ID: 1084805366

View in Genome Browser
Species Human (GRCh38)
Location 11:71575216-71575238
Sequence GCTGCTGGTGAAATTGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084805366_1084805371 -4 Left 1084805366 11:71575216-71575238 CCATATTCAATTTCACCAGCAGC No data
Right 1084805371 11:71575235-71575257 CAGCTCTTCAGGGTTGGCTGTGG No data
1084805366_1084805369 -10 Left 1084805366 11:71575216-71575238 CCATATTCAATTTCACCAGCAGC No data
Right 1084805369 11:71575229-71575251 CACCAGCAGCTCTTCAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084805366 Original CRISPR GCTGCTGGTGAAATTGAATA TGG (reversed) Intergenic
No off target data available for this crispr