ID: 1084806105

View in Genome Browser
Species Human (GRCh38)
Location 11:71580066-71580088
Sequence GTCTGTCATCCCTGCAATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286088
Summary {0: 1, 1: 5, 2: 427, 3: 17553, 4: 268102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084806105_1084806109 11 Left 1084806105 11:71580066-71580088 CCCAAATTGCAGGGATGACAGAC 0: 1
1: 5
2: 427
3: 17553
4: 268102
Right 1084806109 11:71580100-71580122 CATGCAGCCTCTTTTATGTCTGG 0: 2
1: 1
2: 2
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084806105 Original CRISPR GTCTGTCATCCCTGCAATTT GGG (reversed) Intronic
Too many off-targets to display for this crispr