ID: 1084800850

View in Genome Browser
Species Human (GRCh38)
Location 11:71542986-71543008
Sequence TTTGAAAGGCCCAATGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 237}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084800846_1084800850 1 Left 1084800846 11:71542962-71542984 CCATCTCAAAAAATAAAAAAAGG 0: 13
1: 919
2: 16128
3: 114555
4: 84402
Right 1084800850 11:71542986-71543008 TTTGAAAGGCCCAATGTGGATGG 0: 1
1: 0
2: 1
3: 17
4: 237
1084800845_1084800850 22 Left 1084800845 11:71542941-71542963 CCTAGGCAATAGAGCGAGACTCC 0: 15
1: 705
2: 12327
3: 62811
4: 117679
Right 1084800850 11:71542986-71543008 TTTGAAAGGCCCAATGTGGATGG 0: 1
1: 0
2: 1
3: 17
4: 237
1084800844_1084800850 26 Left 1084800844 11:71542937-71542959 CCAGCCTAGGCAATAGAGCGAGA 0: 35
1: 1462
2: 23901
3: 113604
4: 192841
Right 1084800850 11:71542986-71543008 TTTGAAAGGCCCAATGTGGATGG 0: 1
1: 0
2: 1
3: 17
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084800850 Original CRISPR TTTGAAAGGCCCAATGTGGA TGG Intronic
901265123 1:7904220-7904242 TTTGGGAGGCCCAAGGCGGAAGG + Intergenic
901885290 1:12218430-12218452 TTTGGGAGGCCCAAGGTGGGAGG + Intergenic
902203688 1:14852177-14852199 TTAGACAGCCCCAAGGTGGAGGG - Intronic
904805431 1:33128119-33128141 TTTGGGAGGCCGAAGGTGGAAGG + Intergenic
910933672 1:92467722-92467744 TTTTGAAGGCCCAAGGTAGATGG + Intergenic
911530284 1:99036221-99036243 TTTTACAGGCTCAAGGTGGAAGG - Intergenic
911819273 1:102396130-102396152 TTTGGAAGGGAAAATGTGGAGGG - Intergenic
912482335 1:109992871-109992893 TTTTAAAGTCCTGATGTGGAAGG + Intronic
912604245 1:110972139-110972161 GTTGAAACGCCTTATGTGGATGG - Intergenic
913074855 1:115333288-115333310 TTGAAATTGCCCAATGTGGAAGG + Intronic
915141813 1:153772720-153772742 TTTCCAAGGCCCAAAGTGGCAGG - Intronic
916162499 1:161932437-161932459 TTAAAAAGGGCCAATTTGGAAGG - Intronic
918344362 1:183593324-183593346 TTTTAAAAGCTCAATCTGGATGG - Intronic
920419826 1:205825364-205825386 TTTGGGAGGCCCAAAGTGGGAGG + Intergenic
920713510 1:208317650-208317672 ATTGGAAGGACAAATGTGGATGG + Intergenic
1063429037 10:5973158-5973180 TTTAAAAGGCCTGATGTGCAGGG - Intronic
1063999796 10:11654064-11654086 TTTGAAATGTGCAATGAGGAAGG + Intergenic
1065305339 10:24363330-24363352 TTTGAAAGGCTAAATGTGGCAGG - Intronic
1065615049 10:27512546-27512568 TTTGGGAGGCCCAAGGTGGGTGG - Intronic
1067302070 10:45020979-45021001 TTTGGGAGGCCCAAGGTGGGTGG - Intergenic
1067397476 10:45935584-45935606 TTTGGGAGGCCCAACGTGGGCGG + Intergenic
1067865794 10:49904670-49904692 TTTGGGAGGCCCAACGTGGGCGG + Intronic
1067934471 10:50597458-50597480 TTTGATACACACAATGTGGATGG + Intronic
1068180616 10:53513448-53513470 TTTGTGAGCCCCAAAGTGGATGG - Intergenic
1069187363 10:65441376-65441398 TTTCCAAGGGCCAAAGTGGAAGG - Intergenic
1070987421 10:80700733-80700755 TTTGGAAGGGCCAATGTGTCGGG + Intergenic
1071403556 10:85304121-85304143 TTTGAAAGTTCAAATGTGTATGG - Intergenic
1071707194 10:88012030-88012052 TTTGAAAGTGCCAAAGTCGATGG + Intergenic
1071849163 10:89551060-89551082 TTAGAAAGGTCCATTTTGGATGG + Intronic
1071923451 10:90377410-90377432 GTTGAAATCCCCAATGTGGGGGG - Intergenic
1072790452 10:98313943-98313965 TTTGAAAATGCCAATGTGGATGG - Intergenic
1073223672 10:101897677-101897699 TTAGAAAGTCCCAAAGGGGAAGG + Intronic
1076715986 10:132364014-132364036 TTTTAAAGGCCAAATATGGCAGG - Intronic
1077454811 11:2672129-2672151 TTTGAAAGGCCCAAAGAGGGAGG - Intronic
1077627805 11:3788701-3788723 TTTGGGAGGCCCAAAGTGGGCGG + Intronic
1078281096 11:9901886-9901908 TTTGGGAGGCCAAATGTGGGAGG - Intronic
1079938395 11:26646972-26646994 TTTGAAATGCCAAGTGTGGGAGG + Intronic
1082996396 11:59259110-59259132 AGTGAAAGGGCCAATGAGGAGGG - Intergenic
1084800850 11:71542986-71543008 TTTGAAAGGCCCAATGTGGATGG + Intronic
1086166933 11:83790229-83790251 TATGAACAGCCAAATGTGGAAGG - Intronic
1086461787 11:87013068-87013090 TCTGAGAGGCACAATGTGGATGG - Intergenic
1087120078 11:94564354-94564376 TTTAAAAAACCCTATGTGGAAGG + Intronic
1088022479 11:105136421-105136443 TTTCAAAGACTCTATGTGGATGG + Intergenic
1088200744 11:107330930-107330952 TTAAAAAGGCACAATGTAGAAGG + Intronic
1088952746 11:114587696-114587718 TTGGAAAGGCCTAGGGTGGAGGG - Intronic
1088992858 11:114969779-114969801 TATGTAAGTCCCAATGGGGAGGG + Intergenic
1089084368 11:115804348-115804370 TATAAAAGGCCCACTGTGGTGGG - Intergenic
1089184798 11:116607474-116607496 TTTGAAAGGACAAATGTGCAGGG + Intergenic
1090703300 11:129315162-129315184 GAGGAAAGGCCCATTGTGGAGGG - Intergenic
1092200277 12:6577848-6577870 CTTGAAAGGCTCATTGAGGATGG + Exonic
1097831504 12:64229365-64229387 TGTGAAAGAGCCACTGTGGAAGG - Intergenic
1098387320 12:69933290-69933312 TTTCAAAGGCCCAGTGTGGTGGG - Intronic
1098813196 12:75122261-75122283 TTTGAATGGCCAATTTTGGAGGG - Intronic
1100058650 12:90544190-90544212 TTTGAGAGGGCCAATGTACATGG + Intergenic
1102109952 12:110357545-110357567 TTTGGGAGGCCCAAGGTGGGAGG + Intergenic
1102537606 12:113592842-113592864 TTTGAAAAGCACAATATGGCCGG + Intergenic
1102974109 12:117193799-117193821 TTTGAAGGGCCCAAAGGGAATGG - Intergenic
1103615222 12:122147585-122147607 TGAGAAAGGCCCAGTGTGGCGGG + Intergenic
1103906331 12:124329216-124329238 TTTGGGAGGCCCAATGTGGGTGG + Intronic
1105275452 13:18919068-18919090 TTTGAAAGACCAAATTTGGCCGG - Intergenic
1105389352 13:19959727-19959749 TGTGAAAGGCAAAATCTGGAAGG - Intronic
1107327509 13:39260776-39260798 TTTCAAAGGGTAAATGTGGATGG - Intergenic
1107933398 13:45325023-45325045 TTTGGAAGGCCCAAAGCGGGTGG - Intergenic
1108187899 13:47906875-47906897 TTTGGGAGGCCCAAGGTGGGTGG - Intergenic
1112812204 13:103231888-103231910 TTTTAAAGACAAAATGTGGAGGG - Intergenic
1114664780 14:24370965-24370987 ATTGAAAGGGCCAGAGTGGAAGG - Intronic
1115120840 14:29935981-29936003 TTTTAAAAGTCCAATTTGGAAGG - Intronic
1116493957 14:45537652-45537674 TTTGAAAGTCATAATTTGGAGGG - Intergenic
1120827669 14:88970020-88970042 TTTCAAAAGCCCAGGGTGGAGGG - Intergenic
1120992869 14:90393954-90393976 TTTTAAAGGCCCAATGTTAGGGG - Intergenic
1121394670 14:93609864-93609886 TTTGCAAAGCCCACTCTGGAGGG + Intronic
1121642629 14:95495929-95495951 CTTGAGAGGCCCACTGGGGAAGG - Intergenic
1122236787 14:100335266-100335288 AGTGAAAGGGCCAATGGGGAGGG + Intronic
1123587885 15:21775137-21775159 TTTGGGAGGCCAAATGGGGAGGG - Intergenic
1123624523 15:22217702-22217724 TTTGGGAGGCCAAATGGGGAGGG - Intergenic
1123938488 15:25205401-25205423 GGTGAAAGGCCCACTGTTGAGGG + Intergenic
1124396254 15:29304592-29304614 TTTTAAAGGCCCACTCTGGTTGG - Intronic
1125401474 15:39309094-39309116 TTAGAAGGGCCAAATGTTGAAGG + Intergenic
1129139454 15:73584098-73584120 TTTGAAATGTCCAATAAGGAGGG + Intronic
1129406556 15:75322980-75323002 TTTGGAAGGCCTAAGGTGGGCGG - Intergenic
1129713734 15:77834956-77834978 TTTTAAAGGCCTACTGAGGATGG - Intergenic
1129917583 15:79287948-79287970 TTTGACCGGCCCCATGTGCAGGG - Intergenic
1132751799 16:1461044-1461066 TATGAAGGGCCCAGTGTGCACGG + Intronic
1133409966 16:5559918-5559940 TAAGAAAGCCCCAAAGTGGAGGG - Intergenic
1133719124 16:8478108-8478130 TTTGGGAGGCCCAAGGTGGGTGG - Intergenic
1134765775 16:16756425-16756447 TATGAAAGGTACAATGTGGCAGG + Intergenic
1134980278 16:18602794-18602816 TATGAAAGGTACAATGTGGCAGG - Intergenic
1135743134 16:24993935-24993957 TTTGCAAAGCCCAGTTTGGAAGG - Intronic
1137038723 16:35590547-35590569 TTTGAGAGGCCCGAGGTGGAGGG - Intergenic
1137816559 16:51403627-51403649 TTGGAGAGGCCCAGTGTGGCTGG - Intergenic
1139454609 16:67063183-67063205 TTTTAAATGCACAGTGTGGAAGG + Intronic
1141396487 16:83709617-83709639 TTTAAGAGGCTCACTGTGGATGG - Intronic
1141510320 16:84507573-84507595 TTTGAATGGCCACATGTGGCAGG + Intronic
1141548394 16:84787480-84787502 TTTAAAAGTCCCATTGTAGATGG - Intergenic
1142574208 17:895514-895536 TTAAAAAGACCCAATGTGGCCGG + Intronic
1143022276 17:3923029-3923051 TTGGAAGGGCCAAAGGTGGATGG + Intergenic
1143488098 17:7266310-7266332 TTTAAAATGACCAGTGTGGAAGG - Intergenic
1146469992 17:33116497-33116519 GCTGACAGGCCCACTGTGGATGG + Intronic
1147277259 17:39328808-39328830 TTTTGGAGGCCCAAGGTGGAAGG + Intronic
1147724881 17:42560892-42560914 CTTGAAAGGCTGAGTGTGGAGGG - Intergenic
1150532423 17:65998135-65998157 TTTGAGAGGCCTGAGGTGGATGG + Intronic
1151123828 17:71823306-71823328 TTGGAAATACCCAATGTGGATGG + Intergenic
1151631848 17:75316294-75316316 TTTGAAAGGCCAAGGGTGGGGGG + Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153000400 18:450295-450317 TTTGTAATCCCCAATGTTGAGGG + Intronic
1154467072 18:14656192-14656214 TTTGAAAGACCAAATTTGGCCGG - Intergenic
1155031698 18:21990653-21990675 TGTGAAATGCCCAGTGGGGAAGG + Intergenic
1156817608 18:41329253-41329275 TTTTACAGGCTCATTGTGGAAGG + Intergenic
1157154835 18:45255296-45255318 TTTAAAAGGAGCAATGAGGATGG - Intronic
1160591955 18:79950097-79950119 TTTCAGAGGCCCAGTGGGGAGGG + Intronic
1162665941 19:12211992-12212014 TTTGGAAGGCCCAAGGTGGGAGG - Intergenic
1163632386 19:18424107-18424129 AATAAAAGGACCAATGTGGAAGG + Intronic
1164418075 19:28062737-28062759 TTAGCTAGGCCCAATGAGGATGG + Intergenic
1164500082 19:28811879-28811901 TTTTAAGGGCCAAATCTGGAAGG - Intergenic
1165039063 19:33056025-33056047 ATTGAAAGGCCCAAAATGAAAGG - Intronic
1165051421 19:33144008-33144030 TTCTAAATGCCCAGTGTGGAGGG + Intronic
1165590297 19:36963670-36963692 TTAGAAAGGCCCAAGTTGGCCGG + Intronic
1166268887 19:41701486-41701508 TGGGAAAGGCCCAGTGTGGACGG + Intronic
1166772040 19:45289526-45289548 TTTGGGAGGCCCAAGGTGGGCGG + Intronic
1167686957 19:50962497-50962519 TAGGAAAGGACCAATGAGGAAGG - Intronic
925723697 2:6852915-6852937 TTTGAAAGTACAAATGAGGAGGG - Intronic
925975286 2:9138013-9138035 TGTTAAAGGCGCAGTGTGGACGG - Intergenic
930720440 2:54632797-54632819 TTTGAGAGCCCCAAGGTGCAAGG - Intronic
931516323 2:63052419-63052441 CTACAAAGGGCCAATGTGGAGGG - Intronic
931886839 2:66626675-66626697 TTTGAAAGGTCAAAAGAGGACGG + Intergenic
932764292 2:74460373-74460395 TTTGAAGGAACAAATGTGGAAGG + Exonic
933909862 2:86930217-86930239 TTTGAAGGAACAAATGTGGAAGG - Intronic
934022864 2:87973171-87973193 TTTGAAGGAACAAATGTGGAAGG + Intergenic
937161380 2:119765587-119765609 TTTGAAATGCCCATTGTAGTGGG + Intronic
940014374 2:149088018-149088040 TTATGAAGGCCGAATGTGGATGG - Intronic
940290076 2:152069552-152069574 TATAAAAGACCCAGTGTGGAGGG - Intronic
940421215 2:153480882-153480904 TTTGTAAGATCCAATATGGAAGG + Intergenic
940922742 2:159327819-159327841 TTTGGGAGGCCCAATGGGGGCGG + Intronic
940990099 2:160087922-160087944 TTGGAATGGCCCAAAGTGGAGGG + Intergenic
941017226 2:160371296-160371318 TTTGAGAGGCAAAATGTAGAAGG - Intronic
943228387 2:185210500-185210522 TTAGAACGAACCAATGTGGAAGG - Intergenic
943671591 2:190667493-190667515 TTTGAAAGGCACAATGTTATTGG - Intronic
946842275 2:223830622-223830644 TTTGATATACCCAGTGTGGAAGG + Intronic
946939833 2:224759063-224759085 TTTTAAAAGGCCAATCTGGAAGG - Intergenic
947450321 2:230202531-230202553 TTTGAATGGCTCAGTGTGGGAGG - Intronic
947820298 2:233064339-233064361 TGTGGAAGGCCACATGTGGAGGG - Intronic
1170493325 20:16900106-16900128 TTTGAGAGGCCCAATCGGGTGGG + Intergenic
1172947766 20:38702129-38702151 TTTGAAAGGCCCCATCTGCTGGG + Intergenic
1173762789 20:45578831-45578853 TTTGAGTGGCCCAGTGTGGAGGG - Intronic
1174073558 20:47916062-47916084 TCTGAATTGCCCAGTGTGGATGG + Intergenic
1176807445 21:13501490-13501512 TTTGAAAGACCAAATTTGGCTGG + Intergenic
1177789188 21:25703683-25703705 GCTGAAAGGCCCAGTGTGGGTGG - Intronic
1178451872 21:32709241-32709263 TTTGGGAGGCCCAAGGTGGGTGG + Intronic
1180593076 22:16956917-16956939 TTTAAAAGGCTCAAAGTGAAGGG - Intergenic
1182659726 22:31916772-31916794 TTTGGCAGGCCCAAGGTGGGTGG - Intergenic
949214995 3:1555925-1555947 TATGGAAGGCCCAGTGTGAATGG - Intergenic
949870339 3:8582746-8582768 GTTAAAAGGCCCCATGTGGCTGG - Intergenic
950559853 3:13715077-13715099 ATTGAGGGGCCCAAGGTGGAGGG + Intergenic
951928943 3:27941992-27942014 TTTGAAAGGCACATTGGAGAAGG + Intergenic
953681868 3:45045125-45045147 TTTGAAAGAAGCAATGTGGTGGG - Intergenic
954097810 3:48344310-48344332 TTTGGGAGGCCCAAGGTGGGCGG + Intergenic
954461420 3:50629131-50629153 TGTGAAAGGCTCAATAAGGAAGG - Intronic
957007600 3:74968446-74968468 TTTCCAAGGCGCAATGTGGGAGG - Intergenic
959216484 3:103456486-103456508 TATGAAAAGCCAAATGTGAAAGG + Intergenic
960602781 3:119474537-119474559 TTTGAAAAGCCAAATGTGGCCGG + Intronic
961397122 3:126602298-126602320 TTATAAAGGCCCAAAGTGGTGGG + Intronic
964828900 3:160861081-160861103 GTTGAAAGGTTCAAAGTGGAAGG + Intronic
969357578 4:6639476-6639498 TTTGGGAGGCCCGAAGTGGAAGG + Intergenic
970954039 4:21789845-21789867 TTTGGAAGGCCCAACTTGGGTGG - Intronic
971452480 4:26812972-26812994 TTTGGGAGGCCCAAGGTGGGAGG + Intergenic
972113124 4:35591339-35591361 TTTGATAGGCTCATTGGGGATGG - Intergenic
972610050 4:40648089-40648111 TTTGGGAGGCCCAAGGTGGGAGG - Intergenic
972620630 4:40745062-40745084 TTTGAAAGGCCAAGTTTAGAGGG - Intergenic
972638679 4:40906548-40906570 TTTCAGAGTCCCAATGAGGAGGG + Intronic
972716225 4:41649101-41649123 TTTAAAAGGCCTAATGAGGCTGG + Intronic
974883607 4:67788866-67788888 TTTGAAAGGCTGAAGTTGGAGGG - Intergenic
976823574 4:89234508-89234530 TTTTAAAGGCCCACTGTGGTAGG - Intergenic
977409441 4:96642669-96642691 TTTGCAAGGCCCCCTGTGGCTGG - Intergenic
977645363 4:99405741-99405763 CCTGAAAGGCCCAAACTGGATGG + Intergenic
978555544 4:109976178-109976200 ATTGAAATGGCCAATCTGGATGG + Exonic
979324570 4:119363767-119363789 TTAGATAGTCCCAATGAGGAAGG + Intergenic
982371733 4:154640872-154640894 TTTGAAAAGCTAAATGTTGAAGG + Intronic
982802069 4:159718066-159718088 TCTGAAAGGATCAATGAGGAAGG - Intergenic
983242409 4:165248467-165248489 TTAGATAGTCCCAATGAGGAAGG + Intronic
983830267 4:172318404-172318426 TTTGAAAGGCTGAATGAGGCTGG + Intronic
984093525 4:175405984-175406006 TTTGGCAGGCTAAATGTGGATGG + Intergenic
984256829 4:177399560-177399582 TTTGAAAGGGCCAAAGGGGATGG + Intergenic
984347366 4:178546620-178546642 TTTGCCCTGCCCAATGTGGATGG - Intergenic
987269745 5:16294424-16294446 TTTTAAAGGCAAAATGTGAAAGG - Intergenic
989591246 5:43114961-43114983 TTGGAAACTCCCAATTTGGAGGG - Intronic
991312198 5:65256146-65256168 TTTGAACAGCCCCATGTGGCTGG - Intronic
991454966 5:66793209-66793231 TCTGAAATGCCCAATGTGTCTGG - Intronic
991921319 5:71660197-71660219 CTCAAAAGCCCCAATGTGGATGG - Intergenic
995612140 5:113922126-113922148 TTTTAAAAGCCAAATGTGGCCGG - Intergenic
996411443 5:123163603-123163625 TTTGAAAGGCCCACAGTGGATGG - Intronic
996586804 5:125097850-125097872 TTAGAATGGGCAAATGTGGAAGG + Intergenic
996588864 5:125122887-125122909 TTTGAGATGGCCAAGGTGGATGG - Intergenic
996878144 5:128262738-128262760 TTTGAAAGGAGCAGTGTGCAAGG - Intronic
997113563 5:131101489-131101511 TTTCAAAGGCAAAATGAGGAAGG + Intergenic
997241527 5:132311747-132311769 TTTGAAAAGCCCAAAGGGCAGGG - Intronic
997281794 5:132653561-132653583 TTTGAAAGGTGGAAAGTGGAGGG + Intergenic
998974913 5:147634960-147634982 TTTGAAAGCCCAATTGTGTAAGG - Intronic
1001033814 5:168282355-168282377 GTTGTAAGGCCCAGTGTGGGTGG - Intergenic
1002015975 5:176323049-176323071 TTTGAAATGCCCAGTGTGACTGG - Intronic
1002029927 5:176420391-176420413 TTTTAAAGGCAAAATGAGGAAGG - Intergenic
1002587758 5:180262677-180262699 TTTGGAAGGCCCGAGGTGGGCGG - Intronic
1002692724 5:181061663-181061685 TTTGAAAGGGGGAATGAGGAAGG + Intergenic
1004392047 6:15218191-15218213 TTTGGGAGGCCCAAGGTGGGTGG - Intergenic
1006349147 6:33508194-33508216 TTTGGGAGGCCCAAGGTGGGTGG + Intergenic
1006708263 6:36041436-36041458 TTTGAAAGTACAAATTTGGAAGG - Intronic
1006732819 6:36248954-36248976 CTAGAGAGGCCCAATGGGGAAGG + Intronic
1010197887 6:73258010-73258032 TTTGGGAGGCCCAAGGTGGGCGG + Intronic
1011260935 6:85468927-85468949 TTTGCAGGGCCCAGTGTGGGGGG + Intronic
1017891961 6:158646082-158646104 TGTGCCAGGCACAATGTGGAAGG - Intergenic
1019367744 7:643971-643993 TTCGAATGGCACAGTGTGGATGG - Intronic
1019566124 7:1679840-1679862 TCTGAAAGCCCCATTGTGCAGGG + Intergenic
1023181000 7:37483693-37483715 TTTGCAAAACCCACTGTGGATGG + Intergenic
1023793246 7:43770439-43770461 TTTGGAAGGCCAAGAGTGGAGGG - Intronic
1024083887 7:45877920-45877942 TTTTACAGGCCCAAGGTGAAAGG - Intergenic
1024465169 7:49704425-49704447 TTTGGGAGGCCCAAGGTGGGTGG + Intergenic
1025868006 7:65404313-65404335 TTGGAATGGCCCAGTATGGAGGG - Intergenic
1027615227 7:80414852-80414874 TTAGAAAGGCTCAATATGTAAGG - Intronic
1031567173 7:123314586-123314608 TTTGAAATTCCCAATTTTGAGGG - Intergenic
1031869376 7:127075609-127075631 TTTGAATGGGATAATGTGGAGGG + Intronic
1032126492 7:129198193-129198215 TTTGGGAGGCCCAAGGTGGGTGG - Intronic
1032433473 7:131881686-131881708 TTTGACAGGCCAGGTGTGGAGGG - Intergenic
1034513920 7:151558824-151558846 TTTGAAATACCAAATCTGGATGG + Intronic
1034896932 7:154882127-154882149 TATGAAAGGCCCTGAGTGGATGG - Intronic
1036502960 8:9330165-9330187 TTTGGAAGGCCGATTGTGGGCGG + Intergenic
1039027989 8:33278968-33278990 TCTGAAAGGCACAATGTGATGGG + Intergenic
1040047755 8:42980644-42980666 TTTGAAAGTCCCAAGGCGGGTGG + Intronic
1040293470 8:46137249-46137271 TTGGAGAGGCCAAATTTGGAGGG + Intergenic
1041826602 8:62101932-62101954 TTTGGAAGTCCCAATGGGAATGG - Intergenic
1042305049 8:67322452-67322474 TTTGGGAGGCCCAGTGGGGATGG + Intronic
1042817326 8:72891937-72891959 TTTGATAGGCTCCAAGTGGAGGG + Intronic
1044807470 8:96022896-96022918 TTTGATTGTCACAATGTGGAGGG - Intergenic
1047469045 8:125149336-125149358 TTTTAAAAGCCAAATGTGAATGG + Intronic
1049928101 9:429300-429322 TTTAAAAGACCCCATGTAGAAGG - Intronic
1050778498 9:9299597-9299619 TTTGAAAGGTCATATGTGCAAGG + Intronic
1051550714 9:18325982-18326004 TTTGGGAGGCCCAAGGTGGGTGG - Intergenic
1051790249 9:20794004-20794026 TTTGAAGGGCTGACTGTGGAAGG - Intronic
1052349649 9:27445588-27445610 TTTGAGATGCCAAATATGGATGG + Intronic
1052610655 9:30769328-30769350 TTTCAAATGACCCATGTGGATGG - Intergenic
1052765178 9:32633690-32633712 TTTGATGGGCCCCATGTGGGTGG + Exonic
1055366409 9:75549107-75549129 TTTGGGAGGCCGAAGGTGGAAGG - Intergenic
1055692548 9:78848125-78848147 TTGAAAAGGCACAATGGGGATGG + Intergenic
1058827088 9:108784749-108784771 TCTGAAAAGCCCAGTGTGGGTGG + Intergenic
1059455934 9:114400161-114400183 TTTGAAGGGCCCAGTGTGGTAGG - Intergenic
1186307364 X:8276925-8276947 TGTGAGAGGCCCAATGGAGACGG + Intergenic
1186331264 X:8536625-8536647 TTATGATGGCCCAATGTGGAGGG - Intronic
1187980037 X:24746891-24746913 TTTGAAAGGGCAAATGTGCCTGG + Intronic
1188059396 X:25582411-25582433 TTTGAGAGGCCCAGTGATGAAGG + Intergenic
1188971865 X:36627484-36627506 TATGACAGACCCACTGTGGAAGG - Intergenic
1190161141 X:48032257-48032279 TTTTAAAAGCCCACTGTGGGTGG - Intronic
1192469292 X:71383031-71383053 TTTGATGGGCCCCATGTGGGTGG - Exonic
1196034611 X:111130584-111130606 TTGGGAAGGCCCATGGTGGAAGG - Intronic
1196921527 X:120590614-120590636 TTTGAAAGGTGCAGTGTGGTTGG + Intergenic
1197236749 X:124074712-124074734 TATGAAAGGCCCAGTGTGTTAGG + Intronic
1198012540 X:132573049-132573071 TTTGAAAAGAACATTGTGGATGG + Intergenic
1199270239 X:145873760-145873782 TTTGAAATCCCCAAAGTAGAAGG - Intergenic
1201670011 Y:16509381-16509403 TTTAAAAGGGACAAAGTGGAAGG + Intergenic