ID: 1084798426

View in Genome Browser
Species Human (GRCh38)
Location 11:71525121-71525143
Sequence GAAATTTTCAGAGCCCCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084798426_1084798430 10 Left 1084798426 11:71525121-71525143 CCCTAGGGGGCTCTGAAAATTTC No data
Right 1084798430 11:71525154-71525176 TGATGACTTAGGATATCTAGTGG No data
1084798426_1084798429 -1 Left 1084798426 11:71525121-71525143 CCCTAGGGGGCTCTGAAAATTTC No data
Right 1084798429 11:71525143-71525165 CTACTTAGGAGTGATGACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084798426 Original CRISPR GAAATTTTCAGAGCCCCCTA GGG (reversed) Intergenic
No off target data available for this crispr