ID: 1084799046

View in Genome Browser
Species Human (GRCh38)
Location 11:71529344-71529366
Sequence CTAGGAGTGTTCACTGCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 1, 2: 13, 3: 88, 4: 287}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084799046_1084799049 26 Left 1084799046 11:71529344-71529366 CCTGTAGCAGTGAACACTCCTAG 0: 1
1: 1
2: 13
3: 88
4: 287
Right 1084799049 11:71529393-71529415 TGCTATTTATTGTATCTACCTGG 0: 1
1: 0
2: 1
3: 10
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084799046 Original CRISPR CTAGGAGTGTTCACTGCTAC AGG (reversed) Intronic