ID: 1084799820

View in Genome Browser
Species Human (GRCh38)
Location 11:71535987-71536009
Sequence AACCCAATGGCGGTACTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 30}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084799814_1084799820 1 Left 1084799814 11:71535963-71535985 CCCATCCGACGCCTCACATTTGA 0: 1
1: 1
2: 0
3: 3
4: 31
Right 1084799820 11:71535987-71536009 AACCCAATGGCGGTACTGACAGG 0: 1
1: 0
2: 0
3: 0
4: 30
1084799816_1084799820 -4 Left 1084799816 11:71535968-71535990 CCGACGCCTCACATTTGAAAACC 0: 1
1: 0
2: 2
3: 12
4: 126
Right 1084799820 11:71535987-71536009 AACCCAATGGCGGTACTGACAGG 0: 1
1: 0
2: 0
3: 0
4: 30
1084799815_1084799820 0 Left 1084799815 11:71535964-71535986 CCATCCGACGCCTCACATTTGAA 0: 1
1: 1
2: 0
3: 2
4: 48
Right 1084799820 11:71535987-71536009 AACCCAATGGCGGTACTGACAGG 0: 1
1: 0
2: 0
3: 0
4: 30
1084799817_1084799820 -10 Left 1084799817 11:71535974-71535996 CCTCACATTTGAAAACCCAATGG 0: 1
1: 0
2: 3
3: 46
4: 623
Right 1084799820 11:71535987-71536009 AACCCAATGGCGGTACTGACAGG 0: 1
1: 0
2: 0
3: 0
4: 30
1084799813_1084799820 23 Left 1084799813 11:71535941-71535963 CCACATGAGAGGCAATTTTACAC 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1084799820 11:71535987-71536009 AACCCAATGGCGGTACTGACAGG 0: 1
1: 0
2: 0
3: 0
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084799820 Original CRISPR AACCCAATGGCGGTACTGAC AGG Intronic
902467693 1:16628393-16628415 AACCCCATGGGGGCACTGTCAGG + Intergenic
905940856 1:41862124-41862146 CACCCAAAGGTGGCACTGACTGG + Intronic
913411103 1:118552679-118552701 AACCCATAGGCTGTACTGAATGG + Intergenic
916121735 1:161534222-161534244 AACCAAAGGGTAGTACTGACTGG + Intergenic
916131328 1:161614168-161614190 AACCAAAGGGTAGTACTGACTGG + Intronic
919807219 1:201387241-201387263 AACCCAATGGAGATGCTGCCAGG + Intronic
1080564810 11:33498303-33498325 AACCCGATGGCTGCACTGAGAGG + Intergenic
1084799820 11:71535987-71536009 AACCCAATGGCGGTACTGACAGG + Intronic
1086891694 11:92265851-92265873 AACCCCAAGGTGGTACTAACAGG - Intergenic
1099861424 12:88229234-88229256 ACCCCAGTGGAGGTCCTGACTGG - Intergenic
1101114829 12:101521878-101521900 AACCCAGTGGTGGTACCAACAGG + Intergenic
1103386318 12:120534957-120534979 AACCCAAGAGCGGTAAGGACGGG + Exonic
1113503144 13:110793973-110793995 AACCAAATGTCGGGACTGAATGG + Intergenic
1119668640 14:76501882-76501904 AACCCAAGGGCAGTGCTGTCTGG - Intergenic
1124861609 15:33447521-33447543 AACCCAATGCCTGCTCTGACTGG - Intronic
1127750922 15:62042331-62042353 AACGGAAAGGCTGTACTGACTGG - Intronic
1129316259 15:74746821-74746843 AACCCAATGGAGATATAGACAGG + Intergenic
1158885634 18:61824387-61824409 AACCGCATGGCAGTACTGCCAGG + Intronic
1160226199 18:77013220-77013242 TATCCAATGGAGGTACTGAGTGG + Exonic
929259782 2:39852941-39852963 ATCAAAATGGAGGTACTGACAGG - Intergenic
943506418 2:188765634-188765656 AAGCCAATGGAGATACTAACAGG - Intronic
944309326 2:198215849-198215871 AAGCCAATGAAGTTACTGACTGG + Intronic
1173729955 20:45321224-45321246 ACCCCAAGGTCGGTACTTACTGG - Intergenic
1174760467 20:53201962-53201984 ATTCCAAAGGCAGTACTGACAGG + Intronic
968831007 4:2933039-2933061 AACCCCATGGGGCTACTGGCTGG + Intronic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
1002084880 5:176768260-176768282 AACTGAATGGCAGAACTGACTGG + Intergenic
1018914679 6:168125748-168125770 AAAGCAAAGGCGGGACTGACCGG + Intergenic
1060235679 9:121861009-121861031 AACCAAATGGCTGAACTTACAGG - Intronic