ID: 1084795976

View in Genome Browser
Species Human (GRCh38)
Location 11:71504327-71504349
Sequence TCCAGGCTGCTGAGGGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 331}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084795971_1084795976 -10 Left 1084795971 11:71504314-71504336 CCGTCTGGCCATATCCAGGCTGC 0: 1
1: 0
2: 1
3: 18
4: 215
Right 1084795976 11:71504327-71504349 TCCAGGCTGCTGAGGGTCCTGGG 0: 1
1: 0
2: 3
3: 25
4: 331
1084795967_1084795976 10 Left 1084795967 11:71504294-71504316 CCAGTGAGAAGCTTCCAGCTCCG 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1084795976 11:71504327-71504349 TCCAGGCTGCTGAGGGTCCTGGG 0: 1
1: 0
2: 3
3: 25
4: 331
1084795966_1084795976 21 Left 1084795966 11:71504283-71504305 CCAGAGCTCGGCCAGTGAGAAGC 0: 1
1: 0
2: 0
3: 9
4: 150
Right 1084795976 11:71504327-71504349 TCCAGGCTGCTGAGGGTCCTGGG 0: 1
1: 0
2: 3
3: 25
4: 331
1084795969_1084795976 -4 Left 1084795969 11:71504308-71504330 CCAGCTCCGTCTGGCCATATCCA 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1084795976 11:71504327-71504349 TCCAGGCTGCTGAGGGTCCTGGG 0: 1
1: 0
2: 3
3: 25
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084795976 Original CRISPR TCCAGGCTGCTGAGGGTCCT GGG Intronic
900296714 1:1955608-1955630 TCCAGGGGGCTGAGGGGCCCAGG - Intronic
900484874 1:2917753-2917775 ACCAGGCGGCTGAGAGTCATGGG + Intergenic
900765489 1:4502178-4502200 TGGAGGCTGCTGATGGTCCAGGG - Intergenic
901194433 1:7432578-7432600 GCCAGGATGCTGAGGGGCCAGGG + Intronic
901684285 1:10935060-10935082 TCCAGGCTCCAGAGGGTCCTGGG + Intergenic
901715372 1:11149396-11149418 TCCAGGTTGATGAAGGTGCTGGG + Intronic
901799830 1:11701638-11701660 TCCGGGCTGCTGACTGTGCTCGG + Intronic
902242857 1:15100317-15100339 ACCCTCCTGCTGAGGGTCCTGGG - Intronic
902394257 1:16124084-16124106 TCCAGGCTGCTCAGAGTCTTCGG - Intergenic
902639715 1:17759278-17759300 TCCCTGCTGCAGAGGCTCCTCGG - Intronic
903753723 1:25646358-25646380 TCCAGGCTGCAGAGGGTGCGGGG + Intronic
903828159 1:26159735-26159757 TCCTGGAGGCTGAGGGACCTTGG - Intronic
903884686 1:26534166-26534188 ACCTGCCTGCTGAGGGACCTCGG + Intronic
904680237 1:32223948-32223970 TACAGGCTGCTGAGGGTTCCTGG + Intronic
905015589 1:34776382-34776404 TCAACGCTGCTGAGGGTTCAGGG + Intronic
906526581 1:46496804-46496826 TCCAGGCTGCTTTGTGACCTTGG - Intergenic
906732653 1:48096478-48096500 TCCAGTCTTCTCACGGTCCTTGG + Intergenic
906946657 1:50300468-50300490 TCCAGGCTGCACAGGGTACTGGG - Intergenic
907240484 1:53078360-53078382 TCCAGGCTGGAGAGCTTCCTGGG - Exonic
907332255 1:53678984-53679006 CCCAGGCTGTGGAGGGTCATAGG - Intronic
908813872 1:68011846-68011868 TATAGGCTGCTGTGTGTCCTTGG + Intergenic
909301459 1:74017939-74017961 TCAAGTCTGCTCAGAGTCCTTGG - Intergenic
909402396 1:75248756-75248778 TCCAGGCAGCTGTGTGTTCTTGG - Intronic
909500959 1:76335367-76335389 TCCCAGCTGCTTAGGGTCCAAGG + Intronic
912210607 1:107552784-107552806 TCTAGGCTGCTGTGGGTACAAGG + Intergenic
912580523 1:110717158-110717180 TCAAGGCTGCTGCGGCTCTTGGG - Intergenic
912693439 1:111821793-111821815 TGCAGGATGCTCAGGGTCCCAGG - Intronic
912948190 1:114102156-114102178 TCAAGGCTGCTGAGGGAAATAGG - Intronic
915440822 1:155944506-155944528 CGCAGGCTGCTCAGGCTCCTGGG + Intergenic
915456061 1:156041622-156041644 TGCTGCCTGCTGAGGGTGCTGGG + Exonic
915463029 1:156081126-156081148 TCCAGGCGGCTGGGGGCCCCAGG + Intronic
915805436 1:158844026-158844048 TGCTGGCTCCTGAGGGACCTGGG - Exonic
916052749 1:161047869-161047891 TCCAGGCAGCTAAGGGGCCGAGG + Exonic
917789864 1:178492603-178492625 TCCTGCCTGCAGAGGATCCTGGG - Intergenic
918630341 1:186709910-186709932 TCCATGCTGTAGAGGGTCTTTGG - Intergenic
923453537 1:234142388-234142410 CCCAGGCTGCTCAGGGCCGTGGG - Intronic
924192333 1:241566862-241566884 TGCAGGCTCCTCAGGCTCCTTGG + Intronic
1066364897 10:34767456-34767478 GTCAGGCTGCTGAGTGTTCTGGG - Intronic
1067088814 10:43256276-43256298 TGCAGGCTGCTGTGTGTTCTGGG - Intronic
1068058748 10:52039679-52039701 CACAGGCTGCACAGGGTCCTAGG - Intronic
1068987551 10:63121147-63121169 TCTAGGTTGCTGAGGGGTCTAGG + Intergenic
1069606726 10:69743557-69743579 ACCAGGCCGCTGATGGCCCTAGG + Intergenic
1069716830 10:70526527-70526549 ACCAGGCTGTTGAAGGGCCTTGG + Intronic
1071482949 10:86078774-86078796 GCCAGGGGGCTGGGGGTCCTAGG - Intronic
1072237489 10:93465972-93465994 TCCAGGCTTCTGAGTTTCCCTGG + Intronic
1072298313 10:94034500-94034522 TCCAGGCAGCTGACACTCCTAGG + Intronic
1072541413 10:96401008-96401030 TCCAGCCTGCTTAGTCTCCTTGG - Intronic
1073474577 10:103744496-103744518 CCCAGGCTGCAGAGGGTCAGAGG - Intronic
1075475595 10:122730916-122730938 TGCAGGCTGGTGAGAGGCCTTGG - Intergenic
1075666082 10:124231894-124231916 TCCTCTCTGCTGAGGGTCTTTGG - Intergenic
1075793584 10:125103254-125103276 TCCAGGCTGCAGTGGGGCCAGGG - Intronic
1076344545 10:129771542-129771564 TCCAGGCTGTTGAAAGTCCCTGG + Intergenic
1076554423 10:131312177-131312199 TCCAGGGCGCGGAGGGTACTGGG + Intergenic
1076625941 10:131822126-131822148 TCCAGGCAGCAGAGGGTGCAGGG + Intergenic
1076696258 10:132248803-132248825 TGCGGGCTGCTTGGGGTCCTGGG - Intronic
1076765774 10:132632232-132632254 TGCAGGCTGCAGAGGCTCCCAGG + Intronic
1076801989 10:132835181-132835203 GCCAGGCTGCTGAAGGGCTTGGG - Intronic
1076846802 10:133073189-133073211 TCCAGGCTGGTGAGGACCCTGGG + Intronic
1077310914 11:1888788-1888810 CCCAGGCTCCTCAGGGGCCTGGG - Intronic
1077375844 11:2204783-2204805 CTCAGGCTCCGGAGGGTCCTAGG - Intergenic
1078069189 11:8097175-8097197 TTTGGGCTGCTTAGGGTCCTTGG + Intronic
1079303149 11:19297367-19297389 TCCAGACAGCTGAGGGTCAGAGG - Intergenic
1081591655 11:44427293-44427315 TCCAAGCTCCTGAAGGTCCAGGG - Intergenic
1081723379 11:45306442-45306464 CCCAGGATCCTGGGGGTCCTGGG - Intergenic
1083793099 11:64998748-64998770 TCCTAGCTTCTGAGGGGCCTGGG + Intergenic
1084536129 11:69758315-69758337 CCCAGGCAGCTGAGGGTCCTTGG + Intergenic
1084795976 11:71504327-71504349 TCCAGGCTGCTGAGGGTCCTGGG + Intronic
1084891096 11:72237544-72237566 TGCTGGCTGGTGAGGGGCCTGGG - Exonic
1085654052 11:78296217-78296239 GCCAGACTGGTAAGGGTCCTCGG + Intronic
1086508313 11:87528713-87528735 CCCAGGCTTCAGATGGTCCTTGG + Intergenic
1088743791 11:112787596-112787618 TCCAAGCTGATGAGGAGCCTGGG - Intergenic
1089635310 11:119808045-119808067 CCCATCCTGATGAGGGTCCTGGG + Intergenic
1090157532 11:124457407-124457429 TCCAGGCTTCTGTCTGTCCTTGG - Intergenic
1090332560 11:125943190-125943212 TCCAGGCTGATGTGAGCCCTGGG + Intergenic
1090422633 11:126586000-126586022 TCCAAGCTGCTGAGGGAATTAGG - Intronic
1091025985 11:132141815-132141837 TCCAGGATGCTGAGTATGCTAGG + Intronic
1091146878 11:133287840-133287862 GCCTGGCTGCAGAGGCTCCTTGG - Intronic
1091323442 11:134667422-134667444 GCCAGGCTGCTGTGTGACCTTGG - Intergenic
1091602770 12:1928076-1928098 TCCAGGCTGCTGTGGCCTCTGGG - Intergenic
1093547042 12:20360606-20360628 TTCTGGCTGCTGAGAGTACTTGG - Intergenic
1096061787 12:48707491-48707513 TCCAGGCTGCTCAAACTCCTGGG + Intronic
1096476929 12:51914105-51914127 TCCAGGCTCATGAGAGCCCTTGG - Intronic
1096520783 12:52183445-52183467 TCCTGGCTCCTGGGGGCCCTAGG + Intronic
1097199953 12:57269869-57269891 GCTAGTCTGCTGAGGGTGCTGGG + Exonic
1098281395 12:68866168-68866190 TCCAGTGTTCTCAGGGTCCTTGG + Intronic
1098350025 12:69548919-69548941 TCCATGCAGGTGAGGCTCCTAGG + Intronic
1100512227 12:95286876-95286898 TCCAAGCTGCTCTGGGTCATGGG + Intronic
1101782595 12:107849050-107849072 TCCTGGATCCTGAGGGTCTTTGG + Intergenic
1102576981 12:113861854-113861876 CCCAGGCAGCTGAAGGGCCTTGG + Intronic
1103094645 12:118122988-118123010 TCAAGGCTGCTTGGGTTCCTGGG - Intronic
1103921661 12:124402491-124402513 TCCTGGCTGCTGCGGGGCATGGG + Exonic
1104063704 12:125288898-125288920 CCCAGGCTGCTGATGGTAGTTGG + Intronic
1104628879 12:130382444-130382466 ACCATGCTGCTTAGGGGCCTGGG + Intergenic
1105441213 13:20416466-20416488 TCCAGGCTGCTGGAAGGCCTGGG + Intronic
1105636411 13:22219959-22219981 TCCAGTCTCCTGAGTCTCCTAGG - Intergenic
1112640143 13:101264497-101264519 TCCAGGTTGCTGCTGGTCCAGGG - Intronic
1113586332 13:111468484-111468506 GCCGGGCCGGTGAGGGTCCTGGG - Intergenic
1114355777 14:21906538-21906560 TCCCAGCTGCTCAGGGTCCTTGG - Intergenic
1114722073 14:24893016-24893038 GCCAGGCTGCAGAGGGGCTTGGG + Intronic
1117342693 14:54805559-54805581 TCCAGGCTGGGGAGAGTGCTGGG - Intergenic
1118311572 14:64697390-64697412 TTTAGGCTGCAGAGGGTCCTGGG + Intergenic
1118709412 14:68507462-68507484 TTCAGATTGCAGAGGGTCCTAGG + Intronic
1118920957 14:70149630-70149652 TACAGGCTGCAGAGGGCTCTTGG - Intronic
1119739582 14:77005480-77005502 TGCAGGTTATTGAGGGTCCTAGG - Intergenic
1121104579 14:91272024-91272046 TGCAGGCTGCCCTGGGTCCTGGG + Exonic
1121682397 14:95804509-95804531 TGCAGGCTGCTGAGGGTTCAGGG - Intergenic
1122803977 14:104247525-104247547 TCCAGGCTGCAGAGGGCTTTGGG + Intergenic
1123042899 14:105497696-105497718 TCCAGCCCGCTGTGGGACCTGGG + Intronic
1124029971 15:26001593-26001615 ACCAGGCCGCTGAGGGCCCCAGG - Intergenic
1124219222 15:27834943-27834965 TCCTTGCTGCTGAATGTCCTAGG - Intronic
1125728048 15:41878105-41878127 CCCAGGCAGCTCAGTGTCCTGGG + Intronic
1125749412 15:42018715-42018737 TCCAGGCTGGGGAGGGGGCTGGG - Intronic
1125811857 15:42548733-42548755 TCCCGGCTACTGCGGGTCCTGGG - Exonic
1126191794 15:45886009-45886031 GCCAGGCTGGTGCGGGTTCTGGG + Intergenic
1128556005 15:68632060-68632082 TCCAGGCATCTGAGAGGCCTGGG - Intronic
1128744816 15:70106087-70106109 TCCAGGCTGCAGGTGGACCTGGG + Intergenic
1129206952 15:74043046-74043068 TCCAGGACCCTGAGGGTGCTGGG - Exonic
1129386754 15:75200701-75200723 CCCAGCCTGCTGAGTGACCTGGG + Intronic
1132120084 15:99168846-99168868 CCCACGCTGCTGAGGGTGCAGGG - Intronic
1132710111 16:1262726-1262748 TCCAGGCTGCTCAGGGGTCCTGG + Intergenic
1132864289 16:2085924-2085946 GGCAGGCTGCTGAGGGGCCAGGG + Intronic
1133872364 16:9701322-9701344 TCCAGGCCAATGAGGGTCATAGG + Intergenic
1134021429 16:10923954-10923976 GCCAGGATGCTGAGGCTCATGGG - Exonic
1135150208 16:19998848-19998870 TCCTGGCTGCTGAGCTTTCTTGG + Intergenic
1135245965 16:20857430-20857452 TCCAGAGTACTCAGGGTCCTGGG + Exonic
1136997719 16:35202169-35202191 GCAAGGAGGCTGAGGGTCCTTGG + Intergenic
1137905258 16:52315085-52315107 TCAGGGCTGCTGAGGGTACAGGG + Intergenic
1138263600 16:55643669-55643691 TCCAGGCTGGGAAGGATCCTTGG - Intergenic
1138584770 16:57962659-57962681 TCCAGGCTGCCCAGGGGGCTGGG - Intronic
1138679121 16:58672309-58672331 TCCAGGCTGATGTTGCTCCTAGG - Intronic
1141092080 16:81137340-81137362 TGCAGCCTGTTGGGGGTCCTGGG - Intergenic
1142124587 16:88403851-88403873 ACCAGGCTGAGGAGTGTCCTGGG - Intergenic
1142497064 17:311474-311496 TCCTGGCTGCTCTGAGTCCTGGG + Intronic
1142619971 17:1159021-1159043 ACCAGGCTGCTGTGGGTCCAAGG - Intronic
1142697390 17:1640906-1640928 TGCTGGCTCCTGATGGTCCTGGG - Intronic
1142707932 17:1708362-1708384 TCAAGGCTGCTCAGGGCCCCAGG - Intronic
1143845045 17:9767586-9767608 TCCTGGCTGCTGCTGGCCCTGGG - Intergenic
1143904322 17:10197652-10197674 TCAAGCCTGCTGAGGGGGCTCGG + Intronic
1144291283 17:13829118-13829140 TCCAAGCTTCTGAGGGCCTTGGG + Intergenic
1144344755 17:14339790-14339812 GACAGGCTGCTGAGGTTGCTGGG + Intronic
1144546815 17:16204832-16204854 ACCATGCTGCTGTGGGACCTTGG - Intronic
1144855547 17:18265422-18265444 TTCAGGCAGCTGAGGGTCCTGGG + Exonic
1146623393 17:34417719-34417741 CCCAGGCTTGTGGGGGTCCTAGG - Intergenic
1146688790 17:34858889-34858911 TCCAGGCTGGTCAGCTTCCTTGG - Intergenic
1148821009 17:50359641-50359663 TACAGGCTTCTGAGGGCTCTAGG + Intronic
1148977174 17:51539592-51539614 TGCAGGCTGCTGAGGGTAGAGGG + Intergenic
1150207010 17:63416785-63416807 TCCAGGGTGCTGAGGGAAGTGGG + Intronic
1151566701 17:74902539-74902561 CCTAGGGTGCTGAGGGGCCTGGG - Intergenic
1151983473 17:77527906-77527928 TCCAGGCTGTTGTGGGGGCTGGG + Intergenic
1152099095 17:78290709-78290731 GCCTGCCTGCTGAGTGTCCTTGG + Intergenic
1152679183 17:81656875-81656897 GCCAGGCTGCAGAGGGTTTTGGG - Intronic
1152740371 17:82016030-82016052 TCCAGGCTGCTCAGGGCCACAGG - Intronic
1152828325 17:82481340-82481362 TACTGACAGCTGAGGGTCCTAGG + Intronic
1153532257 18:6059032-6059054 TGCCGTCAGCTGAGGGTCCTTGG - Intronic
1153944851 18:10009496-10009518 GTGCGGCTGCTGAGGGTCCTGGG + Intergenic
1157517330 18:48320326-48320348 TGCAGGCTGCTGTGGGGACTTGG + Intronic
1159582983 18:70253668-70253690 TCCAGGGTGCTGAGGGTGAAGGG - Intergenic
1160720770 19:596026-596048 TCCAAGGGGCTGAGGGTCCTGGG + Intronic
1160742670 19:694733-694755 TCCAGGCTGGTGGGGGAGCTGGG - Intronic
1160778643 19:868129-868151 TCCAGGGATCTGGGGGTCCTGGG + Exonic
1161067065 19:2243888-2243910 TCCACGGTGCTGAGGGGACTCGG - Intronic
1161575358 19:5051793-5051815 TCCAGACTGCCGCGGGTCATGGG - Intronic
1161687614 19:5711175-5711197 CCCAGGCTGCTGCAGGGCCTAGG - Intronic
1163586780 19:18168651-18168673 TCCAGGCAGCTGGGGAGCCTCGG + Intronic
1163628315 19:18403582-18403604 TCCTGGGGACTGAGGGTCCTGGG + Intergenic
1163628336 19:18403646-18403668 TCCTGGGGCCTGAGGGTCCTGGG + Intergenic
1165838845 19:38774817-38774839 AGCAGGCTGCTGAGAGGCCTGGG + Intergenic
1165840610 19:38787323-38787345 AGCAGGCTGCTGAGAGGCCTGGG - Intergenic
1166052707 19:40269942-40269964 TGCAGGCCGCGTAGGGTCCTGGG - Intronic
1166071728 19:40392154-40392176 GCCAGGCTGCTTAGGGTCAGAGG - Intergenic
1166270251 19:41709129-41709151 CCCAGGCTGTGGAGGGCCCTGGG + Intronic
1167214316 19:48154331-48154353 TCCAGACTTCTGAGGTTCCGGGG - Intronic
1167438028 19:49491140-49491162 TCAGGCCTGCTGAGGGACCTGGG + Intronic
1167642853 19:50691350-50691372 TGCTGGCTGCTGGGGGGCCTTGG - Intronic
1168059525 19:53883217-53883239 TCCACCCTCCTGAGGGTCCCAGG - Intronic
925121163 2:1419566-1419588 TCCAGGCTGTTGAGGGCCTGGGG - Intronic
925464708 2:4096429-4096451 TCCAGGCAGCTGCAGGGCCTTGG + Intergenic
925978953 2:9161631-9161653 TCCAGGCTGCTGAGGACAGTTGG + Intergenic
926406213 2:12555503-12555525 TCCAGGCTGGGGAGAGTTCTAGG - Intergenic
926699391 2:15793220-15793242 CCCAGGATGCTGAGGGTCAGTGG - Intergenic
927682345 2:25148217-25148239 CCCCGGCTGCTGAGGTTCCAAGG - Intronic
927786361 2:25977887-25977909 TGCTGGCTGCTGATTGTCCTAGG + Intronic
928013101 2:27629087-27629109 TCCAGGCTTCTGGGGGTCCGCGG + Exonic
928234236 2:29526102-29526124 CTCAGGCTGCTCAGGGTCATGGG - Intronic
928359976 2:30654993-30655015 TCTGGGCTGCTGTGAGTCCTGGG + Intergenic
929597874 2:43187429-43187451 TCCAGACAGGTGGGGGTCCTGGG - Intergenic
929640526 2:43574511-43574533 CCCAGACTGCTGAGAGTTCTTGG - Exonic
930306971 2:49686663-49686685 TCAAGGTCACTGAGGGTCCTGGG - Intergenic
931636303 2:64343685-64343707 CCCAGGATGGTGAGGTTCCTGGG + Intergenic
932225362 2:70035225-70035247 ATCAGGCTGCTGAGAGTCCCTGG - Intergenic
932596231 2:73095231-73095253 TCCTGGCTGCAGAGGCACCTGGG - Intronic
935620327 2:105124567-105124589 TCGAGCCTACTGAGGGTCTTAGG + Intergenic
936431252 2:112465494-112465516 ACCAGGCTACTGAGGCTACTGGG + Intergenic
937932997 2:127220035-127220057 GCCAGGTTGGCGAGGGTCCTCGG + Intronic
938779952 2:134575930-134575952 CCCAGGATGCAGAAGGTCCTAGG + Intronic
938911892 2:135893142-135893164 TCCACTCTGCTGTGTGTCCTGGG - Intergenic
939118415 2:138088124-138088146 TCCAGGCTGTTGAGTAGCCTGGG - Intergenic
939595425 2:144116912-144116934 TCTATGCTATTGAGGGTCCTGGG + Intronic
940446750 2:153785846-153785868 TCCAGGCTCCGGAGAGTCCTTGG + Intergenic
944146744 2:196514498-196514520 TCCAGGCTTCAGACTGTCCTTGG - Intronic
946166357 2:217866533-217866555 ACCAGGCTGCAGAGGTTCCCAGG + Intronic
946248362 2:218399608-218399630 TCCAGGCCGCCGAGCGCCCTCGG - Intronic
947617926 2:231570116-231570138 TCCAGGCCTCTGGGGGCCCTGGG + Intergenic
947913492 2:233817794-233817816 TCCAGGCTGCTCAGCCTCCAGGG + Intronic
948383142 2:237564674-237564696 TCCAGTCTTCTGAGGCTCCAAGG - Intergenic
948721801 2:239905393-239905415 TCGAGGCTGCTGAGGAGCCCAGG - Intronic
948918460 2:241050514-241050536 TCCAGGCTGCGGGGGTGCCTGGG - Intronic
1169855378 20:10096162-10096184 TGGTGGCTGGTGAGGGTCCTGGG - Intergenic
1170042285 20:12051483-12051505 CCCAGACAGCTGAGGGTCTTGGG + Intergenic
1170575839 20:17660800-17660822 TCATGGCTGCTGAGGCTCCTGGG - Intronic
1172647776 20:36482123-36482145 TCTAGGCTGCCGAGGGATCTTGG + Intronic
1172926165 20:38537908-38537930 TCCAGGATGCAGAGTGTTCTTGG + Intronic
1173016996 20:39234759-39234781 TTCAGGGTTCTGAGGGTCATGGG + Intergenic
1175673903 20:60930934-60930956 TCCAGGCCCCTGAGAGTCCCTGG + Intergenic
1175839618 20:62018809-62018831 ACGAGGATGCTGAGGGTCTTTGG - Intronic
1175976648 20:62713738-62713760 CACAGGCAGCTGAGTGTCCTGGG + Intronic
1176254650 20:64145573-64145595 TGCAGGCTGCTGTAGGGCCTCGG - Intergenic
1177762445 21:25417713-25417735 TGCAGGCTGCCTAGGGACCTCGG + Intergenic
1178269505 21:31176911-31176933 TCTAGAATGCTGAGGTTCCTGGG - Intronic
1179594736 21:42435072-42435094 TCCAGTCTGCTGAGGAGGCTGGG + Intronic
1179628719 21:42663853-42663875 TCCTGGATGCTGAGAGGCCTGGG - Intronic
1179966156 21:44807409-44807431 GCAAGGCTCCTGTGGGTCCTAGG - Intronic
1180141808 21:45897753-45897775 CCTGGGCTGCTGTGGGTCCTGGG + Intronic
1180141816 21:45897787-45897809 CCCGAGCTGCTGTGGGTCCTGGG + Intronic
1180869429 22:19138026-19138048 TCCAGGCTGCTTGGGGCCGTGGG - Intronic
1180980042 22:19874090-19874112 CCCAGGCAGCCGTGGGTCCTTGG - Intergenic
1181523016 22:23460113-23460135 CCCAGGCAGCTGGGGGTCCCAGG - Intergenic
1181534622 22:23534993-23535015 TCCAGGCTGCCGAGGAACCAAGG - Intergenic
1181766275 22:25094440-25094462 TCCCACCTGCTGAGGGGCCTTGG - Intronic
1182023253 22:27098553-27098575 ACCATGCTGCCCAGGGTCCTTGG - Intergenic
1183069187 22:35384419-35384441 TCCAGGCTGGGTGGGGTCCTTGG + Intronic
1183334614 22:37239529-37239551 TCCAGGCTGCTGAGAGCACCTGG + Intronic
1183705781 22:39474199-39474221 TTCAGGCTGGTGAGGGGCTTAGG + Intronic
1184471067 22:44696683-44696705 TCAAGGCTGCTGTGGGACCAAGG + Intronic
1184890315 22:47375189-47375211 TCCACGCTGCTCCGGGGCCTCGG - Intergenic
950699070 3:14727545-14727567 TCCTGACTGCTGATGGGCCTGGG + Intronic
951339171 3:21463496-21463518 CTCAGGCTGCTCAGGGTCCCAGG - Intronic
952634983 3:35518319-35518341 TAGAGGCTGCTTAGGTTCCTTGG + Intergenic
953094101 3:39757731-39757753 TCAGGGCTGCTCAGGGCCCTTGG + Intergenic
953856045 3:46499784-46499806 TCTTGGCTGCCGAGGGTCCCTGG - Intronic
954276419 3:49544706-49544728 TCCAGGCTTCTAAAGGTCCAGGG - Intergenic
954300440 3:49698228-49698250 TCCAGGTTAGTTAGGGTCCTAGG - Intronic
954445907 3:50546826-50546848 TCCAGGCTCCTGGGGGAGCTGGG - Intergenic
955419690 3:58724093-58724115 TCCATGCTGTGGAGGGGCCTGGG + Intronic
955823905 3:62924752-62924774 GCCAGGCTGCTAAGAGTCCAAGG + Intergenic
961458243 3:127034706-127034728 GCCAGGCTGCTCAGACTCCTGGG + Exonic
961484714 3:127208709-127208731 TCCAGGCTGCAGTGGGGCCCGGG + Intergenic
961646543 3:128395702-128395724 TCCTGGCTGCTGATTGGCCTGGG - Intronic
962827747 3:139112239-139112261 CCAAGGCTTCTGTGGGTCCTGGG + Intronic
963732318 3:148986151-148986173 TGCTGCCTGCTGAGGGTGCTGGG + Intergenic
964430286 3:156598589-156598611 TCCAGGCTGCTGAGGCTATGGGG + Intergenic
967919242 3:194602251-194602273 CCCAGGCCGCTGTGGCTCCTGGG + Intronic
968460304 4:721472-721494 TCCAGGCTGCAGAGGGTGCCGGG + Intronic
968882959 4:3310525-3310547 TCCATGCTGCTCTGGGTCCAGGG + Intronic
969279856 4:6162394-6162416 TCTTTGCTGGTGAGGGTCCTGGG + Intronic
973298771 4:48556611-48556633 TCCAGACAGCTGTGGTTCCTAGG + Intronic
975394009 4:73853845-73853867 TCCAGGCTGGTGATGTGCCTGGG - Exonic
975405220 4:73981459-73981481 TCCAGGCTGGTGATGTGCCTGGG + Exonic
976305253 4:83553520-83553542 TCCAAGCTGCTGAGGGGTTTTGG - Intronic
977380020 4:96260964-96260986 TCTAGGCTTCTCAGTGTCCTCGG - Intergenic
979448419 4:120840472-120840494 CCCACCCTGCTGAGGGTGCTGGG - Intronic
979553361 4:122016534-122016556 TACAGGCTGCTGAAGCACCTGGG - Intergenic
979670329 4:123354527-123354549 TCTGAGCTACTGAGGGTCCTTGG - Intergenic
980062392 4:128145516-128145538 GTCAGGCTGCTGTGTGTCCTTGG - Intronic
981351723 4:143737630-143737652 TGCTGGCTGCTCAGGGTGCTTGG + Intergenic
982338577 4:154268986-154269008 TCCAGGTGTCTGAGGGTTCTGGG - Intronic
985476082 5:80052-80074 TCCAGGCTGTGGTGGGTCATGGG - Intergenic
985793400 5:1945003-1945025 ACCAGGCTGCTGAGTGGCTTAGG + Intergenic
988993534 5:36693352-36693374 TCCGGGCTGCTCTGGGTCATCGG - Intergenic
996662264 5:126018403-126018425 TCCAGGCTTATAAGGGGCCTAGG - Intergenic
997880261 5:137582971-137582993 CCCAGGCTTCTGAGGGTCTATGG + Intronic
998004716 5:138649339-138649361 TCCAGGAGGCTGAGGCTGCTGGG - Intronic
998025815 5:138815364-138815386 TCCAGGCAGGTTAGGTTCCTGGG - Intronic
998162718 5:139822513-139822535 TCCAGGGTGGTCAGGCTCCTGGG + Intronic
999896477 5:156039366-156039388 TTCAGGATGCTGAGGGGTCTGGG - Intronic
1000041343 5:157487373-157487395 TGCAGGCTTTGGAGGGTCCTTGG - Intronic
1002292699 5:178210456-178210478 TCACGGCTGGTGAGGGTCCTGGG + Intronic
1002441587 5:179267141-179267163 TCCAGGCCGCAGGGGATCCTGGG - Intronic
1002533505 5:179863460-179863482 TCCAGGCTGCTCATGGTCACTGG + Exonic
1003525077 6:6890652-6890674 TGCAGCCTGGTCAGGGTCCTTGG - Intergenic
1003569624 6:7247419-7247441 GCCAGGCAGGAGAGGGTCCTTGG + Intronic
1003883806 6:10502629-10502651 TCAAGACTGCTGAGGTTCCTAGG - Intronic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006577029 6:35053967-35053989 TGCAGGCTGGTGCTGGTCCTGGG + Intronic
1006633098 6:35443368-35443390 TCCAGGGGGCTGGGGGTCTTTGG - Intergenic
1008097077 6:47350058-47350080 TCCAAACTGCTGAGGCTCTTGGG - Intergenic
1008605069 6:53132269-53132291 GCCAGGCTTCTGAGGGTCAGGGG - Intronic
1008953372 6:57186016-57186038 TCCAAGCTGCTTGGGGTCCCTGG + Exonic
1009397781 6:63220925-63220947 TTCAGGTTTGTGAGGGTCCTGGG - Intergenic
1011112551 6:83853975-83853997 GCGAGGCTGCTGAGAGCCCTGGG + Intronic
1011191981 6:84738898-84738920 TCCTGGCTGCTGTGAGTCCAAGG + Intronic
1013190007 6:107794370-107794392 TCCAGGCTGCTTTGGGACCAGGG - Intronic
1016948043 6:149552102-149552124 TGCAGGCTGCTGTGGGACCAAGG - Intergenic
1017553177 6:155532870-155532892 TCTAGGCTGCTGATAGTCCTGGG + Intergenic
1017882116 6:158569251-158569273 TGCAGGCTGCAGAGGGTCCCAGG + Intronic
1019307156 7:341162-341184 GCCATGCTGTTGAGGGGCCTGGG + Intergenic
1019505173 7:1386902-1386924 CCCAGGCTGCAGACGGGCCTGGG + Intergenic
1019989958 7:4683578-4683600 TCCAAGCTGGTGGGGGTCCAGGG - Intronic
1022497775 7:30863935-30863957 CCAAGGATGCTCAGGGTCCTGGG + Intronic
1022498810 7:30869836-30869858 TCCAGCCTGCTGTGTGGCCTCGG - Intronic
1023279937 7:38559105-38559127 TCCAGCCTTCTCAGGTTCCTAGG + Intronic
1023844225 7:44112079-44112101 TCCAGGCAGCTGGGGGTTGTGGG + Intronic
1024972563 7:55084244-55084266 TCCAGGCTCATAAGGGTTCTTGG + Intronic
1024979457 7:55145244-55145266 TCCAGGCTGCTGTGGCAGCTCGG - Intronic
1025201221 7:56963014-56963036 TCCACCCTGCTGAGTGCCCTGGG + Intergenic
1025258164 7:57399327-57399349 GGGAGGCAGCTGAGGGTCCTGGG + Intergenic
1025610463 7:63072363-63072385 GGGAGGCAGCTGAGGGTCCTGGG - Intergenic
1025670723 7:63613919-63613941 TCCACCCTGCTGAGTGCCCTGGG - Intergenic
1025709029 7:63890888-63890910 AGGAGGCAGCTGAGGGTCCTGGG + Intergenic
1025806019 7:64835517-64835539 ACCAGGGTGGAGAGGGTCCTAGG + Intergenic
1026082391 7:67233462-67233484 GCCAGGCTGCTAAGGGTCTGTGG - Intronic
1026694680 7:72580531-72580553 GCCAGGCTGCTAAGGGTCTGTGG + Intronic
1027051790 7:75025418-75025440 TCCAGGCTGGTGGGTCTCCTGGG - Intergenic
1029456475 7:100674719-100674741 TGGGGGCTGCTGAGGGCCCTGGG + Intronic
1031498487 7:122481892-122481914 TCCCGGCTGCTGAGATTACTTGG + Intronic
1033171787 7:139091118-139091140 GCCCAGCTGCTGAGGGTTCTGGG - Intronic
1034915935 7:155039058-155039080 TCCAGGTAGCTGATGATCCTTGG + Intergenic
1035297220 7:157873988-157874010 CCGAGGCTGCTCAGGGTCCTGGG - Intronic
1035351595 7:158251227-158251249 TCCTGCCTGCTGAGGTCCCTGGG + Intronic
1035625436 8:1067412-1067434 TGCAGGCTCCTGAGTGTACTTGG + Intergenic
1035993309 8:4516455-4516477 TCCAGGCTGCTGAGAGACAACGG + Intronic
1036572884 8:9997410-9997432 TCCAAGCCCCTGGGGGTCCTGGG - Intergenic
1041520417 8:58749899-58749921 ACCAGGCTGCTGTTGGTACTTGG + Intergenic
1041679447 8:60573425-60573447 TGAAGGCTGCTGTGGGACCTGGG + Intronic
1042817412 8:72892540-72892562 TTCAGGCTGCTGAGGGTTCAAGG - Intronic
1043838590 8:85074428-85074450 TCAAGGCTGCTGTGGTTCTTTGG - Intergenic
1045427056 8:102077701-102077723 TCCAGTCTGCTGTCTGTCCTTGG - Intronic
1045434024 8:102141571-102141593 GACAGGCAGCTGAAGGTCCTGGG + Intergenic
1047569846 8:126085668-126085690 TCCTGGATGCTCAGGGTGCTAGG - Intergenic
1049510540 8:143024753-143024775 TCCAGGCTGCTTCTGGACCTCGG + Intergenic
1049552486 8:143267062-143267084 TCCAGGCCTCCGGGGGTCCTCGG - Intronic
1054903035 9:70389490-70389512 TCCTGACTCCTGGGGGTCCTGGG + Intronic
1055834192 9:80419457-80419479 TCCAGGCTGCAGAGGGTTCATGG - Intergenic
1055986787 9:82061536-82061558 TCCAGGCTGCCTATGGCCCTGGG + Intergenic
1056554864 9:87679809-87679831 TCCATGCTGCAGAGGGGGCTGGG - Intronic
1057185103 9:93053057-93053079 CTCAGGCTGCTGAGGTTCCCTGG - Intergenic
1057278054 9:93686697-93686719 CCCAGGCTGCGCAGGGTCCTGGG + Intergenic
1057474408 9:95386397-95386419 TCCAGGCTGTTGAGGATTTTAGG + Intergenic
1060532382 9:124355457-124355479 TTCAGGCTGGCCAGGGTCCTGGG - Intronic
1060729794 9:126030090-126030112 TCCAGCCTGCTGTGGGACCATGG + Intergenic
1061121811 9:128647882-128647904 TTCAGGCTGCAGAGCGTCCCTGG - Intronic
1061251965 9:129431676-129431698 CCCAAGCTGATGAGGCTCCTGGG - Intergenic
1061393485 9:130330639-130330661 TCACGGCTTCTGAGGTTCCTAGG - Intronic
1061422179 9:130478380-130478402 GGCAGGCTGCGGAGGGTCCTGGG + Intronic
1061821187 9:133227954-133227976 TCCAGGATTGTGAGGGTCATGGG + Intergenic
1061834261 9:133318410-133318432 TCCAGGGTCGTGAGGGTCATGGG - Intergenic
1061919953 9:133777329-133777351 GCCTGGGTGCTGAGGGTTCTGGG - Intronic
1062238068 9:135522122-135522144 TCCAGGGTCGTGAGGGTCATGGG - Exonic
1062385294 9:136306959-136306981 CCCTGGCTGCTGGGGCTCCTGGG + Intergenic
1062538307 9:137030462-137030484 TTCAGGGTGGGGAGGGTCCTCGG + Exonic
1185634733 X:1543429-1543451 TCCAGGCTGCAGTGAGACCTGGG + Intergenic
1186397537 X:9224966-9224988 TCCAGACTGCAGAGTGTCCCTGG + Intergenic
1188007872 X:25029408-25029430 TCCCGGCTGCTGCTGGTACTGGG + Intergenic
1189057827 X:37717137-37717159 TCCAGACTCCTTAGGGTCCTGGG + Intronic
1193756760 X:85418519-85418541 TCCAGGCTGCCTTGGTTCCTTGG - Intergenic
1194745219 X:97620786-97620808 TCCAGGTTGATGGTGGTCCTGGG - Intergenic
1195637464 X:107133819-107133841 TCCCGGCTACTCAGGGTGCTGGG + Intronic
1199111892 X:143945445-143945467 TCCAGGCAGCTCAGGGTGCATGG - Intergenic
1200021529 X:153214764-153214786 TCCAGGCTTCTGAGGGGATTGGG - Intergenic
1201378596 Y:13347680-13347702 TCCAGGCTGCTGTGGGGCAGTGG - Intronic