ID: 1084796031

View in Genome Browser
Species Human (GRCh38)
Location 11:71504621-71504643
Sequence GCACCCACGAGGAGAACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084796031_1084796037 29 Left 1084796031 11:71504621-71504643 CCTCCTGTTCTCCTCGTGGGTGC 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1084796037 11:71504673-71504695 TCCAGTCTGCCCAGTCTGACCGG 0: 1
1: 0
2: 0
3: 14
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084796031 Original CRISPR GCACCCACGAGGAGAACAGG AGG (reversed) Intronic
905939802 1:41854071-41854093 CCATCCAAGAGGACAACAGGTGG - Intronic
906991206 1:50741225-50741247 ACACCCATGTGAAGAACAGGAGG + Intronic
909482677 1:76142462-76142484 GCACCAACCAGGGGAAGAGGAGG + Intronic
911683864 1:100750261-100750283 GCACCCGGGAGGAGGAAAGGAGG + Intergenic
912507422 1:110165740-110165762 GTACCTACGAGGAGAACAAACGG + Intronic
914490230 1:148146956-148146978 ACACCCAAGAGGGGACCAGGCGG + Intronic
915907123 1:159887101-159887123 GCTCCCCTGAGGAGAACAAGGGG - Intronic
919870828 1:201820031-201820053 AGCCCCAGGAGGAGAACAGGAGG + Exonic
920295405 1:204953193-204953215 GCTCCCAGGAGGAGCAGAGGGGG + Intronic
924194418 1:241590868-241590890 CTGCCCCCGAGGAGAACAGGAGG + Intronic
924725613 1:246667843-246667865 AGACCCAAGAGGTGAACAGGAGG - Exonic
1064030760 10:11881172-11881194 GCTCCCCCGAGGTGCACAGGAGG + Intergenic
1064428840 10:15254252-15254274 GCAGCCAGGAGGGGAAGAGGTGG - Intronic
1067427645 10:46221731-46221753 GGACCCAAGAGGAGACCAGAAGG - Intergenic
1067583067 10:47457644-47457666 GGACCCAAGAGGAGACCAGAAGG - Intergenic
1070727098 10:78799896-78799918 GCACCCAGGAGGAGAGGAGGAGG - Intergenic
1072169931 10:92848923-92848945 GCAGCCAGGAGGAGAACGCGGGG - Intronic
1074176511 10:111010448-111010470 CCACCTATGAGGAGAACATGCGG - Intronic
1075238742 10:120758072-120758094 GCACCCAGGGGCAGAACAGCAGG - Intergenic
1076099633 10:127765594-127765616 TCACCAAGGAGGAGAACAGAAGG + Intergenic
1076697811 10:132255598-132255620 GCACCCAGGAGAGGAGCAGGGGG + Intronic
1077050556 11:564498-564520 ACACCCACCTGGAGAAGAGGAGG - Intergenic
1077144800 11:1040070-1040092 GTCCCCTGGAGGAGAACAGGTGG + Intergenic
1081851089 11:46275734-46275756 GCCCCCAGGAGGAGAAAAAGTGG - Intergenic
1082025040 11:47565553-47565575 GGACCCGCGAGAAGAGCAGGCGG - Intronic
1084796031 11:71504621-71504643 GCACCCACGAGGAGAACAGGAGG - Intronic
1085374023 11:76041378-76041400 GAACCCCAGAGGAGAGCAGGTGG + Intronic
1087152800 11:94873542-94873564 CCACCCACCTGGAGTACAGGGGG + Exonic
1087160420 11:94943086-94943108 GCACCCAGGAGGTGAGCAGAGGG - Intergenic
1094514411 12:31118889-31118911 GCACCCACCTGGAGGACTGGGGG + Intergenic
1098076334 12:66735989-66736011 GCACCCAGGAGAAGAAGAGAAGG + Intronic
1099303313 12:80924390-80924412 GCACCCCTGGGGAGAAGAGGTGG + Intronic
1101428315 12:104605896-104605918 GAACCCACGAGAGGACCAGGAGG - Intronic
1104374282 12:128250280-128250302 GCAGCCTCCTGGAGAACAGGTGG + Intergenic
1113010351 13:105758062-105758084 TCACCCACTTGGAGAACAGATGG + Intergenic
1118108851 14:62693824-62693846 TCACCGACGGGGTGAACAGGAGG - Intergenic
1118885381 14:69861360-69861382 GCACCCAGGAAGAAAAGAGGAGG - Intronic
1119397448 14:74337636-74337658 GTACCCACTAGGGGAACAGTTGG - Intronic
1120941297 14:89952758-89952780 CCACTCATGAGGAGAACAGCTGG + Intronic
1128113015 15:65088348-65088370 CCACCCACCAGGAGAGTAGGAGG + Intergenic
1133381777 16:5336919-5336941 GCAGCCAGGAGGAGAATAGAAGG - Intergenic
1133440365 16:5816071-5816093 GCACCCCCATGGAGAACTGGAGG - Intergenic
1135221691 16:20620268-20620290 GCTCCCAAGAGGAGAACACATGG + Intronic
1137489371 16:48918800-48918822 GCACCAATGAGGTGAACAGGAGG + Intergenic
1139359008 16:66385061-66385083 GCCCCCACTAGGAGTACAGAGGG - Intronic
1140287023 16:73613499-73613521 GCACTTACTAGGAAAACAGGTGG + Intergenic
1142139407 16:88466056-88466078 GCACCCACTGGGAGCCCAGGCGG - Intronic
1142237088 16:88927477-88927499 GGTCCCTGGAGGAGAACAGGTGG - Intronic
1143464556 17:7127301-7127323 CCACCCAGGAGGTGGACAGGTGG + Intergenic
1144639168 17:16928104-16928126 GCACCCACCACGAGGGCAGGCGG + Intergenic
1145366283 17:22269178-22269200 GCAACCCCGCGGAAAACAGGGGG - Intergenic
1145939832 17:28737558-28737580 GCACCCAGTGGGAGCACAGGAGG + Intronic
1147036264 17:37683762-37683784 GCACCCAGGAGAAGAGGAGGAGG + Intergenic
1147614544 17:41820447-41820469 GGACCCACGAGGTGAACAGCTGG - Exonic
1152563285 17:81089263-81089285 GCCCCCATGAGAAGAACAGATGG - Intronic
1154000842 18:10481184-10481206 GTACCCAGAAGGAGAATAGGTGG - Intronic
1157578214 18:48758102-48758124 GCACCCACCAGGCGACAAGGGGG + Exonic
1160334786 18:78029203-78029225 GCACCCACGAGCAGAAGACCGGG + Intergenic
1160995382 19:1879864-1879886 ACACCCAAGAGGGGACCAGGCGG - Intronic
1164771321 19:30811613-30811635 GGACCCAGCAGGAGAGCAGGAGG - Intergenic
1166293902 19:41879608-41879630 GCACCACCGCGCAGAACAGGAGG - Exonic
1166569340 19:43783976-43783998 AGACCCAAGAGGAGACCAGGAGG - Intergenic
1166761023 19:45224585-45224607 GCACCCACCGGGATAACAGAGGG - Intronic
1167376995 19:49117719-49117741 ACTCCCACGAGGAGGACATGAGG + Intronic
925118950 2:1402710-1402732 GCACCAACCAGGAGAACAGTAGG + Intronic
925297835 2:2789938-2789960 GCACCCACAGGGTGAAGAGGAGG - Intergenic
929221146 2:39466148-39466170 GCAGCCACGAGGAGGAAGGGTGG + Intergenic
931182553 2:59917333-59917355 GCCCCCAGGAGGAGAAGAAGGGG + Intergenic
931748869 2:65313789-65313811 TCAACCACGAGGAGAACCGCCGG - Exonic
932142744 2:69294110-69294132 TCACCCAAGAGGAGATCAGCTGG + Intergenic
932776244 2:74529940-74529962 GCACCCAGGACGCGAGCAGGCGG - Exonic
934620068 2:95798348-95798370 GCACCCAGGAGCAGATCCGGTGG - Intergenic
935782916 2:106523719-106523741 ACATCAACTAGGAGAACAGGAGG + Intergenic
936016117 2:108960190-108960212 GCAGCCCCGGGGAGAACTGGTGG - Intronic
937972415 2:127560782-127560804 GCACTCAGGAGGAGAACATTCGG - Intronic
938630833 2:133165340-133165362 GTACCCAGGAGGAGAAAAGCTGG - Intronic
940019440 2:149141313-149141335 GCATCCGCGTGGAGTACAGGGGG + Intronic
946421218 2:219565977-219565999 GCATCCCTGAGGAGAACAGCTGG - Intronic
947720558 2:232367182-232367204 GCACCCAAGGGGAGGCCAGGAGG - Intergenic
947871614 2:233441783-233441805 TCAGCCATGAGGAGCACAGGTGG + Intronic
947952019 2:234156325-234156347 GCAGCCCCAAGGAGAAGAGGTGG - Intergenic
948597233 2:239087849-239087871 GCAGTCACTAGGATAACAGGTGG + Intronic
1168913949 20:1471279-1471301 ACACCCACAAGTAGAACTGGAGG - Intronic
1171309868 20:24137555-24137577 GCACCCAGGAGGAATCCAGGAGG - Intergenic
1174784033 20:53416079-53416101 GCACCCACGTGAAGGGCAGGTGG + Intronic
1175269722 20:57725330-57725352 GCACCAAGCAAGAGAACAGGAGG - Intergenic
1176093441 20:63329027-63329049 GCGTCCACGGGGAGAACAGACGG + Intronic
1179279965 21:39925724-39925746 GGACCCACGAGCAGTACAGGGGG - Intronic
1181534672 22:23535156-23535178 GCACACAGGAGGAGTCCAGGCGG - Intergenic
1182011885 22:27007935-27007957 GCACCCATGAGGAGAGCTGCAGG + Intergenic
1182743583 22:32587402-32587424 CCACCCACGAGGTGTTCAGGGGG - Intronic
1183416645 22:37686454-37686476 GCTTCGACGAGGAGAAGAGGCGG + Exonic
1184492558 22:44818475-44818497 GCTGCCACGTGGAAAACAGGAGG - Intronic
1185017575 22:48353641-48353663 GCACCCACGATTGGAAGAGGAGG - Intergenic
949900037 3:8805647-8805669 ACACCCACCAGTAGAACTGGTGG + Intronic
952199022 3:31106268-31106290 GCAGCCATGAGTAGAACTGGAGG - Intergenic
960044005 3:113178948-113178970 GCAGCCAAGAGAAGCACAGGAGG + Intergenic
967953261 3:194857204-194857226 GGGCCCACAAGGAGAACGGGGGG - Intergenic
971037961 4:22715744-22715766 GAACCCAGGAAGAGAACAAGAGG - Intergenic
976546816 4:86345181-86345203 GCAGCTACGAGGGGAAGAGGGGG - Intronic
984644554 4:182205552-182205574 GCACCCATGAGGAGAAAGGCTGG - Intronic
985908175 5:2857963-2857985 GCACACAAGAGGAGCCCAGGAGG - Intergenic
986145442 5:5073116-5073138 GCATCCACCAGGAGGAAAGGGGG - Intergenic
987328337 5:16832816-16832838 GTAGCCACAAGGTGAACAGGAGG - Intronic
988815851 5:34834412-34834434 GCCCCCACGAGGCGAGTAGGAGG + Intergenic
990445004 5:55886177-55886199 GCATCCTCCAGGAAAACAGGAGG - Intronic
997659360 5:135577877-135577899 GGACCCACAAGGAGTACAGTCGG + Intronic
999261735 5:150242674-150242696 TCACCCAGGGGGAGAACAGTAGG + Intronic
1000222400 5:159226646-159226668 GCACCAAAGAGAAGCACAGGTGG - Intergenic
1002570422 5:180136668-180136690 GCGCCCACGGGGAGAGGAGGGGG + Intronic
1007718819 6:43873145-43873167 GCACCCACGAGGAAAATTTGGGG + Intergenic
1007930552 6:45687003-45687025 TCACCCACCAGGAGAACGGGAGG - Intergenic
1015294716 6:131577379-131577401 GCACCCAGGAGTAGAACTGCTGG - Intronic
1018363794 6:163098419-163098441 GCCCCCACTAGCAGAACAGAGGG + Intronic
1019172969 6:170144962-170144984 GCACCAACCATCAGAACAGGGGG - Intergenic
1023648047 7:42339998-42340020 GCACCCAAAAGTAGAATAGGAGG - Intergenic
1033356215 7:140602189-140602211 GCACCCAGCAGGAGAGCAGACGG - Exonic
1034131821 7:148725564-148725586 GCACCCACGAGATGACAAGGAGG - Intronic
1037986150 8:23291838-23291860 GCAGGCAAGAGGAGAAGAGGAGG - Intronic
1039567023 8:38559037-38559059 GCAGGCTCGAGGAGGACAGGGGG + Intergenic
1042266893 8:66917574-66917596 GCTCCCAGGAGGAGTAGAGGAGG - Intronic
1046174131 8:110552836-110552858 GCACCCACTAGCACAACAGACGG - Intergenic
1048462035 8:134629060-134629082 GGACCCACGAGGACAACAGCAGG + Intronic
1049161817 8:141102889-141102911 GCACCCACCAGGAGCACTGAAGG - Intergenic
1049548361 8:143245333-143245355 GCACCCAGAACAAGAACAGGTGG + Intergenic
1051122295 9:13764497-13764519 GAACCCAGGAGGAGGATAGGTGG - Intergenic
1055506484 9:76954753-76954775 TCACCAAAGAGGAGAACTGGGGG - Intergenic
1056559940 9:87721492-87721514 GAATCCAAGAGGAGAAGAGGAGG - Intergenic
1057081000 9:92174638-92174660 GCACCATCTGGGAGAACAGGGGG + Intergenic
1059553573 9:115254938-115254960 GCAGCCACGTGGAGGACAGCTGG + Intronic
1060281837 9:122220287-122220309 TGAGCCACGAGGAGCACAGGAGG - Intronic
1060550287 9:124481730-124481752 CCACCCACTAGGTGAACAGCAGG - Exonic
1060773324 9:126348389-126348411 GCATCCACGAGGTGTGCAGGAGG + Intronic
1197760016 X:130021332-130021354 GCACCCAGGAGGAGCAGAAGGGG - Intronic