ID: 1084793758

View in Genome Browser
Species Human (GRCh38)
Location 11:71490928-71490950
Sequence CTGGATGCAGAACTGGACGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084793758_1084793761 4 Left 1084793758 11:71490928-71490950 CCTTCGTCCAGTTCTGCATCCAG 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1084793761 11:71490955-71490977 TCCAGCTTCCTGCCCTGCAGAGG 0: 1
1: 0
2: 5
3: 61
4: 392
1084793758_1084793767 20 Left 1084793758 11:71490928-71490950 CCTTCGTCCAGTTCTGCATCCAG 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1084793767 11:71490971-71490993 GCAGAGGTGAGTGTGCTCACGGG 0: 1
1: 0
2: 3
3: 26
4: 262
1084793758_1084793766 19 Left 1084793758 11:71490928-71490950 CCTTCGTCCAGTTCTGCATCCAG 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1084793766 11:71490970-71490992 TGCAGAGGTGAGTGTGCTCACGG 0: 1
1: 0
2: 1
3: 34
4: 268
1084793758_1084793768 26 Left 1084793758 11:71490928-71490950 CCTTCGTCCAGTTCTGCATCCAG 0: 1
1: 0
2: 0
3: 12
4: 149
Right 1084793768 11:71490977-71490999 GTGAGTGTGCTCACGGGCTGTGG 0: 1
1: 0
2: 0
3: 13
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084793758 Original CRISPR CTGGATGCAGAACTGGACGA AGG (reversed) Exonic
901371714 1:8804338-8804360 CTGGATACTGAACTGGAGGTGGG + Intronic
905477285 1:38238056-38238078 CTGGGTGCAGAAGTGAAGGAAGG + Intergenic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
909031584 1:70547690-70547712 CTAGATGTAGAACTGGCAGATGG + Intergenic
912048132 1:105486599-105486621 CAGGAGGCAGAGCTGGACCAGGG - Intergenic
912457330 1:109806846-109806868 CTGTATGAAGAACCGGACTAGGG - Intergenic
915064002 1:153209889-153209911 CTGGAGTAAGAACTGGAGGAAGG - Intergenic
915270942 1:154752937-154752959 CGTGATGCAGAACTGGAGGCAGG - Intronic
918735819 1:188061933-188061955 CTGGATGTAGAACTTGGCAAAGG - Intergenic
919586502 1:199447154-199447176 AAGGGTGCAGAACTGGACAAAGG - Intergenic
919697248 1:200590117-200590139 CTGGAAGCAGAACTGGTAAAAGG - Exonic
922167905 1:223130997-223131019 GTGGCTGCAGAATTGGAAGAAGG - Intronic
924813151 1:247420908-247420930 CTGGATGGAGAATTGGAGGCAGG - Intronic
1063105041 10:2985527-2985549 GTGGGCGCAGGACTGGACGAGGG - Intergenic
1065144353 10:22753298-22753320 CTGGATTCAGAACAGGAGGAAGG + Intergenic
1067243746 10:44518359-44518381 CTGAATGCAGAAATAGACGATGG - Intergenic
1069359661 10:67627184-67627206 CAGGAGGCAGAGCTGGACCAGGG - Intronic
1072665327 10:97388508-97388530 CTGGATGCAGAACTTGGCAGTGG + Exonic
1073425948 10:103455559-103455581 CTGGATGCAGACCTTGGCAAAGG + Exonic
1073710785 10:106037430-106037452 CTGGATACAGAACTTTACGTTGG + Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074944976 10:118272493-118272515 CTGGATGCAGAACTTGTCTCGGG - Intergenic
1075926715 10:126257039-126257061 CAGGATGCAGAAGTGGACTGGGG - Intronic
1077498090 11:2896428-2896450 CTGGAGGCAGGAAGGGACGATGG - Intronic
1077504986 11:2925941-2925963 CTGGTCGCAGAACTGTACCAAGG + Intergenic
1078005406 11:7528885-7528907 CTGGATGGAGAACTGGGCCCTGG - Intronic
1078532507 11:12148103-12148125 GTGGATGCAGAGTTGGAAGATGG - Intronic
1079535044 11:21503971-21503993 CTGGATCTAGCACTGGACAAGGG - Intronic
1082748680 11:56995497-56995519 ATGGATGGAGAACTGGAAGGGGG + Intergenic
1084793758 11:71490928-71490950 CTGGATGCAGAACTGGACGAAGG - Exonic
1084824723 11:71721503-71721525 CTGCATTCTGACCTGGACGATGG - Intergenic
1086301638 11:85432297-85432319 AAGGGTGCAGAACTGGACGAAGG + Intronic
1089252635 11:117176076-117176098 CTGGAAACAGTACTGGACCAAGG + Intronic
1089772785 11:120815419-120815441 CTGGAGGCTGGGCTGGACGATGG - Exonic
1090540724 11:127700312-127700334 CTGGATGGGGAACTGGAGGCAGG + Intergenic
1092910243 12:13139885-13139907 TTGGATGTAGGACTGGATGAGGG - Intronic
1092910341 12:13140316-13140338 TTGGATGTAGGACTGGATGAGGG - Intronic
1094054759 12:26257289-26257311 AAGGGTGCAGAACTGGACGGAGG + Intronic
1094329024 12:29272650-29272672 AAGGATGCAGAACTGGACGGAGG - Intronic
1100322287 12:93507272-93507294 CTGAATGCATAACTGGAACAAGG - Exonic
1103070052 12:117933868-117933890 GTGGATGGAGAACTGGAGCACGG - Intronic
1113355051 13:109571036-109571058 CTGGAAGAAGGACTAGACGAAGG - Intergenic
1113527832 13:110994689-110994711 AAGGGTGCAGAACTGGACGGAGG + Intergenic
1113576690 13:111399984-111400006 CTGTCTGCAGAACTGGACCAGGG + Intergenic
1119266454 14:73265527-73265549 CTGGAGGCAGAATAGGAGGAAGG - Intronic
1119420378 14:74504686-74504708 CTGGATGCAGAACTTCCCCAGGG + Intronic
1121495334 14:94388292-94388314 CTGTAAGCAGAAGTGGATGAGGG - Intronic
1122786817 14:104167797-104167819 CTGGCTGCAGAGCAGGCCGAGGG - Intronic
1130563751 15:84978461-84978483 CTGGGGGCAGGACTGGAGGAAGG + Intergenic
1132095961 15:98985092-98985114 CTGGACGCAGAGCTTGAGGAGGG + Intronic
1132498348 16:274213-274235 CCGGCTGCAGAGCTGGACTATGG - Exonic
1133324539 16:4935278-4935300 CAGGATGGAGAGCTGCACGAAGG + Intronic
1133895175 16:9920376-9920398 CTGAATGCAGGACTGGGAGAGGG - Intronic
1134810979 16:17166812-17166834 GTGGATACAGAAGTGGATGATGG - Intronic
1139111104 16:63891831-63891853 CAGGATGCAGAACTGTAAAAAGG + Intergenic
1139669013 16:68479133-68479155 CTGCAGGCAGAACTGAAGGAAGG - Intergenic
1142711538 17:1726402-1726424 GCGGATGCAGAACTGGACCCCGG + Exonic
1142911705 17:3098650-3098672 CAGGAAGCAGAACTGGATGGAGG + Intergenic
1146923667 17:36729925-36729947 CTCCAGGCAGAACTGGACAAAGG + Intergenic
1148272740 17:46276465-46276487 CTGGAATCAGAACTGGATGTTGG - Intronic
1150763272 17:67981465-67981487 CTGGAATCAGAACTGGATGTTGG + Intronic
1152456453 17:80419575-80419597 CTGAAGGCAGAACTGATCGATGG - Intronic
1154010774 18:10572143-10572165 GTGGCTGCAAAACTGGACAAGGG + Intergenic
1154197657 18:12278401-12278423 CTGCAGGCACAGCTGGACGAAGG + Intergenic
1160366415 18:78329683-78329705 GTGGCTGGAGAACTGGAGGAAGG - Intergenic
1161009233 19:1952198-1952220 GTGGGTGCAGGGCTGGACGAGGG + Intronic
1162086216 19:8250933-8250955 CAGGAGGCAGGACTGGAAGATGG - Intronic
1162175516 19:8827175-8827197 CTGGATACAGTGCTGGAGGATGG + Intronic
1166361072 19:42253317-42253339 CGGGATGGAGAACTGGATGGAGG + Intronic
1168596624 19:57682758-57682780 CTGGCTCCAAAACTGGACCAGGG + Intronic
926214776 2:10898174-10898196 CTGGATGCTGATTTGGAGGAAGG + Intergenic
927001559 2:18800280-18800302 CTGCATGGAGAAATGGACGCAGG - Intergenic
927971509 2:27308425-27308447 CTGGAAGCAGCACTGGACGCAGG + Exonic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
930740072 2:54823300-54823322 CGGGAGGCAGAACTAGGCGAGGG + Intronic
932589893 2:73059026-73059048 CTGGAGGCAGAGCTGGACCTTGG - Intronic
941848363 2:170154178-170154200 CTGAAAGCAAAACTAGACGAAGG + Intergenic
942930463 2:181486432-181486454 CTGGCTGCAGAGCTGGAGCAGGG + Intronic
944912875 2:204327463-204327485 CTGGCTGCAGACCTGGAGAAAGG + Intergenic
945752928 2:213810795-213810817 TTGGTTGCAGAACTGGCTGAGGG + Intronic
946064142 2:216971947-216971969 ATGGAAGCAGAGCTGGACAATGG + Intergenic
946304573 2:218848501-218848523 CTGGAAGCAGTGCTGGAAGAAGG - Intergenic
946384272 2:219372694-219372716 CAGGTTGCAGAACTGGACACAGG - Intergenic
946546532 2:220749999-220750021 AAGGATGCAGAACTGGATGGAGG + Intergenic
948173087 2:235922049-235922071 CTGGAATCACAACTGGATGAAGG - Intronic
948811578 2:240481070-240481092 CTGGTAGCAGAACTTGAAGAAGG + Exonic
948841046 2:240649089-240649111 CTGGATTCAGGACTGAAGGAGGG + Intergenic
1169979107 20:11363831-11363853 AAGGGTGCAGAACTGGACGGAGG - Intergenic
1170164695 20:13348853-13348875 GTGGATCCAGAACTGTACTAAGG - Intergenic
1175647578 20:60687901-60687923 GTGGATTCAGAACTGGCCAAGGG - Intergenic
1175654528 20:60757799-60757821 CTGGATGCATATCTCGAGGAGGG + Intergenic
1176423551 21:6534003-6534025 CTGGAGGCAGACCTGGAGGCAGG + Intergenic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1179699045 21:43142319-43142341 CTGGAGGCAGACCTGGAGGCAGG + Intergenic
1179987558 21:44930081-44930103 CAGGACTCAGAACTGGAAGAGGG - Intronic
1181855327 22:25777460-25777482 CTGGAGGCAGATCTGGAGGCAGG + Intronic
1182797208 22:32999739-32999761 CTGGAGGCAGAACTAGAGGGAGG + Intronic
1183412920 22:37665968-37665990 CCCGGTGCAGAACTGGACCAAGG - Exonic
1184646118 22:45896372-45896394 GGGGATGCAGAACTGGATGCTGG + Intergenic
949459489 3:4274917-4274939 AAGGAAGCAGAACTGGACAAAGG + Intronic
949592830 3:5511333-5511355 AAGGATGCAGAACTGGACAGAGG + Intergenic
950230908 3:11275032-11275054 CAGGATGAAGATCTGGATGAAGG + Intronic
951035640 3:17929065-17929087 TTGGATGAAGAACTGGGCGGGGG - Intronic
952507940 3:34024584-34024606 CTGGAGGTGGAACTGGACCAAGG - Intergenic
953852267 3:46473394-46473416 CTTGATCCAGAACTGGAAGTTGG - Intronic
955167875 3:56532677-56532699 CTGGATGCATGACTGGAGAAAGG + Intergenic
955608808 3:60735329-60735351 CTGGAGTCAGAACTGGAGAAGGG - Intronic
960233587 3:115255782-115255804 AAGGGTGCAGAACTGGACGGAGG + Intergenic
961406023 3:126680055-126680077 AGGGATGCAGAACTGGAAGTGGG + Intergenic
963242638 3:143023300-143023322 CTGGATACAACACTGGACAAAGG - Intronic
963761065 3:149287785-149287807 ATGGATGCAGAGCTGGAAGCGGG - Intergenic
965094725 3:164210439-164210461 CTGGTTACAGAAATGGACGGTGG - Intergenic
965263457 3:166511603-166511625 AAGGATGCAGAACTGGACAGAGG + Intergenic
971652909 4:29302671-29302693 CTTAATGCAGAACTGGACAGTGG + Intergenic
974480249 4:62433545-62433567 AAGGATGCACAACTGGAGGATGG + Intergenic
977113709 4:92994152-92994174 ATAGATGCAGAAATGGAGGAAGG + Intronic
979392257 4:120141147-120141169 ATGGATGGAGAGCTGGAAGAGGG - Intergenic
981841159 4:149113940-149113962 TTGGAGGCAGAGCTGGAGGATGG + Intergenic
982402430 4:154983046-154983068 TTGGATGCAGAAATGAACCAAGG + Intergenic
983922254 4:173358514-173358536 CTGCATGAAGCACTGGAGGAGGG + Intergenic
986272295 5:6243897-6243919 CTGCATGGAGCACTGGAGGAAGG - Intergenic
990823962 5:59876160-59876182 CTAGATGCAGACCTGGAAAATGG - Intronic
996012257 5:118493985-118494007 CTGTAGGCAGAGCTGGACAATGG - Intergenic
1000202039 5:159020535-159020557 CTGGACACAGAACTGCAGGAAGG - Intronic
1001355773 5:171021789-171021811 AAGGGTGCAGAACTGGATGAAGG - Intronic
1003414339 6:5894561-5894583 TTGTAGGCAGAGCTGGACGAGGG + Intergenic
1004362490 6:14983631-14983653 GTGGCTGCAGACCTGGAAGAAGG + Intergenic
1004443205 6:15673118-15673140 CTGGATGCAGCCCTGCAGGATGG - Intergenic
1004566427 6:16802257-16802279 CTGGATGAAGAAAGGGACGATGG + Intergenic
1004760242 6:18657515-18657537 AAGGGTGCAGAACTGGACGGAGG + Intergenic
1005083452 6:21980577-21980599 CAGGCTGCAGAACAGGAAGAAGG - Intergenic
1007285250 6:40743018-40743040 CTGGATGCAGATCTGTAAAATGG - Intergenic
1010755907 6:79666159-79666181 CTGGAGGCTGAACTTGTCGAGGG + Intronic
1013603947 6:111730976-111730998 GTGGTGGCAGAACTGGCCGAGGG + Intronic
1015005927 6:128281631-128281653 CTGGAAGCAGAACTGTACCTCGG + Intronic
1017055588 6:150433017-150433039 CTGGCTGCAGAGCTTGACGCTGG - Intergenic
1022700669 7:32756802-32756824 CTGGGAGCAGATCTGGAAGATGG + Intergenic
1027569556 7:79847241-79847263 ATGGATGCAGAGCTGGAAGAGGG - Intergenic
1028260558 7:88658994-88659016 CTGGAGGCAGAAGTGGTGGAAGG + Intergenic
1034780909 7:153881713-153881735 CTGGAAGCAGAGCTGGGTGATGG - Intergenic
1035496412 7:159331171-159331193 CTAGATGCAGACATGGAGGACGG - Intergenic
1039491214 8:37948789-37948811 CTGGAAGCAGAACTGAACGTGGG + Intergenic
1042795765 8:72662059-72662081 CAGGATGAAGAACTGGATGCTGG - Intronic
1046057733 8:109098455-109098477 CTGGAAGAAGAACTGGAGGAGGG - Intronic
1046587620 8:116167262-116167284 CTTGATGAAGAAGTGGACAAAGG - Intergenic
1047223569 8:122938300-122938322 ATGGATTCATAACTGGACAAAGG - Intronic
1047762493 8:127964382-127964404 GTGGGAGCAGAACTGGAGGATGG + Intergenic
1049000377 8:139822247-139822269 CAGGAAGCAGACCTGGAAGACGG + Intronic
1049408490 8:142462075-142462097 CTGGGGGCAGGACTGGAGGAGGG + Intronic
1052717077 9:32129608-32129630 AAGGGTGCAGAACTGGACGGAGG + Intergenic
1053023981 9:34715482-34715504 CTGGATGCAGAGCTTGGGGAAGG + Intergenic
1053152142 9:35749849-35749871 CTGGATGCAGAAGTGGCCGTGGG - Exonic
1054800533 9:69344068-69344090 CTGGATGCAGGACTGGTCAGAGG - Intronic
1060661761 9:125408724-125408746 CTGGATGCTGAGCGGGAGGAAGG - Intergenic
1060803980 9:126563523-126563545 CAGGATGCAGAAGTGGAGGACGG + Intergenic
1187590823 X:20715277-20715299 CTGTTAGCAGAACTGGACGGGGG - Intergenic
1189187535 X:39066975-39066997 CAGGCTGAAGAACTGGCCGAGGG + Intergenic
1197624828 X:128790114-128790136 AAGGATGCAGAACTGGATGGAGG + Intergenic
1197634835 X:128903328-128903350 CTGAAAGCAGAACTGGACTGAGG - Intergenic
1199996198 X:153028269-153028291 CTGGCTACAGAAGGGGACGATGG + Intergenic
1201979798 Y:19893990-19894012 AAGGATGCAGAACTGGACAGAGG + Intergenic
1202109656 Y:21406527-21406549 TTGGATGCAGCACTGGCAGAGGG - Intergenic