ID: 1084796054

View in Genome Browser
Species Human (GRCh38)
Location 11:71504770-71504792
Sequence GGTTCTATTGGAACACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 20, 3: 55, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084796054_1084796065 29 Left 1084796054 11:71504770-71504792 CCTGGCTGTGTTCCAATAGAACC 0: 1
1: 0
2: 20
3: 55
4: 196
Right 1084796065 11:71504822-71504844 AGCTGGATACTGTTAATGACAGG 0: 1
1: 0
2: 0
3: 7
4: 63
1084796054_1084796059 12 Left 1084796054 11:71504770-71504792 CCTGGCTGTGTTCCAATAGAACC 0: 1
1: 0
2: 20
3: 55
4: 196
Right 1084796059 11:71504805-71504827 GCCCGAGCCTCCCTCTCAGCTGG 0: 1
1: 0
2: 0
3: 32
4: 1057
1084796054_1084796066 30 Left 1084796054 11:71504770-71504792 CCTGGCTGTGTTCCAATAGAACC 0: 1
1: 0
2: 20
3: 55
4: 196
Right 1084796066 11:71504823-71504845 GCTGGATACTGTTAATGACAGGG 0: 1
1: 0
2: 0
3: 5
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084796054 Original CRISPR GGTTCTATTGGAACACAGCC AGG (reversed) Intronic
901083415 1:6596537-6596559 AGTTTTCTTGGCACACAGCCAGG - Intronic
901491044 1:9596460-9596482 AGTTTTATTGGAACACAGCCAGG - Intronic
902539367 1:17142212-17142234 AGTTTTATGGGGACACAGCCAGG - Intergenic
903370786 1:22834595-22834617 AGTTTTATTGGCACACAGCCAGG - Intronic
911956196 1:104238169-104238191 GGTTCTAGTGTCTCACAGCCTGG + Intergenic
912167757 1:107060373-107060395 GGTGCCATTGGACCACAGGCAGG + Intergenic
915425031 1:155818786-155818808 GGGTCAATTGGAAACCAGCCTGG + Intronic
916015468 1:160745700-160745722 AATTGTACTGGAACACAGCCAGG - Intronic
916100988 1:161393016-161393038 GGGTCTTGTGGAACACAGCAAGG - Intergenic
917337328 1:173939084-173939106 AGTTTTATTGGAATATAGCCTGG + Intronic
917430061 1:174957155-174957177 AGTTTTCTTGGAACACAGCCAGG + Intronic
917434586 1:175007323-175007345 TGTTTTATTGGGACATAGCCAGG + Intronic
918466016 1:184822463-184822485 TGTTTTCTTGGCACACAGCCAGG - Intronic
920032737 1:203047197-203047219 GGGTCTGCTGGGACACAGCCAGG - Intronic
922527864 1:226319935-226319957 TGTTCCATTGCAATACAGCCTGG - Intergenic
922797539 1:228348089-228348111 TGTTGTCCTGGAACACAGCCAGG + Intronic
1064257902 10:13760112-13760134 AGTTTTATTGGAACACAATCAGG + Intronic
1064993817 10:21279190-21279212 AGTTTTATTGGAATGCAGCCAGG - Intergenic
1065133188 10:22643281-22643303 CGTTTTATTGGAACAGAGCCAGG + Intronic
1065872206 10:29965187-29965209 AGTTTTATTGGAATACAGTCAGG + Intergenic
1065947749 10:30622670-30622692 AGTCTTATTGGAACACAGCCAGG + Intronic
1065978308 10:30863796-30863818 GGTTCTGTAGGAAGACAGCAAGG - Intronic
1066694713 10:38067476-38067498 GATTCTCTTGGGAGACAGCCTGG + Intergenic
1067523296 10:47023670-47023692 GGTTCCACAGGAACACACCCAGG + Intergenic
1067525796 10:47037838-47037860 AGTTTTATTGGAATGCAGCCAGG - Intergenic
1070379769 10:75870220-75870242 AGTTTTATTGGAACACAGCTGGG + Intronic
1070440122 10:76434990-76435012 GTTTCTCATGAAACACAGCCTGG + Intronic
1071262510 10:83933599-83933621 GATTTTATTGGGACACCGCCAGG + Intergenic
1071599550 10:86951584-86951606 AGTTTTATTGGAGCACAGACAGG - Intronic
1072108938 10:92299570-92299592 GGTTCTATTGAAACACAGAAAGG - Intronic
1073073774 10:100810671-100810693 GGTTCTCTTTGAACAGTGCCTGG - Intronic
1073552708 10:104418086-104418108 AGTTTTATTGGCACACAGCCAGG + Intronic
1075576006 10:123578029-123578051 AGTTTTATTGGAACACCGCCAGG + Intergenic
1075722618 10:124596372-124596394 GGTGCTATGGGAACTCAGCGAGG - Intronic
1076673372 10:132135293-132135315 AGTTCAACTGGAACACAGTCAGG - Intronic
1079659701 11:23022259-23022281 TTTTCTTTTGTAACACAGCCTGG - Intergenic
1080464005 11:32480365-32480387 AGTTCTATTAGAACACAGTTTGG + Intergenic
1080464512 11:32484233-32484255 AGTTCTATTAGAACACAGTTTGG - Intergenic
1081585444 11:44380770-44380792 AGCTTTATTGGAACACAGCCAGG + Intergenic
1081694092 11:45097678-45097700 GGAGCTATTGGGACACATCCAGG + Intronic
1084164332 11:67367986-67368008 GGTACAACTGGAACACAGGCAGG - Intronic
1084796054 11:71504770-71504792 GGTTCTATTGGAACACAGCCAGG - Intronic
1087803257 11:102527251-102527273 AGTTTTACTGGAACACAGTCAGG - Intronic
1088058300 11:105611256-105611278 GGTTCCGTTGGAATACACCCAGG + Intronic
1088064029 11:105693828-105693850 AGTTTTATTGGAACATAGCCAGG + Intronic
1088714087 11:112533570-112533592 AGTTCATTTGGAACACAGACTGG - Intergenic
1089339975 11:117750666-117750688 GGTTCTAGTGGAACAACCCCTGG + Intronic
1092868300 12:12783675-12783697 GGTACCACTGCAACACAGCCTGG - Intronic
1093765029 12:22952879-22952901 GGTGCTATAGCAACCCAGCCAGG - Intergenic
1098032677 12:66270781-66270803 GGTGCCATTGGAACACAGGGAGG + Intergenic
1099355527 12:81630136-81630158 GTCTCCAGTGGAACACAGCCTGG + Intronic
1100103868 12:91144383-91144405 GTTTCTATTGGAAGACATTCAGG - Exonic
1100506621 12:95227202-95227224 TGTTCTATTGGAGGCCAGCCTGG - Intronic
1102620127 12:114187962-114187984 AGTTTAATTGGAACACAGCTGGG - Intergenic
1102788449 12:115623446-115623468 AGTTTTATTGGAACACAGCCTGG + Intergenic
1106141888 13:27018771-27018793 AGTTTTCCTGGAACACAGCCAGG + Intergenic
1106414093 13:29531480-29531502 GGTACCACTCGAACACAGCCAGG + Intronic
1107106769 13:36651805-36651827 AGTTTTATTGGAACAAAGCCAGG + Intergenic
1109683593 13:65784385-65784407 GGTGCTGTTGCAACCCAGCCAGG - Intergenic
1110307136 13:74001446-74001468 GGTGTTGTTGGAACACAGCTAGG + Intronic
1111420169 13:88000645-88000667 GGTTCACGTGCAACACAGCCTGG + Intergenic
1114703744 14:24705398-24705420 GGTTCTCTTGGAACACTTGCAGG + Intergenic
1114908087 14:27155305-27155327 GTTTCTATTGGTCCACACCCTGG + Intergenic
1115378883 14:32710893-32710915 AGTTTTGTTGGAACACTGCCAGG + Intronic
1115484942 14:33901509-33901531 GGTGCTGTTGCAACCCAGCCAGG + Intergenic
1118542177 14:66840592-66840614 AGTTTTATTAGAGCACAGCCAGG - Intronic
1119159673 14:72442455-72442477 GGTGCTATGGGGACACAGACAGG - Intronic
1121435414 14:93915974-93915996 AGTTTTATTGGAACACAGCCAGG - Intergenic
1121517800 14:94564613-94564635 AGTTTTATTGGCACACAGCCAGG + Intronic
1123126978 14:105953836-105953858 GGCTGTAGTGGAGCACAGCCAGG + Intergenic
1123407442 15:20029656-20029678 GGCTGTAGTGGAGCACAGCCAGG + Intergenic
1123516769 15:21036312-21036334 GGCTGTAGTGGAGCACAGCCAGG + Intergenic
1126858724 15:52863471-52863493 AGCTTTATTGGAACACAGCTAGG - Intergenic
1126913432 15:53438717-53438739 GGTACTGTTGGAAGCCAGCCTGG - Intergenic
1127384387 15:58455335-58455357 AGGTTTATTGGAACACAGCCAGG - Intronic
1128090058 15:64913123-64913145 GTTTGTATTGGCAAACAGCCAGG - Intronic
1128324393 15:66714468-66714490 GTTTTACTTGGAACACAGCCAGG + Intronic
1133155762 16:3874482-3874504 AGTTTTACTGGAACACAGCCAGG + Intronic
1133743651 16:8670948-8670970 AATTTTATGGGAACACAGCCAGG - Intergenic
1133974766 16:10592773-10592795 AGTTTTATTGGAACACAGCCAGG - Intergenic
1134232909 16:12442886-12442908 AGTTTTTTTTGAACACAGCCAGG - Intronic
1135062422 16:19282320-19282342 AGTTTTATTGGCACACTGCCTGG + Intergenic
1135151148 16:20007131-20007153 AGTTTTATTGGAACACAGCCAGG + Intergenic
1135600645 16:23780507-23780529 AGTTTTATTGGAACACAGCCAGG - Intergenic
1135742330 16:24986552-24986574 AGTTTCACTGGAACACAGCCAGG + Intronic
1135754097 16:25082071-25082093 AGTTTTATTGGAACACAGCCAGG - Intergenic
1136526954 16:30837397-30837419 GGCTCTATTGCACTACAGCCTGG - Intronic
1138401701 16:56750661-56750683 AGTTTTATTGGAACACAGCCAGG + Intronic
1138918821 16:61501859-61501881 GGTCTTATTTGAACTCAGCCTGG + Intergenic
1140880159 16:79190737-79190759 AGTTTTATTGGAACACAGCCAGG + Intronic
1141179272 16:81741350-81741372 GCTTCTATTTGAACCCAGTCTGG + Intronic
1141292608 16:82734190-82734212 AGTTCCATTGGATCTCAGCCAGG + Intronic
1142770477 17:2093148-2093170 CGTTCTATTGCAATCCAGCCTGG + Intronic
1142897008 17:2987110-2987132 AGTTTTATTGGAACGCAGACAGG - Intronic
1142975469 17:3641135-3641157 GGGTCAGTTGGAACACAGGCTGG + Intronic
1143286017 17:5789871-5789893 AGTTCTATGGGAACCCAGCGGGG - Intronic
1143379280 17:6485861-6485883 AGTTTTATTGGAACACACTCAGG + Intronic
1143971163 17:10797004-10797026 TGTTTTATTGGAACACAGACTGG - Intergenic
1144308113 17:13987572-13987594 GATTTTCTTGGAACACAGCCAGG - Intergenic
1144759219 17:17698023-17698045 AGTTCTACTGGAAGACAGTCAGG - Intronic
1148355367 17:46972149-46972171 GGTTCTGTCAGCACACAGCCTGG - Intronic
1148481072 17:47959705-47959727 GGTTCTATGGGAACACAGAAGGG - Intergenic
1148586998 17:48788032-48788054 GGTTTTCTTGGGACAAAGCCTGG + Intronic
1151485025 17:74393695-74393717 GGTTCCCTTGGGACACAGTCAGG + Intergenic
1152113602 17:78371205-78371227 GGTTTTATTGAATCACAGCCAGG + Intergenic
1152673195 17:81621671-81621693 AGTGTTATTGGAACACAGCCAGG - Intronic
1155912577 18:31521536-31521558 AGTTTTATTGGACCACAGCTAGG - Intronic
1158361948 18:56684456-56684478 AGTTTTATCGCAACACAGCCAGG - Intronic
1159525382 18:69582199-69582221 AGTTATATCAGAACACAGCCAGG - Intronic
1160102247 18:75933929-75933951 GCCTCTACTGGAACAAAGCCAGG + Intergenic
1160663130 19:310604-310626 GGAGCTATAGAAACACAGCCCGG + Intronic
1161585980 19:5105867-5105889 AGTTTTATTGGCACATAGCCAGG - Intronic
1162363515 19:10233590-10233612 GGTGCTATTGGACTTCAGCCTGG + Intergenic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1168352065 19:55681532-55681554 AGTTTTATTGGAACACAGCCAGG + Intronic
925043426 2:751845-751867 TGTTCTATTTGGACCCAGCCTGG + Intergenic
925060734 2:888134-888156 GTTTCTCTTGGATCACAGACAGG - Intergenic
930912344 2:56644232-56644254 GGTTCTGTTGCAACATAGACGGG + Intergenic
932858962 2:75268292-75268314 AGTTTTGTTGGAACACAGCCAGG + Intergenic
933239394 2:79903054-79903076 AGTTTTATTAGAACACAGTCAGG - Intronic
933612209 2:84448283-84448305 AGTTTTATTGGAACGCACCCAGG + Intronic
935552120 2:104468597-104468619 GGTTTTATTGCCACACACCCAGG - Intergenic
935831266 2:107002976-107002998 AGTTACATTGGAGCACAGCCAGG - Intergenic
936508470 2:113127009-113127031 AGTTGTAGTGGAACACAGCTAGG + Intronic
936715578 2:115183389-115183411 GGTTCTATTGGATGACCGCTGGG - Intronic
937301678 2:120846549-120846571 GGGGCTGTTGGAAAACAGCCCGG - Intronic
938531537 2:132192511-132192533 GGTTCCAATAGAACTCAGCCTGG - Intronic
940124076 2:150304263-150304285 AGCTTTATTGGAACATAGCCAGG - Intergenic
941212993 2:162666523-162666545 GGTTTTATTTGAACATAGCAGGG - Intronic
943928548 2:193819925-193819947 GGTGCTGTTGCAACACAACCAGG - Intergenic
945044035 2:205766250-205766272 GGCTCTGATGGGACACAGCCAGG - Intronic
945721232 2:213421268-213421290 GGTGCTGTTGCAACCCAGCCAGG + Intronic
945855804 2:215068423-215068445 AGTTTTATTGGAATACAACCAGG - Intronic
946041820 2:216789284-216789306 AGTTTTCTTGGATCACAGCCCGG - Intergenic
1168765189 20:377460-377482 ATTTCTATTGGAACACAGAATGG + Intronic
1170346763 20:15395601-15395623 AGTTTTATTGGAACACAGCCAGG - Intronic
1172030995 20:31981997-31982019 AGTGCTATTGGAGGACAGCCAGG - Intronic
1173408357 20:42786999-42787021 AGTTTTGTTGGAACACAGCTGGG + Intronic
1174284979 20:49466097-49466119 GGTTTTAATGGAACACAGGCAGG - Intronic
1174785173 20:53425718-53425740 AGTTTTATTGGAACATGGCCTGG - Intronic
1174889979 20:54381415-54381437 AGTTTTATTGAAAGACAGCCAGG + Intergenic
1175815706 20:61882210-61882232 GGCTTTATTGGCACACAGCGTGG + Intronic
1178577214 21:33805543-33805565 AGTTTTATTGGAACACAGCCAGG + Intronic
1179170044 21:38965933-38965955 GGTTTCATTGGCACTCAGCCAGG + Intergenic
1179340586 21:40504685-40504707 GGTTCCATTGGAACACAGGATGG - Intronic
1182656350 22:31893279-31893301 AGTTTTATTGGAATACAGCCAGG + Intronic
1182802797 22:33045274-33045296 AGTTCACCTGGAACACAGCCAGG - Intronic
1183701880 22:39455715-39455737 AGTTTTATTGGAACACCGCCAGG + Intergenic
1184601510 22:45546512-45546534 AGTTTTATTAGAACACAGCCCGG - Intronic
949867212 3:8555911-8555933 AGTTTGATTGGAACACAGCCAGG - Intronic
950087051 3:10266685-10266707 GGTTTCATTGGAATACAGTCAGG - Intronic
950336742 3:12200752-12200774 GGTTCCATTTAAAGACAGCCTGG - Intergenic
951611128 3:24494355-24494377 GCTGCGATTGGAACAGAGCCCGG + Intronic
951734154 3:25844916-25844938 AGTTTTATTGGAACACAACTAGG + Intergenic
952289454 3:32001236-32001258 AGTTCTCTTGGGACACATCCAGG - Intronic
953648772 3:44780151-44780173 GATTCTAGTGCACCACAGCCTGG + Intronic
955310583 3:57882634-57882656 AGTTTTATGAGAACACAGCCAGG - Intronic
955743552 3:62118304-62118326 AGTTTTATTGGAACACAGTCAGG - Intronic
956693886 3:71902355-71902377 AGTTCTATAGAAACACAGCGAGG + Intergenic
957307647 3:78478872-78478894 TGTTTTCTTGGAACACAGGCTGG - Intergenic
958029077 3:88085347-88085369 GGTTTTATTGGAACACAACCAGG - Intronic
959442311 3:106392411-106392433 GGAGCTATTGGGACACATCCTGG + Intergenic
961352659 3:126313943-126313965 AGTTTTATTGGCACACAGCCAGG + Intergenic
962077040 3:132093183-132093205 AGTTTTATTGGAACACAGCCAGG - Intronic
963775882 3:149439103-149439125 AGTATTATTGGAACACAGTCAGG + Intergenic
965080440 3:164025172-164025194 TATTTTATTGTAACACAGCCTGG - Intergenic
966317259 3:178661562-178661584 AGTTTTACTGGAACACAGCCAGG - Intronic
967198095 3:187046879-187046901 AGTTTTGTTGGAACATAGCCAGG - Intronic
967395730 3:189006811-189006833 AGTTTTATTGGAATACAGCCAGG + Intronic
967412155 3:189177886-189177908 GGTTCTATTCGAACCCAGAAGGG + Intronic
971021346 4:22539359-22539381 AGTTTCATCGGAACACAGCCAGG - Intergenic
971669870 4:29542900-29542922 GGTGCTGTTGCAACCCAGCCGGG - Intergenic
972616157 4:40700338-40700360 GTTCTTATTGGAACACAGACAGG - Intergenic
974715636 4:65667580-65667602 GAATCTTGTGGAACACAGCCTGG - Intronic
975620640 4:76292848-76292870 GGTTTGAATGGAACAAAGCCAGG - Intronic
976160377 4:82192314-82192336 GGTACAACTGGAACACTGCCGGG + Intergenic
976381060 4:84399546-84399568 GGTTCTCTAGGAACACAGCATGG - Intergenic
976944177 4:90744127-90744149 GGTTGTATTTGCACACGGCCTGG + Intronic
978149430 4:105415442-105415464 GGTGCTGTTGCAACGCAGCCAGG - Intronic
980351503 4:131690964-131690986 GGTTCCAGTGAAGCACAGCCAGG + Intergenic
982878836 4:160685647-160685669 GCCTGTAGTGGAACACAGCCTGG + Intergenic
986475318 5:8124356-8124378 GGGTATATCAGAACACAGCCCGG - Intergenic
987788975 5:22538937-22538959 TGTGCCAGTGGAACACAGCCTGG - Intronic
987990990 5:25212527-25212549 GTTTGTAGTGGAACACAGCCAGG + Intergenic
988739332 5:34054515-34054537 AGTTTTGTTGGAACACAGCCCGG - Intronic
989367784 5:40675870-40675892 GGTTTTATAGGGACCCAGCCTGG + Intergenic
989728768 5:44622608-44622630 GGCTCTAGCTGAACACAGCCAGG - Intergenic
989757240 5:44970133-44970155 GGTTGCCTTGGAACACAGCAGGG + Intergenic
990425247 5:55681862-55681884 ATTTTTACTGGAACACAGCCAGG + Intronic
991243903 5:64489114-64489136 GGCTGCAGTGGAACACAGCCAGG + Intergenic
993654279 5:90558704-90558726 GGTCCTATTGGAGCAGAGCGAGG + Intronic
995725204 5:115174555-115174577 GTTTCTATGGGAACAAAGTCAGG + Intronic
996633759 5:125666548-125666570 TTTTTTATTGCAACACAGCCTGG - Intergenic
996636421 5:125694774-125694796 GGTTCTATTGAAACAAAGCAAGG - Intergenic
997386945 5:133481017-133481039 GGTTCCAGTGGAACCCAGGCTGG + Intronic
997597877 5:135119202-135119224 GGTGCTAATGCAACACAGCCCGG - Intronic
998486254 5:142505079-142505101 TGTTCTATTGAAACACACCCAGG - Intergenic
998817719 5:146030846-146030868 AGTTTTATTGGTACTCAGCCAGG + Intronic
999573111 5:152943119-152943141 GATTCTCTTGTAGCACAGCCTGG + Intergenic
999633618 5:153597419-153597441 GGTTCTATAGGCAGACTGCCAGG + Intronic
1000045048 5:157515577-157515599 AATTTTACTGGAACACAGCCAGG - Intronic
1001217477 5:169869247-169869269 GTTTCTATGGAAACACAGCAGGG + Intronic
1004057203 6:12151795-12151817 AGTTTTATTGGAACACAGCCAGG - Intronic
1004620455 6:17326436-17326458 TCTTTTATTGTAACACAGCCTGG - Intergenic
1004895505 6:20143949-20143971 AGTTATATTGGAACGCAACCAGG - Intronic
1005080361 6:21951053-21951075 AGTTTTGTTGGAACACAGCCAGG + Intergenic
1005151412 6:22755965-22755987 AGTTTTATTGGAACACAGCCAGG + Intergenic
1006880921 6:37339046-37339068 AGTTTTACTGGAACACAGCCTGG + Intergenic
1009781097 6:68271907-68271929 GGTGCCATTGGACTACAGCCTGG - Intergenic
1011149746 6:84257867-84257889 GGTTCTGTTGGAGCAGAGGCAGG + Intergenic
1013393847 6:109714027-109714049 GTTTGTAGTGGAGCACAGCCAGG - Intronic
1014180812 6:118382317-118382339 AGTTTTATTGGAACACAGCCAGG - Intergenic
1015343442 6:132128613-132128635 AGTTTTATTGGAATTCAGCCAGG + Intergenic
1015561078 6:134516692-134516714 AGTTTTATTGAAACACTGCCAGG - Intergenic
1021090268 7:16474625-16474647 GGTTATATTAGAACACAAGCAGG + Intronic
1021504540 7:21367287-21367309 AGTTTTATTGGAACACAGCCAGG - Intergenic
1022897322 7:34764434-34764456 AGTTTTATTGGATTACAGCCAGG + Intronic
1023055957 7:36290299-36290321 GGTACTATTGACCCACAGCCTGG + Intronic
1023630703 7:42161292-42161314 TGTTTTGTTGGAACACAGCCAGG + Intronic
1023684423 7:42719838-42719860 GAATCTATTTTAACACAGCCTGG - Intergenic
1029960416 7:104684464-104684486 AGTTTTATTGGAACACAGCTAGG - Intronic
1032115152 7:129110723-129110745 GGCTGTATTGGAACAGAGCCTGG - Intergenic
1033353028 7:140577823-140577845 AGTTCTATGGAAACACAGCCAGG - Intronic
1035113379 7:156503752-156503774 GGTGCTATTGGAACATAGCCAGG - Intergenic
1035997063 8:4559984-4560006 GTTTCTCTTGAAGCACAGCCAGG - Intronic
1036163277 8:6407940-6407962 AGTTTTATTGGAACACAGGCCGG + Intronic
1038105334 8:24427520-24427542 AGTTTTATTGGAACATAGCCAGG - Intergenic
1038617185 8:29105506-29105528 GATGCTATTAGAACCCAGCCAGG - Intronic
1039088808 8:33806314-33806336 GGTGGTATTGGAAGACAGACTGG + Intergenic
1039444108 8:37616987-37617009 AGTTTTATTGGAATGCAGCCAGG - Intergenic
1041033148 8:53758794-53758816 TGTTTTACTGGAACACAGCCAGG + Intronic
1042486268 8:69349501-69349523 AGTTTTTCTGGAACACAGCCAGG + Intergenic
1043195460 8:77287199-77287221 GGTGCTGTTGCAACACAGCCAGG + Intergenic
1045356438 8:101393313-101393335 AGTTGAACTGGAACACAGCCGGG - Intergenic
1046375111 8:113368222-113368244 GGTTCTTTGGTAACACAGCTGGG - Intronic
1046721700 8:117627412-117627434 AGTTTTATTGGAACACAACCAGG - Intergenic
1047109841 8:121777180-121777202 GGTGCTATTGCACCCCAGCCTGG + Intergenic
1047414025 8:124649156-124649178 AGTTTTATTGAAAGACAGCCAGG + Intronic
1048380230 8:133859253-133859275 GGTTTCATTGGGACACAGCTGGG - Intergenic
1049517052 8:143065538-143065560 TATTCTATTGCAACACAGCTTGG - Intergenic
1049956657 9:699174-699196 CGTTATGTTGGAACACAGCAGGG - Intronic
1050923428 9:11234326-11234348 TTTTTTATTGCAACACAGCCTGG - Intergenic
1051172845 9:14336949-14336971 AGTTTTATGGAAACACAGCCAGG - Intronic
1053781211 9:41608748-41608770 GGTTCCAGTGAAGCACAGCCAGG - Intergenic
1054169157 9:61818901-61818923 GGTTCCAGTGAAGCACAGCCAGG - Intergenic
1054668375 9:67761915-67761937 GGTTCCAGTGAAGCACAGCCAGG + Intergenic
1056094236 9:83234603-83234625 GGCTCTATTGGAACTGAGCCTGG + Intergenic
1056425386 9:86470457-86470479 GGTTCTGTTGGGAAACAGCTGGG - Intergenic
1057433761 9:95020466-95020488 GATTCTATAGTAACACAGCTGGG + Intronic
1057979825 9:99649938-99649960 GTCTGTAGTGGAACACAGCCAGG + Intergenic
1058823172 9:108751595-108751617 AGTTTTATTGGGACACAGCCAGG - Intergenic
1060742707 9:126110142-126110164 GGGACTATGAGAACACAGCCAGG + Intergenic
1061072694 9:128321315-128321337 AGTTCTATTGGAATACAGCTAGG + Intronic
1185508613 X:646303-646325 GGTTTTCTGGGAACACAGCAAGG + Exonic
1186127532 X:6430280-6430302 AGTTTTACTGGAACACAGCCAGG - Intergenic
1186498281 X:10030066-10030088 AGTTTTATTGGAACACAGCCAGG - Intronic
1186546411 X:10454495-10454517 AGTTTTATGGGAATACAGCCAGG - Intronic
1187540173 X:20185414-20185436 GGTTCTACTGCACCCCAGCCTGG - Intronic
1187725338 X:22196473-22196495 AGTTTTACTGGAACACAGCCAGG - Intronic
1187751641 X:22472359-22472381 TGTTTTACTGGAACACAGTCAGG + Intergenic
1189206629 X:39245361-39245383 AGTTTCATTGGAACATAGCCAGG - Intergenic
1190076395 X:47320374-47320396 GGTGCTATTGGAGCAAAGACAGG - Intergenic
1192416973 X:70989612-70989634 GGTGCTATGGGAACACAGTATGG - Intergenic
1194110859 X:89832852-89832874 GGCTTTGTTAGAACACAGCCAGG - Intergenic
1194316452 X:92383087-92383109 AGTTTTATTGGAACACAGGCAGG + Intronic
1194710854 X:97234632-97234654 AGTTTTATTGAAAAACAGCCAGG - Intronic
1197076895 X:122363885-122363907 GTTTGTAGTGGAGCACAGCCAGG - Intergenic
1200463521 Y:3487589-3487611 GGCTTTGTTAGAACACAGCCAGG - Intergenic
1200624627 Y:5496406-5496428 AGTTTTATTGGAACACAGGCAGG + Intronic
1201609755 Y:15827776-15827798 AGTTTTATTGGGACACAGCCAGG - Intergenic
1201632197 Y:16081125-16081147 ATTTTTATTGCAACACAGCCTGG + Intergenic
1201902246 Y:19055566-19055588 AGTTTAATTGGAAAACAGCCAGG + Intergenic