTTTAACTCTGG + Intergenic
1072908546 10:99478921-99478943 TTGAATCTACAGATCATTTTGGG - Intergenic
1073278394 10:102332737-102332759 CAGGATCCATAGATCCACTTAGG - Intronic
1073283423 10:102371497-102371519 TTGAATTTACAGATCAATTTGGG - Intronic
1073957099 10:108885171-108885193 CTGAATCTATAGATCACTTTGGG - Intergenic
1074055212 10:109917551-109917573 TTGAGTCCATAGATCAATTTGGG - Intronic
1074628805 10:115225793-115225815 TTAAATCTACAGATCAATTTGGG - Intronic
1074957117 10:118402759-118402781 CTGAATCCATGGATCAATTTGGG + Intergenic
1075267579 10:121016460-121016482 TTGAATCCACAGATAAAACTGGG - Intergenic
1075488030 10:122842675-122842697 CTGAATTTATAGATCAACCTGGG + Intronic
1075501210 10:122976353-122976375 TTGAATCTATAGATCAAGTTGGG - Intronic
1076352612 10:129828253-129828275 CTGAATCTGTAGATCAATTTTGG + Intergenic
1076669950 10:132114666-132114688 TTGAATCTATAGATCAATTTGGG + Intronic
1077234741 11:1474995-1475017 CTAAATCAACAGATCAGTTTGGG + Intronic
1077503026 11:2917739-2917761 CTGAATCCCCAGAGGCACTTAGG - Intronic
1078050255 11:7959481-7959503 TTGAATCTACAGATCAAACTGGG + Exonic
1078611712 11:12825579-12825601 CTGAATCTACAAATCATTTTAGG - Intronic
1078881604 11:15454835-15454857 TTGAATCTATAGATCAATTTGGG + Intergenic
1078977135 11:16491448-16491470 CTGAATCTCCAGATTAATTTGGG - Intronic
1078992128 11:16659593-16659615 TTGACTCCATAGATCAAGTTGGG + Intronic
1079072644 11:17361256-17361278 TTGAATCTAGAGATCAAGTTGGG + Intronic
1080247623 11:30197451-30197473 CTGAAGTCACAGATCTACTGTGG - Intergenic
1080273537 11:30476814-30476836 CTGAATCTACAGATCAATTTAGG + Intronic
1080311854 11:30903654-30903676 CAGAATGCACGGAACAACTTGGG - Intronic
1081422355 11:42884360-42884382 TTGAATCTACAGATAAATTTGGG - Intergenic
1081839761 11:46190584-46190606 CTGAATCTATAAATCAAGTTGGG - Intergenic
1084015493 11:66377787-66377809 CTTAATCTATAGATCAAGTTGGG + Intergenic
1084282887 11:68110622-68110644 TTAAATCTACAGATCAAGTTGGG - Intronic
1084312880 11:68326888-68326910 CTGAAGCCACACAGCAACCTAGG - Intronic
1084314072 11:68333848-68333870 CTGAATCCACTGATCAATCTGGG - Intronic
1084790016 11:71469043-71469065 CTGAATCCACAGATCAACTTAGG - Intronic
1085612688 11:77966845-77966867 CTGAATCTGCAGATCATTTTGGG + Intronic
1085654768 11:78303732-78303754 CTGAATCTATTGATCAATTTAGG + Intronic
1086000651 11:81980962-81980984 TTGAATCTATAGATCAACTTTGG + Intergenic
1087001688 11:93427048-93427070 CTGAATCTACAAATTACCTTGGG - Intronic
1087302128 11:96447932-96447954 CTGCATGCAGAGTTCAACTTTGG + Intronic
1087808670 11:102585176-102585198 TTGAATCTACAGATCAATTTGGG + Intronic
1088370110 11:109079647-109079669 CTGAATCTATAAATTAACTTGGG + Intergenic
1088710343 11:112502390-112502412 TTGAATCTATAGATCAAATTGGG + Intergenic
1088752724 11:112858341-112858363 CAGACAACACAGATCAACTTTGG + Intergenic
1088943951 11:114490280-114490302 ATGAATCCATAAATCATCTTGGG - Intergenic
1088960624 11:114661175-114661197 TTGAATCTATAGATCAATTTTGG - Intergenic
1089726689 11:120486815-120486837 CTAAAAACACAGATCAATTTAGG - Exonic
1090112762 11:123933275-123933297 TTGAATCCATAGATCAATTTAGG + Intergenic
1090113051 11:123937044-123937066 TTGAATCTATAGATCAAATTGGG + Intergenic
1090792922 11:130107638-130107660 CTGAATCTACAAATTACCTTGGG - Intronic
1090841476 11:130492062-130492084 CTGGATCTATAGATCAAGTTAGG + Intergenic
1091072942 11:132586074-132586096 CTGAGTCCACAGACCCACATGGG + Intronic
1091249553 11:134131127-134131149 CTGAATCTAGAGATCAGCCTGGG - Intronic
1091454318 12:594753-594775 TTGAATCTATAGATCAAGTTAGG - Intronic
1091949130 12:4577695-4577717 TTGAATCTACAGATTAAGTTGGG + Intronic
1092037839 12:5355185-5355207 TTGAATCTATAGGTCAACTTGGG - Intergenic
1092593270 12:9971388-9971410 CTGAAGCCACAGATGAGATTTGG + Intronic
1093399991 12:18734044-18734066 TTGAATCTATAGATCACCTTGGG + Intronic
1093488198 12:19675793-19675815 CTGAATTTATAGATCAATTTGGG + Intronic
1093631175 12:21411645-21411667 TTGAAGCTACAGATCAATTTGGG + Intronic
1093759088 12:22886124-22886146 TTGAATCTATAGATCAAGTTGGG + Intergenic
1093900806 12:24629663-24629685 TTGAATCTACAGATAAATTTGGG + Intergenic
1094056965 12:26277855-26277877 CTGACTCCACAAAATAACTTAGG - Intronic
1094758661 12:33501920-33501942 CTGAATCTATAGATCACTTTGGG + Intergenic
1094771530 12:33667060-33667082 GTGAGTCTACAGATTAACTTGGG + Intergenic
1095922497 12:47544742-47544764 CTGAAACCACAGAGCCACCTTGG + Intergenic
1096435545 12:51588197-51588219 TTGAATCTGTAGATCAACTTGGG - Intergenic
1097551615 12:61078565-61078587 CTGAATCCATAAATTACCTTGGG - Intergenic
1097965659 12:65577597-65577619 TTGAAGCTACAGATCAATTTGGG - Intergenic
1098808521 12:75053170-75053192 CTAAATCTACAGATAAAATTGGG - Intronic
1099026654 12:77472837-77472859 CTGAATCTGTAGATCACCTTGGG - Intergenic
1099243908 12:80171724-80171746 TTAAATCTACAGATCAATTTGGG + Intergenic
1099306426 12:80961940-80961962 TTAAATCTACAGATCAATTTGGG + Intronic
1099710144 12:86213216-86213238 CTAAATTGACAGATCAATTTGGG + Intronic
1100298376 12:93284207-93284229 TTGAATCTATAGATCAATTTAGG - Intergenic
1100683395 12:96956320-96956342 CCGAATCTACAGATCAATGTGGG - Intergenic
1100735855 12:97530073-97530095 CTGATTCCACAGGTTGACTTGGG + Intergenic
1101279157 12:103233390-103233412 CTGAATCTATAGATCAAGTTGGG + Intergenic
1102203168 12:111072181-111072203 CTGAGTCTATAGATCAAGTTGGG + Intronic
1103279847 12:119748204-119748226 AGGAGTCCACAGATCCACTTTGG + Intronic
1104984872 12:132591073-132591095 CTGAACCCACAGTTCCACGTTGG - Intergenic
1105441978 13:20422853-20422875 CTGAATCTGTAGATCACCTTGGG + Intronic
1105554582 13:21433723-21433745 CTGAACTTACAGATCAACTTGGG + Intronic
1105730217 13:23206889-23206911 CTGAATCTACAGATCACTTTTGG - Intronic
1106262658 13:28081193-28081215 CTGAATCACTAGATCAATTTGGG + Intronic
1106299997 13:28455076-28455098 TTGAATCTGCAGATCAAGTTGGG - Intronic
1106771644 13:32966834-32966856 TTGAATCTATAGATCAAGTTGGG + Intergenic
1107318655 13:39161849-39161871 CTGATTCCACAGATTCTCTTTGG + Intergenic
1107330342 13:39292956-39292978 CTCAATCCACACAAGAACTTGGG - Intergenic
1107763417 13:43707323-43707345 TTGAATCTACAAATCAACTTTGG - Intronic
1107767542 13:43753235-43753257 TTGAATCTATAGATCAATTTGGG + Intronic
1107843739 13:44488859-44488881 CTGAATCTACAGATGAATTTGGG - Intronic
1107847333 13:44529996-44530018 CTGAATCTAAAGATCAAGTTGGG - Intronic
1108427400 13:50317338-50317360 TTGAATCCATAGATCAAATTGGG - Intronic
1108464635 13:50702417-50702439 TTGAATCTACAGATCACTTTAGG - Intronic
1109239684 13:59870541-59870563 TTGAACCCATAGATCAAGTTGGG + Intronic
1109418466 13:62076342-62076364 CTGAATCCATAAATCAGTTTAGG + Intergenic
1109591699 13:64492156-64492178 CAAAATCCACAGAACAATTTGGG + Intergenic
1110243868 13:73299471-73299493 ATGAATCTACAGAGCATCTTTGG - Intergenic
1110827015 13:79983202-79983224 CAGAATCTATAGATCAAGTTGGG + Intergenic
1110894330 13:80730229-80730251 ATCGATCCACAGAACAACTTGGG + Intergenic
1111341129 13:86887859-86887881 TTGAATCTATAGATCAATTTGGG - Intergenic
1111412842 13:87898483-87898505 CTGAATCCATAAATTACCTTGGG - Intergenic
1111776012 13:92662784-92662806 CTGATTCCACAGGGAAACTTTGG - Intronic
1111787842 13:92813818-92813840 CTGAATGTACAGATTAATTTAGG - Intronic
1111946021 13:94666737-94666759 CTTCATCCACAGATCTACATAGG + Intergenic
1112153292 13:96788302-96788324 CTAAATTCATAGATCAACTTGGG + Intronic
1113275451 13:108723889-108723911 TTGAATCTACAGATCAATTTGGG + Intronic
1114505931 14:23213430-23213452 TTGAATCTATAGATCAAATTGGG - Intronic
1114520756 14:23333700-23333722 CTGAATCTGTAGATCAATTTAGG + Intergenic
1115167681 14:30467469-30467491 TTGAATCCACAGAACAATTTGGG - Intergenic
1115169424 14:30487343-30487365 TTGAATCTATAGATCAAGTTGGG - Intergenic
1115193174 14:30768891-30768913 CTGAACAAACAGATGAACTTTGG + Intergenic
1115639877 14:35327832-35327854 TTGAATCTATAGATCAAGTTGGG - Intergenic
1115686542 14:35802596-35802618 TTGAATCTATAGATCAATTTGGG - Intronic
1115706025 14:35998862-35998884 CTGCATCTGCAGATGAACTTCGG + Intergenic
1115719170 14:36141301-36141323 TTGAATCTATAGATCAAGTTGGG + Intergenic
1116192963 14:41683871-41683893 CTGAATCTATAGATTACCTTGGG - Intronic
1116271980 14:42783379-42783401 CTGACTTCATAGTTCAACTTGGG - Intergenic
1116307694 14:43279374-43279396 CAGAAACTACAGATCAACTTGGG + Intergenic
1116563170 14:46409715-46409737 CTGATTCCACATATTAAATTTGG + Intergenic
1116665782 14:47773186-47773208 TTGAATTTACAGATCAAGTTTGG - Intergenic
1117259339 14:54014625-54014647 TTGAATCCAGAGATCAAGTTGGG + Intergenic
1118794273 14:69126488-69126510 TTGAATCCATAGATGAAGTTGGG - Intronic
1118840910 14:69510262-69510284 TTGAATCTATAGATCAAGTTGGG + Intronic
1119413234 14:74451000-74451022 ATGAATCCATAGATCAATCTGGG - Intergenic
1119801159 14:77446517-77446539 TTGAATGTACAGATCAATTTTGG - Intronic
1119822394 14:77628720-77628742 CTGAATCTGTAGATCAATTTGGG - Intergenic
1120078988 14:80193765-80193787 TTGAATCTACAGATCACATTGGG - Intergenic
1120336242 14:83159109-83159131 CTGAATCTATAGATTAATTTGGG - Intergenic
1120581832 14:86261153-86261175 ATGAATCTATAGATCAAATTTGG + Intergenic
1120792063 14:88593301-88593323 TTGAATCCATAGATCAACTTGGG - Intronic
1121036825 14:90712684-90712706 CTGAATCTTTAGATCAATTTGGG - Intronic
1121065332 14:90958279-90958301 TTGCATCCATAGTTCAACTTAGG + Intronic
1121372598 14:93374162-93374184 CTGCTTCCACAGTTCCACTTAGG - Intronic
1121430872 14:93887397-93887419 TTGAATCTATAGATCAAGTTGGG + Intergenic
1121510524 14:94509710-94509732 GTGAATCTACAGAGCACCTTGGG - Intronic
1122305108 14:100760199-100760221 TTGACTCTACAGATCAATTTGGG - Intergenic
1122381728 14:101312055-101312077 CTGAATCTATAGATCAAATTGGG - Intergenic
1123453463 15:20390735-20390757 TTGAATCTATAGATCAATTTTGG + Intergenic
1123953089 15:25303691-25303713 TTGAATCTACAGATCACTTTGGG + Intergenic
1124029553 15:25997467-25997489 TTGGATCTACAGATCAACTTGGG + Intergenic
1124586008 15:31007747-31007769 TTAAATCTACAGATAAACTTGGG + Intronic
1125167001 15:36718421-36718443 TTGAATTTACAGATCAATTTGGG + Intronic
1126658625 15:51008800-51008822 TTGAATCTAAAGATCAAGTTGGG + Intergenic
1127340210 15:58034055-58034077 TTGAATCTACATATTAACTTGGG + Intronic
1127406862 15:58658565-58658587 CTGAATCTGCAGAACAATTTGGG + Intronic
1128094266 15:64942085-64942107 TTTAATCCACACATCAACCTAGG - Intronic
1128421719 15:67497932-67497954 TTGAATCTATAGATCAATTTGGG - Intronic
1128559767 15:68656836-68656858 CTGAATCCTCAGAACAGCCTCGG - Intronic
1131065808 15:89434365-89434387 CTGAATGCACTGATGAGCTTAGG + Intergenic
1132189506 15:99839470-99839492 CTGACTCCACAGGGAAACTTTGG + Intergenic
1132422311 15:101681343-101681365 CTGACTTTATAGATCAACTTGGG + Intronic
1133540310 16:6746186-6746208 TTGAATCTACAGATCAATTAGGG - Intronic
1133863626 16:9620577-9620599 TTGAATCTATAGATCAAATTAGG - Intergenic
1134438162 16:14280879-14280901 TTGAATCTACAGATGAATTTGGG - Intergenic
1135273732 16:21092038-21092060 TTGAATCTATAGATCAAGTTGGG - Intronic
1135275429 16:21108346-21108368 ATGAATGCACTGATCAACTAAGG + Intronic
1135749696 16:25047380-25047402 TTGACTCCATAGATCAATTTGGG - Intergenic
1135996076 16:27249828-27249850 TTGAATCTATAGATCAATTTGGG + Intronic
1136991749 16:35156310-35156332 CTGAATCCACAGATTGCTTTGGG + Intergenic
1137436634 16:48459875-48459897 TTGAATCTATAGATCAAGTTAGG + Intergenic
1137819867 16:51433898-51433920 TTGAATGCACAGAACATCTTTGG + Intergenic
1139051808 16:63132996-63133018 ATGCATGCACAGAGCAACTTTGG - Intergenic
1140693452 16:77507734-77507756 GTGAATCTAGAGATCAATTTGGG + Intergenic
1141902462 16:87000870-87000892 CTGAATCTATAGATCGATTTGGG - Intergenic
1143308111 17:5964809-5964831 TTGAATCTATAGATCAAGTTAGG + Intronic
1143989892 17:10948323-10948345 TTGAATCTACAGATCAAGTTTGG + Intergenic
1144048463 17:11474914-11474936 TTGAATCTATAGATCAAGTTGGG + Intronic
1145045213 17:19608879-19608901 CTGAATCTGTAGATCAACTTAGG - Intergenic
1145726398 17:27130044-27130066 TTGAATCCATAAATGAACTTGGG + Intergenic
1146231289 17:31113138-31113160 CTGAGTCCATGGATCAACTTTGG + Intronic
1146554105 17:33808593-33808615 CTGAATCTATGGATCAAGTTGGG + Intronic
1146970911 17:37071362-37071384 CTGACTCTATAGATCAATTTGGG + Intergenic
1148247187 17:46040714-46040736 CTGACTCTACAGATCAATTTGGG + Intronic
1148324922 17:46777681-46777703 CTGAATCCTCACAACAACTCTGG + Intronic
1148455703 17:47810236-47810258 CTGAGTCCTGAGATCAATTTAGG + Intronic
1148675731 17:49443770-49443792 CTGAATCCCCTGGTCATCTTTGG + Intronic
1148842599 17:50508529-50508551 GCGCATCCACCGATCAACTTGGG - Exonic
1149853613 17:60058180-60058202 CTGAATCTATAGATCAAGTTGGG + Intronic
1149939719 17:60850882-60850904 CTGAATGCATAGATCAACTTAGG - Intronic
1150461101 17:65353644-65353666 TTGAATCTACAGATCAGTTTAGG - Intergenic
1150480987 17:65510453-65510475 CTGAATCTATAGATCAATTTGGG - Intergenic
1153751358 18:8234179-8234201 CTGAATCTATAGATCAATTTGGG + Intronic
1154948947 18:21189216-21189238 TTGAATCTACAGATCACTTTTGG + Intergenic
1154951320 18:21212893-21212915 ATGAATCTATAGATCAAGTTGGG + Intergenic
1155106529 18:22671828-22671850 ATGAATTCTCAGATGAACTTTGG - Intergenic
1155366039 18:25050018-25050040 CTAAATCCACACAACAACCTCGG - Intergenic
1155513602 18:26601582-26601604 TTGAATCTGCAGATCAATTTGGG + Intronic
1156380072 18:36550515-36550537 TTAAATCCACAGATCACTTTGGG + Intronic
1157509324 18:48258613-48258635 TTGAATCTACAGATCAATTTGGG - Intronic
1157707822 18:49822316-49822338 TTTAATCTATAGATCAACTTGGG + Intronic
1157961840 18:52162981-52163003 TTGAATCTATAGATCAATTTGGG + Intergenic
1158919226 18:62171067-62171089 TTAAATCCACAGACCAACTGGGG + Intronic
1159255899 18:65945308-65945330 TTGAATCCTTAGATTAACTTAGG + Intergenic
1159579831 18:70222652-70222674 TTGAATCTGCAGATCAATTTGGG - Intergenic
1159588488 18:70305625-70305647 TTGAATCTATAGATCAATTTTGG + Intronic
1160056384 18:75485569-75485591 TTGAATCTAAAGATCAAATTAGG - Intergenic
1160472616 18:79151017-79151039 CTGAATCTACAGATCAATTTAGG - Intronic
1160536229 18:79595257-79595279 TTGAATCTATAGATCAAATTGGG - Intergenic
1161184791 19:2910038-2910060 TTGAATCTATAGATCAAGTTGGG + Intronic
1163226852 19:15968490-15968512 TTGAATCTATAGATCAAGTTGGG - Intergenic
1164113388 19:22192374-22192396 CTGAATCTAGAGATCACTTTGGG - Intronic
1164304435 19:23992287-23992309 CTGAATGTACAGAGCCACTTTGG - Intergenic
1164644790 19:29850580-29850602 CTGAAGCTATAGATCAATTTGGG - Intergenic
1164815529 19:31198851-31198873 CTGAGTCTATAGATCAAGTTGGG - Intergenic
1164887298 19:31791870-31791892 TTGAATCAATAGATCAATTTGGG - Intergenic
1164893784 19:31850296-31850318 TTGAATCTATAGATCAAGTTGGG - Intergenic
1165011863 19:32854350-32854372 TTGAATCCATAGATCAACTGGGG - Intronic
1165375951 19:35442056-35442078 CTGAATCCATAGATCAATTTGGG - Intergenic
1165876516 19:39011464-39011486 CTGAATCTGTAGATCAATTTAGG + Intronic
1166463582 19:43012711-43012733 TTGAATCCACAGCTCACTTTGGG - Intronic
1166581762 19:43906934-43906956 TTGAATCCATAGGTCAATTTGGG - Intergenic
1167400367 19:49263507-49263529 CTGAATCTGTAGATCAATTTGGG - Intergenic
1168495867 19:56849837-56849859 CTGAATCTACACATCACTTTGGG + Intergenic
1168698721 19:58421875-58421897 TTGAATCTGCAAATCAACTTTGG - Intergenic
925287301 2:2724184-2724206 AGGGATCCACACATCAACTTGGG + Intergenic
925560600 2:5189805-5189827 TTGAATACACAGGGCAACTTGGG - Intergenic
925565364 2:5247968-5247990 CTGAATCTATAGATCAAGTTGGG - Intergenic
925765154 2:7226275-7226297 CTAAAGCCTCAGATCGACTTGGG - Intergenic
926481829 2:13408489-13408511 TTGAATCTATAGATCAATTTTGG - Intergenic
927002173 2:18808953-18808975 CTGAAACTATAGATGAACTTAGG - Intergenic
927734323 2:25504786-25504808 CTGAATCAATAGATCTATTTGGG - Intronic
927736606 2:25528964-25528986 CTGAATCTAAAGATCAAATTGGG - Intronic
927902983 2:26835278-26835300 TTGAATCCATAGATAAAATTGGG - Intergenic
928021370 2:27707711-27707733 CTGATTCAACTGATCAACCTGGG - Exonic
928050097 2:27983524-27983546 TGGGATCTACAGATCAACTTGGG + Intronic
928493519 2:31808053-31808075 CTGAATCCATAGATCAACTTAGG + Intergenic
928524263 2:32123456-32123478 CTGAATCGATATATGAACTTGGG - Intronic
928643839 2:33329946-33329968 TTGAATCAATAGATCAATTTGGG + Intronic
928851157 2:35748824-35748846 CTGAATCTATAGGTCAATTTGGG - Intergenic
929767820 2:44864038-44864060 CTGAATCTATAGATCAAATTGGG - Intergenic
930450424 2:51529363-51529385 TTGAATCAATAGATCAATTTAGG + Intergenic
930489332 2:52048122-52048144 CTGAGTCTGCAGATCAGCTTGGG - Intergenic
930859791 2:56059479-56059501 TTGAATCTATAGATCACCTTGGG + Intergenic
930875853 2:56214938-56214960 TTGAACCTACAGATCAAGTTGGG + Intronic
931339452 2:61385281-61385303 CTGAATCTATAGATGAATTTCGG - Intronic
931865517 2:66406318-66406340 TTGAATCTATAGATTAACTTGGG - Intergenic
931965306 2:67526968-67526990 TTGAATCTACAGATAAAGTTGGG - Intergenic
932513448 2:72319791-72319813 TTGAATTCAGAGATCAATTTGGG - Intronic
932749242 2:74360933-74360955 CTGACTCCATAAATGAACTTAGG + Intronic
933076138 2:77929076-77929098 CTGAATCTACAGATCACTCTGGG + Intergenic
933512766 2:83262175-83262197 CTGAAGCCTCATATTAACTTGGG - Intergenic
933688651 2:85162387-85162409 CTGGATCCACAGAGCAGCCTGGG - Intronic
933838817 2:86268554-86268576 TTGAATCTATAGATCAAGTTGGG - Intronic
934920328 2:98338872-98338894 TGGAATCAACAGATCAATTTTGG + Intronic
935434062 2:103009076-103009098 CTTAATTCACAGAACAACTCTGG - Intergenic
935510695 2:103969518-103969540 TTGAATCCGCAGATCAAGTTGGG + Intergenic
935519630 2:104088458-104088480 CTGAATCTGTAGATTAACTTGGG + Intergenic
936723910 2:115289068-115289090 CTGAATTCACTGATCAAATCCGG - Intronic
936772301 2:115928668-115928690 ATGAATCTACAGAACAAGTTGGG + Intergenic
936781027 2:116032759-116032781 CTGAATCTATAGATCAATTTTGG + Intergenic
936942533 2:117900541-117900563 CTGAATCTACAAATTACCTTGGG - Intergenic
937652676 2:124337933-124337955 CTGAATCTACAAATTACCTTGGG + Intronic
937743563 2:125384837-125384859 CTGAATCTATAGATCAAATTGGG - Intergenic
938554326 2:132410533-132410555 TTGAATCTATAGATCAATTTTGG + Intergenic
939747922 2:146000854-146000876 CTGAATCTGTAGATCAATTTGGG - Intergenic
940103936 2:150076070-150076092 CTGAAACTACACATCATCTTTGG + Intergenic
940410155 2:153353019-153353041 TTGATTCTATAGATCAACTTAGG + Intergenic
940714156 2:157200147-157200169 TTGAATCTATAGATCAAGTTGGG - Intergenic
940732600 2:157410654-157410676 CTGAATCTACAGATTAAGTTGGG + Intergenic
940852038 2:158697134-158697156 TTGAATCTATAGATCAAGTTGGG - Intergenic
940920484 2:159300189-159300211 TTGAATCTGTAGATCAACTTGGG + Intergenic
941870308 2:170377514-170377536 CTGAATCCATGGATCAAGTAGGG - Intronic
941958045 2:171224625-171224647 TTGAATCTGTAGATCAACTTGGG - Intronic
942012807 2:171780004-171780026 CTGAATTTATAGATCAATTTGGG - Intergenic
942271427 2:174279493-174279515 TTGAATCTATAGATCAATTTGGG + Intergenic
942405054 2:175645303-175645325 CTGAATCTATAGAGCAAGTTGGG + Intergenic
942493746 2:176517235-176517257 TTGAATCAATAGATCAATTTTGG + Intergenic
942608670 2:177718357-177718379 CTGAACCCACACCTCAACTTAGG - Intronic
942650292 2:178159542-178159564 TAGAAACCACAGATCAATTTTGG + Intergenic
944700753 2:202243881-202243903 CTGAATCTATATATCAAGTTGGG + Intergenic
945327836 2:208503348-208503370 TTGAATCTATAGATCAATTTTGG + Intronic
945472572 2:210244164-210244186 CTGAATCTATTGATCAAATTGGG + Intergenic
945953198 2:216059956-216059978 CTGAATCTACAGATCAATTTGGG + Intronic
946270230 2:218586131-218586153 CTGAATCTATAGATCAGTTTGGG - Intronic
947030696 2:225790193-225790215 TTGAATCTATAGATCAAGTTAGG + Intergenic
948240274 2:236426201-236426223 CTGAATCTATAGATCACTTTGGG + Intronic
948557985 2:238829308-238829330 TTAAATCTACAGATCATCTTGGG - Intergenic
1168814402 20:727046-727068 CTCTACCCACAGATGAACTTGGG + Intergenic
1169152438 20:3300254-3300276 CTGAACCTACAGATCATGTTGGG + Intronic
1169808503 20:9584139-9584161 CTCACCCCACAGATTAACTTGGG + Intronic
1170161491 20:13317365-13317387 TTGAATCTATAGATCAAGTTGGG - Intergenic
1170378152 20:15725159-15725181 TTGAATCTATAGATCAAGTTGGG + Intronic
1170400178 20:15974117-15974139 CTGAAATCCCAGATCTACTTGGG - Intronic
1172089235 20:32416033-32416055 TTGAATCTACAAATCAAATTGGG - Intronic
1172785115 20:37463675-37463697 TTGAATCTATAGATCAATTTGGG + Intergenic
1173008858 20:39162961-39162983 TTGAATCCACAGACCACCTTGGG - Intergenic
1174560442 20:51427231-51427253 CTGACTCCACAGCTGAACTGGGG - Intronic
1174747661 20:53079929-53079951 CTGACTCCAAAGTTCAACTTAGG + Intronic
1175317809 20:58063704-58063726 TTGAATCTACGGATCAACTTGGG - Intergenic
1175511423 20:59529488-59529510 TTGAATCTATAGACCAACTTAGG - Intergenic
1177125498 21:17188406-17188428 TTGAATCTATAGATCAATTTGGG - Intergenic
1177250500 21:18585018-18585040 CTGAATTCACAGTTCAATTATGG - Intergenic
1177468740 21:21526552-21526574 CTGACTCTACAGATCAAGTTGGG - Intronic
1177600271 21:23302061-23302083 TTGAAGCCACAGAGCAATTTGGG + Intergenic
1177799221 21:25811396-25811418 TTGAATCTATAGATCAATTTGGG - Intergenic
1178031500 21:28531867-28531889 TTGAATCTATAGATCAAGTTGGG + Intergenic
1179009359 21:37543916-37543938 TTGAATCCATAGATCACTTTGGG - Intergenic
1180003798 21:45009812-45009834 CTGAATGTGCAGATCAATTTGGG + Intergenic
1180094223 21:45547913-45547935 CTGAATCTATGGATCAATTTGGG - Intergenic
1180207381 21:46269600-46269622 CTGGAGCCACAGATCAACCAAGG + Intronic
1181808673 22:25390640-25390662 CTGAAGCCACACAGCAACCTAGG + Intronic
1182054740 22:27342093-27342115 TTGAATCCATAGATCAATTTAGG + Intergenic
1182462408 22:30491963-30491985 CTTCACCCACAGATCAACTATGG - Exonic
1182467374 22:30525740-30525762 CTTCACCCACAGATCAACTACGG - Exonic
1182824263 22:33250102-33250124 TTGAATCTACAGATAAAGTTAGG + Intronic
1183133288 22:35860752-35860774 CTGAATCTACAGATCACTTTGGG + Intronic
1183694159 22:39410776-39410798 TTAAATCTACAGATCAATTTGGG - Intronic
1184621284 22:45680397-45680419 TTGAATCCACAGGTCAATTTGGG - Intronic
1185011121 22:48315292-48315314 CTCAGTCCACAGATCATCTGGGG + Intergenic
1185164149 22:49248627-49248649 TTGAATCTATAGATCAATTTAGG + Intergenic
1185350589 22:50335005-50335027 TTGGATCCACAGATCAATTTGGG + Intergenic
949389875 3:3548423-3548445 TTGAATCTATAGATCAAGTTAGG + Intergenic
949870667 3:8585159-8585181 TTGAATCAACAGGTCAATTTGGG + Intergenic
949870746 3:8586122-8586144 TGGAATCAACAGATCAATTTGGG + Intergenic
949915267 3:8957247-8957269 TTGAATCTAGAGATCAATTTGGG - Intronic
950321764 3:12061944-12061966 CTGCATCTACAGATCAAGTTGGG - Intronic
950352148 3:12365969-12365991 TTGAATCTATAGATCAAGTTGGG + Intronic
950828327 3:15849223-15849245 TTGAATCAATAGATCAATTTGGG - Intronic
950843517 3:15990769-15990791 TTGAATCTATAGATCAATTTGGG + Intergenic
950994137 3:17476662-17476684 CTGAATCTATAGATCAATTTGGG + Intronic
951533070 3:23716351-23716373 CTGAATCTATAGATCAAGCTGGG + Intergenic
951616631 3:24553997-24554019 TTGAATCTGCAGATCAATTTTGG + Intergenic
951757569 3:26108262-26108284 TTGAATCCATAGATCATTTTAGG + Intergenic
952473262 3:33678842-33678864 TTGAATCCATAGATCAAGTTGGG - Intronic
952480398 3:33754977-33754999 CTGAATTCAGAGTTCAATTTGGG - Intergenic
952559222 3:34570293-34570315 TTGAATCTACAGGTCAATTTGGG + Intergenic
952611395 3:35215016-35215038 TTGAATCTATAGATAAACTTGGG + Intergenic
952635967 3:35531803-35531825 CTGAATCTACAGATCATTTTGGG - Intergenic
952703930 3:36357450-36357472 TTGAATCTATAGATCAAGTTGGG + Intergenic
953422733 3:42767508-42767530 TTGAATCTATAGATCAAGTTGGG - Intronic
953600102 3:44354478-44354500 TTGAATCTATAGATCAAGTTGGG + Intronic
954253409 3:49386141-49386163 CTGAATCTACAGATCGATTTGGG + Intronic
954417799 3:50402531-50402553 CTGAAGCCACAGTTCAAATGTGG - Intronic
954677252 3:52322753-52322775 CTGGAACCTTAGATCAACTTGGG + Exonic
954681030 3:52346026-52346048 CCCAATCCACAGGTCAACATGGG - Intronic
954846090 3:53557919-53557941 CTGAATCTATAGATCGATTTGGG + Intronic
955169990 3:56554272-56554294 TTGAATCTATAGATCAAGTTGGG + Intergenic
957037200 3:75304929-75304951 TTGAATCTACAGATCAATTTGGG + Intergenic
957120885 3:76090521-76090543 TTGAAACTATAGATCAACTTTGG - Intronic
957362769 3:79180774-79180796 TTGACTCCTCAGACCAACTTAGG - Intronic
957400440 3:79705744-79705766 CTGAATCTATAGAACAAGTTGGG + Intronic
958001732 3:87759324-87759346 TTGAATCTATAGATCAAGTTGGG - Intergenic
958204369 3:90370943-90370965 TTGAATCCATAAATTAACTTGGG + Intergenic
958813258 3:98887847-98887869 CTGAGTCCACAGTTCATATTAGG + Intronic
959499935 3:107094949-107094971 TTGAATCTATAGATCAAGTTGGG - Intergenic
959666572 3:108929004-108929026 TTGAATCTACAGATCAACTTGGG + Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960020370 3:112945146-112945168 TTGAATACATAGATCAAGTTGGG - Intronic
960220557 3:115103274-115103296 TTGAATCTATAGATCAATTTGGG - Intronic
960227073 3:115181041-115181063 TTGAATCTACAGATCAAGTCAGG - Intergenic
960547321 3:118930806-118930828 CTGAATCTATAGATCAATTTAGG - Intronic
960822966 3:121753734-121753756 TTGAATCTACAGATAAAGTTGGG - Intergenic
960860909 3:122152812-122152834 TTGAATCTGCAGATCAATTTGGG + Intergenic
960889250 3:122429629-122429651 TTGAATCTATAGATCAAGTTGGG - Intronic
961914790 3:130362694-130362716 TTAAATCTACAGATCAATTTGGG + Intronic
962290476 3:134132142-134132164 ATGAATCTAGAGATCAAATTGGG - Intronic
962730349 3:138276810-138276832 CTTAATCTATAAATCAACTTGGG - Intronic
963406853 3:144876257-144876279 TTGAATCTACAGATCACTTTTGG + Intergenic
963433041 3:145234016-145234038 CTGAATCCACTTAATAACTTAGG + Intergenic
963859132 3:150289223-150289245 TTGAATCTGTAGATCAACTTGGG - Intergenic
964460814 3:156925003-156925025 TTGAATCTATAGATCAATTTGGG + Exonic
965200701 3:165654442-165654464 TTGAATTCATAGATCAATTTAGG + Intergenic
965326527 3:167310917-167310939 ATGAATCTATAGATCAAGTTGGG - Intronic
965636455 3:170786894-170786916 ATGAATCCATAAATCAATTTAGG - Intronic
966706274 3:182918648-182918670 CTGAGTTCACAGAGCAAATTAGG + Exonic
967490402 3:190084131-190084153 CTGAATCTACACATCAAGTTAGG + Intronic
967633347 3:191772837-191772859 TTGAATTCATAGATCAAATTCGG - Intergenic
968840250 4:2998784-2998806 TTGAATCTATAGATCAATTTGGG - Intronic
968851321 4:3081152-3081174 TTGAATCTGTAGATCAACTTGGG + Intronic
969625164 4:8299051-8299073 TTGAATTTACAGATCAATTTGGG + Intronic
970102053 4:12535633-12535655 TTGAAACCACAGATCAATTAGGG + Intergenic
970392784 4:15632481-15632503 CTGAATCTACAAATTACCTTGGG + Intronic
970534470 4:17015799-17015821 TTGAATCTACAGATCAATATGGG + Intergenic
970668351 4:18364777-18364799 ATGAATCAATAGATCAAATTGGG + Intergenic
971320927 4:25605472-25605494 CTGAAGGCTCAGATCAACTGTGG - Intergenic
971526004 4:27620038-27620060 TTGAATCTATAGATCAATTTGGG - Intergenic
971684989 4:29753578-29753600 TTGAATCCATTGATCAAATTGGG - Intergenic
972830089 4:42804522-42804544 TTGAATCTACAGATCAAATTGGG + Intergenic
974475012 4:62367291-62367313 TTGAATCTACAGATCAAATTGGG - Intergenic
974655779 4:64819137-64819159 TTGAATCTACAGATCAATCTGGG + Intergenic
974759126 4:66252462-66252484 CTGAAGCCACATATCCACTAGGG + Intergenic
974918885 4:68212118-68212140 ATGAATGCACAGATAGACTTTGG - Intergenic
976422686 4:84864428-84864450 CTTAATCTACAGATCATTTTCGG + Intronic
976962481 4:90995806-90995828 GTGAGTCCACAAATCAACTATGG - Intronic
977433836 4:96967938-96967960 CTGAATCTACAAATTACCTTGGG - Intergenic
977454478 4:97240730-97240752 TTGAATCTATAGATCAAGTTGGG - Intronic
978129397 4:105176690-105176712 CTGAATCTATAGATCAAGTTGGG - Intronic
978176508 4:105738454-105738476 CTGAATCTATAGATCACTTTTGG + Intronic
978213563 4:106169137-106169159 TTGAATCTACATATCAATTTGGG - Intronic
978415481 4:108471144-108471166 TTGAATCCATAGATCAAGTTGGG - Intergenic
978622745 4:110650596-110650618 CTGTATACACATAGCAACTTGGG + Intergenic
979116245 4:116827867-116827889 TTAAATCTGCAGATCAACTTAGG - Intergenic
979749906 4:124266370-124266392 TTGAATCTACAAATCAATTTGGG - Intergenic
979781454 4:124656014-124656036 CTGAATCTACAGATAAACTGCGG - Intergenic
980584798 4:134797922-134797944 TTAAATCTACAGATCAAATTGGG - Intergenic
981070618 4:140533146-140533168 TTGAATCCATAGATCGATTTGGG - Intronic
982134499 4:152260535-152260557 TTGAATCTATAGATCAATTTGGG - Intergenic
982161176 4:152571060-152571082 CAGAATCTATAGATCAAGTTGGG + Intergenic
982399329 4:154948923-154948945 CTAAATGCACCTATCAACTTTGG - Intergenic
982491412 4:156034370-156034392 TTGAATCTATAGATCAAGTTGGG + Intergenic
982566053 4:156988226-156988248 TTAAATCTACAGATCAATTTGGG + Intergenic
982756590 4:159226541-159226563 CTGAGTCTATATATCAACTTGGG + Intronic
982895416 4:160916100-160916122 CTGATTCTATAGATCAAGTTGGG + Intergenic
982984604 4:162190404-162190426 TTGAATCTATAGATCATCTTGGG + Intergenic
983461723 4:168032639-168032661 TTGAATCTATAGATCAATTTAGG + Intergenic
983571614 4:169214496-169214518 TTGAATCTATAGATCAAGTTGGG + Intronic
984074310 4:175155494-175155516 CTGAATCTATACATCAATTTTGG + Intergenic
984319799 4:178179346-178179368 TTGAATCTGCAGATCAATTTGGG - Intergenic
985144893 4:186886429-186886451 CGGAATCCACAGAGCAAGGTGGG - Intergenic
985352344 4:189078419-189078441 TTGAATCTATAGATCAATTTTGG - Intergenic
985759647 5:1739661-1739683 TTGAATCTACAGATCAATTTGGG + Intergenic
986991709 5:13561316-13561338 TTGAATCCATATATCAATTTGGG - Intergenic
987689654 5:21250674-21250696 TTGAATCTACAGATCACTTTGGG + Intergenic
987819634 5:22946331-22946353 CTGAATCTACAGAGGAACTTGGG + Intergenic
988007438 5:25435066-25435088 TTGAATCTATAGATCAAGTTGGG - Intergenic
988186991 5:27877844-27877866 ATGAATCTATAGATCAAGTTGGG + Intergenic
988207670 5:28160997-28161019 GTGAAGCCATAGATCAAGTTGGG - Intergenic
988647701 5:33112282-33112304 GTGAATCTACAGATCAAGTTGGG + Intergenic
989373874 5:40739320-40739342 CTGAGTTTACAGATCAATTTCGG + Intronic
989447188 5:41543509-41543531 CTGAATCCATAGATCACTTTGGG + Intergenic
990037279 5:51336846-51336868 TTAAATCCCCAGATCAACTTGGG + Intergenic
990096978 5:52128087-52128109 TTGAATCTATAGATCAAGTTGGG - Intergenic
990326684 5:54683689-54683711 TTGAATCTACAGATCAAGTAAGG + Intergenic
992276644 5:75127697-75127719 CTGAATCTATAGATCAATTTGGG + Intronic
992485812 5:77193734-77193756 TTGAATCTATAGATCAATTTAGG + Intergenic
992533653 5:77676186-77676208 CTGACTCTACAGATCAAGTTGGG - Intergenic
992803548 5:80315079-80315101 CTGAGGCCACAGATCAACTGAGG - Intergenic
992937482 5:81724212-81724234 CTGAATACACAAATTAATTTGGG + Intronic
993097884 5:83501855-83501877 ATGAATCTCTAGATCAACTTGGG + Intronic
993588747 5:89766757-89766779 TTGAATCTACAGATCAATGTGGG + Intergenic
994326434 5:98451755-98451777 CTGAATCAATAGATCACTTTGGG - Intergenic
994617498 5:102123770-102123792 TTGAATCTATAGATCAAGTTGGG + Intergenic
995029699 5:107466211-107466233 CTAAATCCACAGTGGAACTTTGG - Intronic
996168150 5:120251949-120251971 CTAAGTCCTCAGATCAACTTTGG - Intergenic
996778931 5:127161914-127161936 TTGAATCTATAGATCAAGTTGGG + Intergenic
996803003 5:127424436-127424458 TTGAATCTATAGATCAATTTGGG + Intronic
997168780 5:131692477-131692499 TTGAATCTATGGATCAACTTGGG - Intronic
997703819 5:135928731-135928753 TTGAATCTAGAAATCAACTTAGG - Intronic
998178823 5:139921170-139921192 TTGAATCGATAGATCAAGTTGGG - Intronic
998571955 5:143268510-143268532 TTGAATCCATAGTTCAAATTGGG + Intergenic
999382431 5:151131003-151131025 ATGAGTCAACAGATGAACTTAGG - Intronic
999705707 5:154270759-154270781 CTGAATGGACAGATCATCTGAGG + Intronic
999864785 5:155688932-155688954 TTGGATCCTCACATCAACTTTGG + Intergenic
1000238745 5:159389015-159389037 CTGAATCTATAGATCAAGTTGGG + Intergenic
1000766171 5:165293088-165293110 CTGAATATACAGTTCAACTGGGG - Intergenic
1000839440 5:166198406-166198428 TTGAATTTACAGATCAATTTGGG + Intergenic
1000913824 5:167055474-167055496 TTGAATCTATAGATCAAGTTGGG + Intergenic
1002611648 5:180422907-180422929 CTGAATCTGTAGATTAACTTTGG + Intergenic
1002657709 5:180765148-180765170 TTGAATCTATAAATCAACTTGGG - Intergenic
1002769194 6:275656-275678 CTGAATCCATAGATCAACTTGGG + Intergenic
1003023571 6:2533040-2533062 CTGAATCTGCAGATCACATTGGG + Intergenic
1003055524 6:2815240-2815262 ATTAATCAACAGATCAATTTGGG + Intergenic
1003262853 6:4537859-4537881 TTGAATCTGCAGATCAATTTGGG - Intergenic
1003580698 6:7337899-7337921 CTGAATCAATAAATGAACTTGGG + Intronic
1003630226 6:7779950-7779972 CTGAAACCACAGGCCACCTTTGG + Intronic
1003637939 6:7851185-7851207 CTAAATCTAGAGATCAATTTGGG + Intronic
1004033418 6:11896287-11896309 TTGAATCTATAGATCAAGTTGGG + Intergenic
1004083631 6:12421959-12421981 CTGGTCCCACAGATCAACTCTGG + Intergenic
1004153467 6:13144523-13144545 CTGAATCTTGAGATCAATTTAGG - Intronic
1004188289 6:13441166-13441188 CAGAATCCAGAAATAAACTTGGG - Intronic
1004305180 6:14494376-14494398 TTGACTACACAGATCAATTTAGG + Intergenic
1005007532 6:21303935-21303957 TTGAATCTATAGATCAACTTAGG - Intergenic
1005129148 6:22484498-22484520 CTCAATCTATAGATCAAGTTGGG - Intergenic
1005197356 6:23303261-23303283 CTGAATCTACAAATAAACTTGGG + Intergenic
1005249940 6:23933562-23933584 GTGAATCCATAGATCACTTTGGG - Intergenic
1005390644 6:25329833-25329855 CTGAATCCCCTGAACAACTCTGG - Intronic
1005424460 6:25687254-25687276 TTGAATCTGCAGATCAATTTGGG + Intronic
1006431123 6:33996557-33996579 TTGAATCTACAGATCATTTTGGG - Intergenic
1007920389 6:45604033-45604055 TTGAATCTACAGATAAATTTGGG - Intronic
1008258714 6:49337887-49337909 TTGAATCTACAGATCAGTTTGGG - Intergenic
1008873070 6:56295509-56295531 TTGAATCCATAGATGAAGTTAGG + Intronic
1009528177 6:64774548-64774570 CTTAAGCCACAGATCCACATAGG - Intronic
1009879627 6:69549951-69549973 TTCAATCTACAGATCAATTTGGG + Intergenic
1010035052 6:71315626-71315648 TTGAATCTAAAGATCAATTTGGG - Intergenic
1010040173 6:71372449-71372471 CTGAATCTACAGATCAACTTGGG + Intergenic
1011017854 6:82778612-82778634 TTGAATCTACAGAGCAATTTGGG - Intergenic
1011505109 6:88033238-88033260 TTGAATCTACAGATCAAGTTGGG + Intergenic
1011707078 6:90012242-90012264 CTGAATCTACTGATGAATTTAGG + Intronic
1012466479 6:99521717-99521739 CTGCATCCACAGATAAAAGTTGG - Intronic
1012580136 6:100857935-100857957 CTGAATCTACAGATCAATTTGGG + Intronic
1012684540 6:102228831-102228853 CTGAATCCTCAGAGCAAGTTGGG + Intergenic
1012702036 6:102470858-102470880 CTGAATCTATATATCAACTTGGG + Intergenic
1012735630 6:102938009-102938031 CTGAATCTATAGATTAAGTTGGG + Intergenic
1012856218 6:104505085-104505107 CTTAATCCACATATAAAATTTGG + Intergenic
1013306956 6:108857135-108857157 TTGAATCTATAGATCAAGTTGGG + Intronic
1013440679 6:110163657-110163679 TTGAATCTACAGATCAAGTTGGG - Intronic
1013813688 6:114072716-114072738 CTGAATCTATAAATCACCTTGGG - Intronic
1014178789 6:118360760-118360782 TTAAATCCATAGATCAAGTTGGG - Intergenic
1014405990 6:121051795-121051817 CTGAATTCATAGATCAGTTTTGG - Intergenic
1014450423 6:121575511-121575533 ATGAATTCACACATCAATTTAGG + Intergenic
1015268315 6:131312458-131312480 TTGAACCCATAGATCAATTTGGG - Intergenic
1015925506 6:138306386-138306408 CTGAATCTATACATCAATTTGGG - Intronic
1016432547 6:144002833-144002855 TTGACTCTACAGAGCAACTTTGG - Intronic
1017522626 6:155215153-155215175 CTGAATCTTAAGATAAACTTTGG - Intronic
1018347353 6:162914641-162914663 TTGAATCTATAGATCAACCTGGG + Intronic
1018543911 6:164914588-164914610 ATGAATCCAAACATCAACTATGG + Intergenic
1018571314 6:165213267-165213289 TTGAATTCATATATCAACTTTGG - Intergenic
1018863282 6:167728134-167728156 TTAAATCTACAGATCAAGTTGGG - Intergenic
1018966134 6:168490604-168490626 CTCAATCCACTGATAAACCTAGG - Intronic
1019004130 6:168782280-168782302 CTAAATTCTCAGTTCAACTTCGG - Intergenic
1020662716 7:11001461-11001483 TTGAATCTATAGATCAAGTTGGG + Intronic
1020851710 7:13361739-13361761 TTGAATCTATAGATCACCTTGGG + Intergenic
1022014001 7:26333139-26333161 TTGAATCCATAGATCACTTTGGG + Intronic
1022075117 7:26961099-26961121 TTGAATCTATAGATCAAGTTTGG - Intronic
1022135679 7:27446107-27446129 TTGAATCTGCAGATCAATTTGGG + Intergenic
1022297437 7:29069039-29069061 CTGAATGCACACATCATTTTTGG + Intronic
1022381412 7:29863637-29863659 TTGAATTTACAGATCAACCTGGG + Intronic
1022395383 7:29983560-29983582 TTGACTCCACAGATTAATTTAGG - Intronic
1022688955 7:32626686-32626708 CTGAATCTGTAGATCAAGTTGGG - Intergenic
1022937614 7:35195678-35195700 CTGAATATATAGATCAAGTTGGG + Intergenic
1023573831 7:41603393-41603415 CTGAATTCACAGAGCAGTTTCGG + Intergenic
1023597032 7:41840899-41840921 CTGAATCCACAGATCAAGTTGGG + Intergenic
1023649472 7:42353851-42353873 TTGAATCTACAGATCAATTTGGG - Intergenic
1023756305 7:43420866-43420888 CTGAAACCACAGATCAATTTGGG - Intronic
1024501711 7:50116667-50116689 CTGAAACTATAAATCAACTTAGG - Intronic
1024690110 7:51791551-51791573 TTGAATCTATAGATCAAATTGGG - Intergenic
1024749106 7:52443313-52443335 TTGAATCCATAGATCCAGTTAGG + Intergenic
1026887188 7:73958075-73958097 TTGAATCCATAGATCATTTTAGG + Intergenic
1027334740 7:77137671-77137693 TTGAATCTACAGATCAATTTGGG - Intronic
1027415623 7:77970913-77970935 CTGACTCTATAGATCAATTTGGG + Intergenic
1027582003 7:80009171-80009193 TTGAATCTACAGATTAAGTTTGG - Intergenic
1027928560 7:84500062-84500084 CTGAATCTATAGATCACATTGGG + Intergenic
1028397048 7:90381485-90381507 CTGAATCCGTAGATCACTTTGGG - Intronic
1029038254 7:97545881-97545903 TTAAATCTACAGATCAATTTGGG - Intergenic
1029345582 7:99976229-99976251 CTCAGTCCAGAGATCAACTCTGG - Intergenic
1029781061 7:102733431-102733453 TTGAATCTACAGATCAATTTGGG + Intergenic
1029916709 7:104217508-104217530 TTGAATCTACACATCAATTTGGG - Intergenic
1030224608 7:107135794-107135816 TTGAATCTACAGATCAACTTGGG - Intronic
1030257173 7:107523076-107523098 TTGAATTCATAGATCAAGTTGGG + Intronic
1030522538 7:110616155-110616177 CTGAATCTATAGATCACTTTTGG + Intergenic
1030545987 7:110895593-110895615 CTGAATCTATAGAGCAATTTAGG + Intronic
1030790424 7:113720403-113720425 TTGAATCTACAGATCAAGTTTGG - Intergenic
1030826486 7:114165691-114165713 TTGAATATACATATCAACTTAGG - Intronic
1031160678 7:118164096-118164118 CTGAATCTACAGATTAATTTAGG + Intergenic
1031203508 7:118722769-118722791 TTGAATCCACAAATCACATTGGG + Intergenic
1031295751 7:120001244-120001266 CTGAATCTACACATCAAGCTGGG + Intergenic
1031308357 7:120162639-120162661 TTGAGTCCATAGATCAACTTGGG + Intergenic
1031689469 7:124768918-124768940 CCTAATCCACATAACAACTTGGG - Intergenic
1031773403 7:125874884-125874906 TTGAATCTACAAATCAATTTTGG + Intergenic
1032769906 7:135041194-135041216 TTAAATCTACAGATCAACTTGGG - Intronic
1033004047 7:137540958-137540980 TTGAGTCTATAGATCAACTTGGG - Intronic
1033060494 7:138101847-138101869 TTGAATCTACAGATGAATTTGGG - Intronic
1033382642 7:140838536-140838558 TTGAATCTGTAGATCAACTTGGG - Intronic
1034019238 7:147623676-147623698 CTGAATCTATAGATCACTTTGGG - Intronic
1034199216 7:149271850-149271872 CTGAATCCACAGAAGAACTGAGG - Intronic
1034320421 7:150174922-150174944 TTGAATCTACTGATCAATTTGGG - Intergenic
1035089177 7:156291889-156291911 CTGACTCCATAGATAAACTTGGG + Intergenic
1036115675 8:5958327-5958349 GTTATTCCACAGATCACCTTGGG + Intergenic
1036580383 8:10068852-10068874 CTGAATCTCCAGATCAAGTTGGG + Intronic
1036734666 8:11301100-11301122 CTGACTCTACAGATCAATTAAGG - Intronic
1037105366 8:15100524-15100546 TTGAATCTACAGATAAAGTTGGG - Intronic
1037618217 8:20540068-20540090 TTGAATACATAGATCATCTTGGG + Intergenic
1037979829 8:23244704-23244726 CTGGATCTACAGATCAATTTGGG + Intronic
1038232148 8:25711351-25711373 TTGAATCCACAGTTCAATTTGGG + Intergenic
1038273009 8:26091785-26091807 TTGAATCTACAGATCAAGTTGGG - Intergenic
1039007313 8:33054188-33054210 CTGAATCTACAAATTACCTTGGG - Intergenic
1039011125 8:33094100-33094122 CTGAATCCATAGATCAATTTGGG - Intergenic
1039666074 8:39529789-39529811 CTGAATCTACAGATCAATTTGGG - Intergenic
1040327581 8:46361462-46361484 CTGAATCCACACATCACAATTGG + Intergenic
1040450017 8:47536217-47536239 CTGAATCTACAAATCAAGTTGGG - Intronic
1040525516 8:48220540-48220562 TTGAATCTACAGGTCAATTTCGG - Intergenic
1041130043 8:54688879-54688901 CTGAATCTACAAATTACCTTGGG + Intergenic
1041385353 8:57296591-57296613 CTGAACCAACAGAACAACTTTGG - Intergenic
1041741065 8:61157157-61157179 CAGAATCCAGAGTTCAGCTTAGG - Intronic
1041879151 8:62727807-62727829 CGATATCCACAGAACAACTTTGG - Intronic
1042152819 8:65807102-65807124 CTGAATCTGTAGATCAATTTGGG + Intronic
1042366657 8:67944941-67944963 TTGAATCTATAGATCAAATTGGG - Intergenic
1042371594 8:67997682-67997704 GTGAATCTATAGATCAATTTTGG + Intronic
1042474277 8:69228601-69228623 TTGAATCTATAGATCAATTTGGG - Intergenic
1042538486 8:69883441-69883463 TTGAATCTAAAGATCAATTTGGG - Intergenic
1042701105 8:71615814-71615836 CTCTACCCACAAATCAACTTTGG + Intergenic
1043541941 8:81273864-81273886 TTGAATCTACAGATCACTTTGGG + Intergenic
1044783568 8:95770385-95770407 CTGGATCTGCAGATCAAATTGGG + Intergenic
1045400762 8:101815042-101815064 TTGAATCTATAGATCAAGTTAGG - Intronic
1046024112 8:108701828-108701850 TTGAATCTATAGATCAATTTGGG - Intronic
1046113611 8:109757647-109757669 TTGAATCTATAGATCAAATTGGG + Intergenic
1046388669 8:113538783-113538805 TTGAATCTACAGATCAAGTTAGG + Intergenic
1046416760 8:113926070-113926092 CTGAAACTACAGAACAATTTGGG - Intergenic
1046484238 8:114864712-114864734 TTGAATCTATAGATCAAGTTGGG - Intergenic
1046663402 8:116973612-116973634 CTGAATCTATAAATCACCTTGGG - Intronic
1046870434 8:119199637-119199659 CTTAAAGCACAGATCAAATTTGG + Intronic
1047652905 8:126943438-126943460 TTGAATCCATAGATCACCTTGGG + Intergenic
1047867093 8:129037189-129037211 TTGAATCTACACATCAATTTGGG - Intergenic
1047890694 8:129304804-129304826 TTGAATCTGTAGATCAACTTGGG + Intergenic
1048025325 8:130581491-130581513 CTGACTCTATAGATCAACTTGGG + Intergenic
1048415258 8:134221072-134221094 CTGAATCTACAGATCACTTTGGG - Intergenic
1048682510 8:136859760-136859782 CTGAATCTATAGATTAAGTTGGG + Intergenic
1049295616 8:141833846-141833868 TTGAATCTATAGATGAACTTCGG + Intergenic
1050116948 9:2272853-2272875 CTGAATATACAGAGAAACTTAGG - Intergenic
1050426856 9:5520007-5520029 TTGAATCCATAGATCAATTTGGG - Intronic
1050695233 9:8271992-8272014 TTGAGTCTACAGATCAAGTTGGG + Intergenic
1050735211 9:8754182-8754204 GTGAATTCATAGATAAACTTGGG - Intronic
1050784257 9:9379603-9379625 TTGAATCTACAGATGAAGTTGGG + Intronic
1051116421 9:13699079-13699101 CTGAATCTATAGATCAAGTGGGG + Intergenic
1051279582 9:15428295-15428317 CTGTTTATACAGATCAACTTTGG + Intronic
1051607749 9:18932603-18932625 TTGAATCTACAGATCAATTTGGG + Intronic
1051807660 9:21013570-21013592 CTGAATCTACAGATCAATTTGGG + Intronic
1052754613 9:32527689-32527711 TTGAACCTACAGATAAACTTGGG + Intergenic
1053563456 9:39221365-39221387 CTGAATCTGTAGATCACCTTAGG + Intronic
1053829241 9:42059287-42059309 CTGAATCTGTAGATCACCTTAGG + Intronic
1053861614 9:42392457-42392479 CTGGATCCACAAATCAAGTTAGG - Intergenic
1054133691 9:61397701-61397723 CTGAATCTGTAGATCACCTTAGG - Intergenic
1054601318 9:67128160-67128182 CTGAATCTGTAGATCACCTTAGG - Intergenic
1055634380 9:78260873-78260895 CTGGTTCCACAGGTCAACTGTGG - Intronic
1055867210 9:80829475-80829497 CTGAATCTGTAGATCAACTAGGG + Intergenic
1056431940 9:86536419-86536441 TTGAATCCATAGATCACTTTGGG - Intergenic
1056594891 9:87999334-87999356 CTGAATACACAGAATAACCTGGG - Intergenic
1056924801 9:90825295-90825317 TTGAATCTACAGATCAAGCTTGG - Intronic
1057163776 9:92910415-92910437 CTCAATCCTCAGATCAACCAAGG + Intergenic
1057775353 9:98003814-98003836 CTGAATCAAGAGAAAAACTTCGG - Intronic
1057823738 9:98355648-98355670 CTGAATGTATAGATCAAGTTGGG - Intronic
1057838094 9:98463318-98463340 CTGAATCTGTAGATCAATTTAGG - Intronic
1058196301 9:101980634-101980656 CTGAATCAACAGATAAATTAAGG + Intergenic
1058454018 9:105122574-105122596 ATAAATCTACAGATCAATTTGGG - Intergenic
1059090654 9:111354506-111354528 TTGAATCTGTAGATCAACTTGGG + Intergenic
1059667170 9:116458833-116458855 TTGAATCTACAGATAAATTTGGG - Intronic
1059841874 9:118226620-118226642 CTGAAACCTGAGATCAATTTGGG - Intergenic
1059881738 9:118697899-118697921 TTGAATCTATAGATCAAATTTGG - Intergenic
1060433647 9:123573351-123573373 TTGAATCTATAGATCAATTTAGG + Intronic
1061434947 9:130555194-130555216 CTGAATCCTCAGCTCAGCTGGGG + Intergenic
1061447118 9:130645746-130645768 ATGAATCTATAGATCAATTTGGG + Intergenic
1186668682 X:11746390-11746412 ATGAATCTATAGATCAATTTAGG + Intergenic
1186976057 X:14906011-14906033 CTGAATCAGTAGATCAATTTGGG - Intronic
1187335803 X:18380463-18380485 TTGAATCTATAGATCAAATTGGG + Intergenic
1187421880 X:19142120-19142142 CTGAATCTGTAGGTCAACTTGGG - Intergenic
1187782423 X:22842937-22842959 CTTAATCCTCAGAACAACCTTGG - Intergenic
1188134502 X:26478433-26478455 TTGAAACCATAGATCAATTTGGG - Intergenic
1188726353 X:33588339-33588361 CTGAATACATAGATTAAGTTTGG + Intergenic
1189527740 X:41842740-41842762 CTGAATCTATAGATCAATTTGGG + Intronic
1190492437 X:50995531-50995553 TTGAATATACAGATCAATTTTGG - Intergenic
1190547119 X:51539608-51539630 TTGAATCTATAGATCAAGTTGGG + Intergenic
1190551279 X:51584105-51584127 TTGAATCCATAGACCAATTTGGG + Intergenic
1190551778 X:51589871-51589893 CTGAATCTATAGATCAAGTTGGG - Intergenic
1190716384 X:53107496-53107518 TTGAATCTATATATCAACTTGGG + Intergenic
1191129991 X:56997548-56997570 CTGACTCTGCAGATAAACTTGGG + Intergenic
1191821161 X:65310570-65310592 CTGAATCTATAAATCACCTTGGG - Intergenic
1192187871 X:68965530-68965552 TTTAATCTACAGATCAAGTTGGG + Intergenic
1192303408 X:69930958-69930980 TTGAATCTATAGATCAATTTTGG - Intronic
1192375864 X:70561078-70561100 TTGAATCTATAGATCAATTTGGG + Intronic
1192382607 X:70634294-70634316 TTGAATCTATAGATCAGCTTGGG - Intronic
1192391706 X:70735648-70735670 TTGAATCTGCAGATCAATTTGGG - Intronic
1192540465 X:71965675-71965697 TTGAATCCATAGATCAAGTTGGG + Intergenic
1192851468 X:74960895-74960917 TTGAATCCACAAATTACCTTGGG - Intergenic
1193393007 X:80951215-80951237 TTGAATCTAAAGATCAATTTGGG + Intergenic
1193399274 X:81022451-81022473 TTGAATCTATAGATCAAGTTGGG - Intergenic
1193898734 X:87148418-87148440 CTTAATACAGAGATCATCTTTGG + Intergenic
1194234353 X:91363550-91363572 TTTAATCTACAGATCAATTTTGG + Intergenic
1194234801 X:91369623-91369645 TTGAATCTATAGATCAAGTTAGG + Intergenic
1194532363 X:95067371-95067393 TTGAATCTACAGATAAAATTTGG - Intergenic
1194760076 X:97785566-97785588 TTGAATCTATACATCAACTTGGG - Intergenic
1194769854 X:97888786-97888808 TTGAATCTACAGATTAATTTGGG + Intergenic
1194826378 X:98568334-98568356 TTAAATCCATAGATTAACTTGGG + Intergenic
1194929873 X:99874222-99874244 TTGAATCCATAGATCAATTTTGG - Intergenic
1195253612 X:103072474-103072496 TTGAATCCATAGATCACTTTGGG - Intergenic
1195279189 X:103313526-103313548 CTGAATTTACAGATGAATTTGGG - Intergenic
1195300133 X:103521536-103521558 CTGAATCTATAGATCAGTTTTGG - Intergenic
1195785120 X:108511386-108511408 CTGAATGCTTAGATCAATTTGGG - Intronic
1196490861 X:116264488-116264510 TAGAATCCACAGATAAACTGTGG + Intergenic
1197409854 X:126103343-126103365 TTGAATCCACAAATAAATTTGGG - Intergenic
1197588595 X:128381356-128381378 TTGAATCTATAGATCACCTTGGG - Intergenic
1197599042 X:128505531-128505553 TTAAATCTACAGATCAATTTGGG - Intergenic
1197730835 X:129808143-129808165 TTGAATCTATAGATCAATTTGGG - Intronic
1197880255 X:131158929-131158951 CTGATTCCACAGGGGAACTTTGG - Intergenic
1198318354 X:135493220-135493242 CTGAATATGCAGATCAATTTGGG - Intergenic
1198501152 X:137248347-137248369 CTGAATCTACAGATCATTTTGGG - Intergenic
1199014313 X:142794807-142794829 TTGAATCCATAGATCAATTTGGG + Intergenic
1199055896 X:143294368-143294390 TTGAATCCACAGATTACCTTGGG - Intergenic
1199244700 X:145589756-145589778 TTGAATCCATAGATCATTTTGGG - Intergenic
1199584498 X:149399539-149399561 TTGAATCTACAGATCAATTTGGG + Intergenic
1199674404 X:150174292-150174314 CTGAATCTACAAAACAATTTGGG + Intergenic
1199702614 X:150394510-150394532 CTGAATCTATAGATCAAATTGGG + Intronic
1199820873 X:151444176-151444198 TTGAATCCATAGATCAATTTGGG + Intergenic
1199937830 X:152594008-152594030 CTGAATCTACAGATCAATCTGGG + Intergenic
1200767797 Y:7095121-7095143 CAGAATCAACAGATCATATTTGG + Intergenic
1201603817 Y:15763100-15763122 CTGAATACACAGAACAACACAGG + Intergenic
1201899223 Y:19030475-19030497 CTTAATCTATAGATCAATTTAGG + Intergenic