ID: 1084796392

View in Genome Browser
Species Human (GRCh38)
Location 11:71507625-71507647
Sequence AAGGGCTTGGTAAAAACTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084796392 Original CRISPR AAGGGCTTGGTAAAAACTTA AGG Intronic
900247861 1:1647199-1647221 AAAGGCTTGGAAACAACTTGTGG - Intronic
900259087 1:1714353-1714375 AAAGGCTTGGAAACAACTTGTGG - Intronic
901333939 1:8432267-8432289 AAGGCATTGGTAAAAACCCAGGG - Intronic
902767158 1:18624997-18625019 ATGGACTTGGTAGAAGCTTATGG - Intergenic
905985057 1:42272802-42272824 AAGAGCTTGGTCCAAATTTAAGG - Intronic
907943932 1:59115538-59115560 AAGGGCATGATAAATACATAAGG + Intergenic
908280194 1:62525392-62525414 AAGGGCATGCTAAGAACTTCTGG + Intronic
909021443 1:70435697-70435719 AAGGGCCTGGTACCAAGTTAGGG - Intronic
915125269 1:153659234-153659256 CAGGGGTTGGCAAAAACCTAAGG - Intronic
916317632 1:163467993-163468015 AAAGGCTTGGTAACATGTTATGG + Intergenic
918474440 1:184908162-184908184 CAGGACTTGGGAAGAACTTAGGG - Intronic
919413392 1:197275408-197275430 AAGTGCTTGGTAAATATTTGTGG + Intronic
919718960 1:200811172-200811194 GAGGGCTTGGTAAACACCTTGGG - Intronic
921690177 1:218139678-218139700 AAGGGCCTGGCAGAAAGTTACGG - Intergenic
923026177 1:230205980-230206002 AAGGGCTTGGCCTAAACTCAGGG + Intronic
923903658 1:238357875-238357897 AATGGCTAGGTTAACACTTATGG + Intergenic
1062914211 10:1235050-1235072 AATGGCTTGGTAAAAGATCATGG - Intronic
1063870962 10:10417329-10417351 AAGGCCTTGGAAAAAACATTCGG + Intergenic
1064277433 10:13919220-13919242 ACTGGCTTGTTTAAAACTTATGG - Intronic
1066216110 10:33289296-33289318 AAGGGCATGCCAAATACTTAGGG + Intronic
1067208708 10:44241189-44241211 AGGGGCTTGGTAAATGCTTATGG - Intergenic
1071049273 10:81427185-81427207 AGGGGCTTGGTAAAAACATCAGG - Intergenic
1071120820 10:82276388-82276410 AAGTGATTTGTAAAAACTGAAGG + Intronic
1071122819 10:82299134-82299156 AAAGACCTGGCAAAAACTTAGGG + Intronic
1074803224 10:117023459-117023481 AAGTACTTTGTAAAAAGTTATGG + Intronic
1078508942 11:11971372-11971394 AAGGGCTTTACAAAAGCTTATGG - Intronic
1081078546 11:38708894-38708916 AAGGGCTTGGAAAAACCGTTGGG - Intergenic
1082882778 11:58054609-58054631 AAGTGCTTAGTAAATACTTGTGG + Intronic
1084796392 11:71507625-71507647 AAGGGCTTGGTAAAAACTTAAGG + Intronic
1087590920 11:100186576-100186598 CAGGGCTAGATAGAAACTTATGG + Intronic
1091594783 12:1870138-1870160 AGGGGCTTGGTAAACACCTCAGG - Intronic
1093324351 12:17756030-17756052 AAGGGGTTGGGAAAAGGTTAGGG + Intergenic
1093733619 12:22593828-22593850 GAGAGCTTGGTAAAAACATAAGG - Intergenic
1094281096 12:28739630-28739652 AAGGCCTTGGCAAAAAAATAGGG - Intergenic
1096768653 12:53916869-53916891 AGGAGCTTGGAAAATACTTACGG - Intergenic
1098608195 12:72420597-72420619 AAGGTCTTGGAAAAAGCTAAGGG + Intronic
1100250209 12:92813195-92813217 AAGTCCTTGGCAAAAACATATGG + Intronic
1100448192 12:94680556-94680578 AAGGGTTTAGTAGAGACTTAGGG - Intergenic
1100559744 12:95736240-95736262 AAGGGCCTTATAAAAACTTCAGG - Intronic
1102356081 12:112237122-112237144 AAGAGATTGGTGAAAACTTAAGG + Intronic
1103880583 12:124163067-124163089 AAGGGCCTGATAAATACATATGG - Intronic
1106354189 13:28964001-28964023 AAGGGCCTGGGGAAGACTTATGG - Intronic
1108133787 13:47333218-47333240 CAGGACTTGGTAAATATTTATGG - Intergenic
1108258743 13:48636080-48636102 AAAGCCTTGATAAGAACTTAGGG + Intergenic
1108934282 13:55866781-55866803 AAGGGATTGGTAAAAATGTTGGG + Intergenic
1110354749 13:74554654-74554676 TAGGGCTCAGTAAACACTTAAGG + Intergenic
1110794049 13:79617208-79617230 AGAGGCTCAGTAAAAACTTATGG + Intergenic
1111359812 13:87161466-87161488 GAGGAATGGGTAAAAACTTACGG + Intergenic
1116810643 14:49536747-49536769 AAGGGATGGGTAAAAACAAATGG - Intergenic
1121636296 14:95455925-95455947 AATGGCTTGAAAAAGACTTATGG - Intronic
1122918561 14:104870110-104870132 AAGGGCCTGGTAAAGATTTTAGG + Intronic
1127235853 15:57051199-57051221 AAAGGCTTGGTAAATAATTTGGG - Intronic
1127370415 15:58333641-58333663 AAGGGTTTTGTAAAGACTCATGG - Intronic
1131340315 15:91593343-91593365 AAATGCTTGTTAAAATCTTAGGG + Intergenic
1132954984 16:2586885-2586907 AAACCCTTGGTAAGAACTTATGG + Exonic
1133768069 16:8851493-8851515 AAGGGTTTGGCAAAAGCTGAAGG - Intergenic
1137638912 16:50011313-50011335 AAGGGCTTGGTAAACAGTGCTGG + Intergenic
1138154175 16:54687116-54687138 AAGGCCTTGGTGAAAGCTTCAGG - Intergenic
1140553324 16:75891809-75891831 AAGGGCTTGCAAACATCTTATGG - Intergenic
1140835806 16:78792532-78792554 AAGGGGTTCGTAAAAACTTAGGG + Intronic
1144636205 17:16910857-16910879 AAGGCCTTGGTGACAATTTATGG - Intergenic
1148259586 17:46168895-46168917 AATGACTTGGAAAAACCTTAAGG - Intronic
1149391593 17:56196835-56196857 AAGGACTTGGGAAGAAGTTATGG + Intronic
1150184580 17:63166833-63166855 AAGGGTTTGGTTGAAACATAGGG + Intronic
1151075399 17:71266447-71266469 AAAGGCATAGTGAAAACTTAGGG + Intergenic
1151243220 17:72774378-72774400 AAGGGTTTGGTGACAACTTTGGG + Intronic
1153335906 18:3924612-3924634 AAGGGCTGGGTAGCACCTTATGG - Intronic
1155090364 18:22503368-22503390 AGGAGCTTGATAGAAACTTAAGG - Intergenic
1158191802 18:54837741-54837763 AAGGACTTGGGGAAAATTTAAGG + Intronic
1161198183 19:2998917-2998939 AAGGGCCTGGTAAACATTTTAGG + Intronic
1161609580 19:5234130-5234152 AAGGGCTTCATAATAATTTACGG + Intronic
1164837268 19:31364944-31364966 AAGTGCTTTGTAAAGACTAAGGG + Intergenic
1165491354 19:36125177-36125199 GAGGGCTTTGTAAAAACCTAAGG - Intronic
1166046546 19:40233790-40233812 AAAGGCTAAGTAAAAAGTTAGGG + Exonic
926445064 2:12931508-12931530 AAGTGCTTAGTAACAACTTCTGG - Intergenic
926965437 2:18404818-18404840 AAGGGGTTGGGGAAAACATACGG + Intergenic
928784252 2:34863078-34863100 AAGGGATTAGTAATAACTTAGGG - Intergenic
928936124 2:36680030-36680052 AAGGGCTTGGTAAACATCTCAGG - Intergenic
929131583 2:38579697-38579719 AAGGGCTTTGAAAAAAGTGAGGG + Intronic
931584845 2:63814168-63814190 AAGGGGTTGGGAATAACTTTTGG - Intronic
933153932 2:78949904-78949926 AAGGGCATGAAAAAAACTTGTGG + Intergenic
940869226 2:158846229-158846251 AAGGGCTTTCCAAAAACTAAAGG - Intronic
941854699 2:170219189-170219211 AAGGACGTGGTGGAAACTTAGGG - Intronic
941871939 2:170395021-170395043 AAGGGTTTGAGAAAAACTAAAGG - Intronic
943141204 2:183984202-183984224 AAGGGCTAGGATAAAACTTGTGG - Intergenic
943510555 2:188820987-188821009 AATAACTTGGTAAATACTTAGGG + Intergenic
944706823 2:202298215-202298237 AATGGCATGGAAAAAAATTAGGG - Intronic
946942897 2:224788237-224788259 AAGGGCTGGGAAAAAAAATAAGG - Intronic
1169977447 20:11346002-11346024 TAGTGCTTGGTAAACACTGAAGG + Intergenic
1170711862 20:18798379-18798401 AAGGGCTTGATAAAGGCTGATGG + Intergenic
1170717119 20:18841289-18841311 AAGGGGTTTGTAAACACATAAGG + Intergenic
1177196299 21:17907019-17907041 AAGTGCTTGGTAAAATGTAAGGG - Intronic
1177613904 21:23491137-23491159 AAGGACTTTGTAGAAACTTTGGG + Intergenic
951089938 3:18560664-18560686 AAGGGCTTGGAAAGAAGTTAAGG + Intergenic
951410809 3:22363648-22363670 AATGGCTGTTTAAAAACTTATGG + Intronic
951494189 3:23308022-23308044 GGGGAGTTGGTAAAAACTTAAGG - Intronic
952430075 3:33214564-33214586 AGGGGCCTGGTAATATCTTAAGG - Intronic
955913011 3:63877692-63877714 ACGGGGTTGATAAGAACTTATGG - Intronic
956925170 3:73979301-73979323 ATGGGCTTAATACAAACTTAAGG - Intergenic
957162823 3:76632256-76632278 AAGTGCTCAGTGAAAACTTATGG - Intronic
958477132 3:94599098-94599120 AAGGGCTTGAGAAAACCTTTAGG - Intergenic
959689138 3:109179681-109179703 AATGGCTTGGTAAAAACTCAAGG - Intergenic
960725979 3:120670491-120670513 AAGGGCTTGTGAGAAACTGAAGG + Exonic
961043918 3:123695923-123695945 AAGGGCTAGGAAAAGACTTGGGG + Intronic
961963059 3:130872255-130872277 AAGGGCTAGGGAAAAAATGAGGG - Intronic
970313254 4:14804764-14804786 AAGGGATTGGTTATAACTGAGGG - Intergenic
970377437 4:15473525-15473547 TAGGCCTTGGAAAAAACTTTGGG + Intronic
972595411 4:40525722-40525744 CAAGGCTTGGTAAAAACCTAGGG + Intronic
973841844 4:54870190-54870212 AAGGGCTTGGCAAAAATCTCAGG - Intergenic
974930398 4:68354720-68354742 CAGGGCTTACTACAAACTTATGG + Intergenic
975436212 4:74355062-74355084 AAGAGATTGGTAAAGATTTAAGG + Intergenic
976708523 4:88043586-88043608 AAGGGAGGGGTAAAAACTGAAGG + Intronic
978137325 4:105278371-105278393 AAGGACTTGGAAAAAAATGATGG - Exonic
978202342 4:106036783-106036805 AATAGCTTTTTAAAAACTTAGGG + Intergenic
980085091 4:128382618-128382640 AAGGGATTGGTGCAAAGTTAGGG + Intergenic
981487179 4:145299718-145299740 AAGAGCTTGGCAAAAGCTTGTGG - Intergenic
983878667 4:172907159-172907181 AAAGGTTTGGAAAAAACTAATGG - Intronic
984597288 4:181684260-181684282 AAATGATTGGTAAAAAATTAGGG - Intergenic
985833065 5:2250156-2250178 AAGGGTTTGTTAAATATTTAAGG - Intergenic
987007655 5:13726739-13726761 GAGGGAGTGTTAAAAACTTATGG - Intronic
987594503 5:19979464-19979486 AATGGCAAGGTAAAAACATATGG + Intronic
988122095 5:26977862-26977884 ATGTGCTTGGTAAACACTTTGGG + Intronic
989260266 5:39411761-39411783 AAGGGCTTGGTCATTACTTTTGG - Intronic
989975258 5:50578262-50578284 AAGTGTTTGTTAAAGACTTATGG + Intergenic
990431138 5:55736882-55736904 AAGGGCTGGGGAAATACTGAGGG + Intronic
994133048 5:96252946-96252968 ACGGACTTGGTAAACACATATGG + Intergenic
994207437 5:97050903-97050925 AAGGGATTGGATGAAACTTAGGG + Intergenic
994382602 5:99088933-99088955 AAGGGCTTGTTAACAGCTTTGGG - Intergenic
994746886 5:103689276-103689298 AAGGCATTTGTTAAAACTTAAGG + Intergenic
997285905 5:132678290-132678312 AAGGGCTTAGGAAATGCTTATGG + Intronic
998870031 5:146542837-146542859 AAACGCTTGGTACAACCTTATGG + Intergenic
999047426 5:148484123-148484145 ATGTGCTTGCAAAAAACTTAAGG - Intronic
999944869 5:156584177-156584199 AAGAGCTTGGTATATACTTAAGG - Intronic
1003914675 6:10775616-10775638 AAGGGCTTGGTATCATGTTAGGG - Intronic
1004791946 6:19036194-19036216 AAGGGCTTGGAAACAGCTAACGG + Intergenic
1005326467 6:24706609-24706631 AAGGAATAGGTAAAAATTTAAGG + Intronic
1005748156 6:28858644-28858666 AAGTGCTTGCTAAAGATTTAGGG - Intergenic
1007172527 6:39873747-39873769 AAGGAGTTGATAAAACCTTAAGG - Intronic
1007196956 6:40070542-40070564 AAGGTCTTGAGAAAAACTTGAGG - Intergenic
1007677552 6:43609650-43609672 AAGGTGTTGGTAGAAACTTCTGG + Intronic
1012044024 6:94246199-94246221 AAGGGATTGGGAATAACTAATGG - Intergenic
1013028762 6:106309105-106309127 AGGAGCTTGGCAAAAATTTATGG + Intronic
1013860172 6:114626037-114626059 AAGGGCAAGGTAAAAACAGAGGG - Intergenic
1018206304 6:161440256-161440278 ATGGGAAGGGTAAAAACTTAGGG - Intronic
1019768174 7:2866563-2866585 TAGGGGGTGGTATAAACTTATGG + Intergenic
1021244007 7:18239487-18239509 AAGGACTTTGTGAAAACTTTGGG + Intronic
1022711519 7:32855175-32855197 AAGGGTTTGATAAGAACTTGTGG - Intergenic
1022913138 7:34919784-34919806 AAGGGTTTGATAAGAACTTGTGG + Intergenic
1026263563 7:68776863-68776885 AAGAGCTTAGTAAAAGCTAAAGG + Intergenic
1029840489 7:103357922-103357944 AAGGTGCTGGGAAAAACTTAAGG - Intronic
1030383994 7:108846770-108846792 AAGGGCTCGGCAAAGACTCAAGG - Intergenic
1031028831 7:116712896-116712918 AAAGGCTTGAGAAAACCTTACGG - Intronic
1032066823 7:128777574-128777596 AGGGTCTGGGTAAACACTTAGGG + Intergenic
1034135770 7:148767929-148767951 AAGTGCGAGGGAAAAACTTACGG - Intronic
1034279662 7:149844302-149844324 AGGGGCTGGGCAACAACTTAGGG - Intronic
1035084904 7:156249905-156249927 AGGGACTGGTTAAAAACTTACGG - Intergenic
1035263864 7:157678288-157678310 AAGGCTTTGTTAAAAACTTCTGG + Intronic
1036610792 8:10348197-10348219 AAGGGCTGAGTAAACACTGATGG - Intronic
1037013158 8:13870067-13870089 AAGCGCATGGTGAAAACTAAAGG + Intergenic
1041893363 8:62896508-62896530 CAAGGCTTGGTATAAACTTACGG - Intronic
1042888335 8:73577604-73577626 TAGGGCTTGGCTAAAACATACGG - Intronic
1043111497 8:76189237-76189259 AAGGACTTGGGAAAGATTTAAGG + Intergenic
1043111594 8:76190843-76190865 AAGGACTTGGAAAAGACTTCAGG + Intergenic
1045991080 8:108309275-108309297 AAGGGCTTGGTAAACACTTCAGG - Intronic
1046799614 8:118411546-118411568 TAGGGCTTTGAAAAATCTTAAGG + Intronic
1048893597 8:138968885-138968907 AAGACCTTTGTAAAAACTGAAGG - Intergenic
1050912268 9:11086483-11086505 AAGAGCTAGATAAATACTTAAGG + Intergenic
1052542316 9:29827091-29827113 AAGGGCTCTGTATAAAGTTAAGG - Intergenic
1053034622 9:34814003-34814025 AAGGGTTTGGAAAAAACTTCTGG - Intergenic
1057008326 9:91580649-91580671 AAGAGCCTGGTAAAACCTAAAGG - Intronic
1058175902 9:101737185-101737207 AACGGCTTGGTAAAGTCTGAGGG - Intronic
1186980273 X:14951114-14951136 AAGGACTTGTTAAAAACCTGGGG + Intergenic
1187145759 X:16635912-16635934 AAGGACTTTTTAAAAAATTAAGG + Intronic
1188043386 X:25397099-25397121 AAGGACTTTGTAAAAACAAAAGG - Intergenic
1189475362 X:41349266-41349288 AAGTACTTTGTAAAAAGTTATGG - Exonic
1190436802 X:50433579-50433601 AAGGGCTGGGTAAGAGCTTTGGG + Intronic
1194813280 X:98412955-98412977 AAAAGCTTGGTAAAAGCATAAGG - Intergenic
1195449596 X:104996315-104996337 AATTGCTTGGTACATACTTATGG - Intronic
1195815187 X:108877424-108877446 GAGAGCTTGATAAAAACCTAGGG + Intergenic
1198082200 X:133250775-133250797 AAGGCCTTGGTAATTACTGAAGG - Intergenic
1198493842 X:137170423-137170445 AGGGGCTTGGAAAAAGCTGAGGG - Intergenic
1201889454 Y:18925918-18925940 AAGATCTTGGTATAAACTCATGG - Intergenic