ID: 1084799046 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:71529344-71529366 |
| Sequence | CTAGGAGTGTTCACTGCTAC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 390 | |||
| Summary | {0: 1, 1: 1, 2: 13, 3: 88, 4: 287} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1084799046_1084799049 | 26 | Left | 1084799046 | 11:71529344-71529366 | CCTGTAGCAGTGAACACTCCTAG | 0: 1 1: 1 2: 13 3: 88 4: 287 |
||
| Right | 1084799049 | 11:71529393-71529415 | TGCTATTTATTGTATCTACCTGG | 0: 1 1: 0 2: 1 3: 10 4: 151 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1084799046 | Original CRISPR | CTAGGAGTGTTCACTGCTAC AGG (reversed) | Intronic | ||