ID: 1084806109

View in Genome Browser
Species Human (GRCh38)
Location 11:71580100-71580122
Sequence CATGCAGCCTCTTTTATGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 2, 1: 1, 2: 2, 3: 7, 4: 121}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084806106_1084806109 10 Left 1084806106 11:71580067-71580089 CCAAATTGCAGGGATGACAGACA 0: 1
1: 3
2: 197
3: 8534
4: 125705
Right 1084806109 11:71580100-71580122 CATGCAGCCTCTTTTATGTCTGG 0: 2
1: 1
2: 2
3: 7
4: 121
1084806104_1084806109 14 Left 1084806104 11:71580063-71580085 CCTCCCAAATTGCAGGGATGACA 0: 2
1: 91
2: 9181
3: 326954
4: 329919
Right 1084806109 11:71580100-71580122 CATGCAGCCTCTTTTATGTCTGG 0: 2
1: 1
2: 2
3: 7
4: 121
1084806099_1084806109 27 Left 1084806099 11:71580050-71580072 CCTCCTGCCTTGGCCTCCCAAAT 0: 437
1: 28558
2: 79961
3: 162520
4: 174890
Right 1084806109 11:71580100-71580122 CATGCAGCCTCTTTTATGTCTGG 0: 2
1: 1
2: 2
3: 7
4: 121
1084806100_1084806109 24 Left 1084806100 11:71580053-71580075 CCTGCCTTGGCCTCCCAAATTGC 0: 725
1: 62450
2: 181508
3: 241157
4: 278888
Right 1084806109 11:71580100-71580122 CATGCAGCCTCTTTTATGTCTGG 0: 2
1: 1
2: 2
3: 7
4: 121
1084806102_1084806109 20 Left 1084806102 11:71580057-71580079 CCTTGGCCTCCCAAATTGCAGGG 0: 10
1: 1793
2: 89811
3: 216585
4: 250430
Right 1084806109 11:71580100-71580122 CATGCAGCCTCTTTTATGTCTGG 0: 2
1: 1
2: 2
3: 7
4: 121
1084806105_1084806109 11 Left 1084806105 11:71580066-71580088 CCCAAATTGCAGGGATGACAGAC 0: 1
1: 5
2: 427
3: 17553
4: 268102
Right 1084806109 11:71580100-71580122 CATGCAGCCTCTTTTATGTCTGG 0: 2
1: 1
2: 2
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084806109 Original CRISPR CATGCAGCCTCTTTTATGTC TGG Intronic
907560406 1:55382478-55382500 CATGCCGCCTCTCTGATCTCCGG + Intergenic
908106467 1:60848292-60848314 CATACAGCTTCTTTTGTGACAGG + Intergenic
916437307 1:164789065-164789087 CATACTGCCTCTTTTCTTTCAGG - Intronic
919648878 1:200125500-200125522 CATGCAGTAGCTTTTCTGTCTGG - Intronic
923055763 1:230425458-230425480 CCTGCAGCCTCATTTGTTTCCGG + Intronic
1073190941 10:101650317-101650339 CACTCTGCCTCTTTTCTGTCTGG + Intronic
1075840355 10:125496808-125496830 CATGCAGCCCCTAGTATTTCTGG + Intergenic
1076180010 10:128399723-128399745 CATGCAGCCTCTTTCGTGAAAGG - Intergenic
1077263800 11:1638733-1638755 CATGCAGCCTCATTTATGTCTGG - Intergenic
1077399741 11:2348403-2348425 TATCCAGTCTCTTTTATCTCAGG + Intergenic
1079260742 11:18877525-18877547 CATGAAGCCCCTTTCATATCAGG - Intergenic
1079465920 11:20730815-20730837 CATCCAGCCTCTGTGAAGTCAGG - Intronic
1083819390 11:65158920-65158942 CATGAAGCCTCTTTTATAAGAGG + Intergenic
1084804325 11:71568410-71568432 CATGCAGCCTCTTTTATGTCTGG - Intronic
1084806109 11:71580100-71580122 CATGCAGCCTCTTTTATGTCTGG + Intronic
1088900178 11:114109758-114109780 CATGAAGCCAGTTTTCTGTCAGG - Intronic
1091042365 11:132293640-132293662 CCTGCAGCCTCTTTTCTGAATGG + Intronic
1092759168 12:11793776-11793798 CATGCAGCCAGGTTTATGCCTGG - Intronic
1095682458 12:44994273-44994295 CATGCAGCCTCTTCTGCATCTGG + Intergenic
1096521753 12:52188442-52188464 CCTGCAGCCTCTGGGATGTCCGG - Intronic
1099397879 12:82163783-82163805 CACGCAGTATCTTTTGTGTCTGG - Intergenic
1100432397 12:94542327-94542349 CCTCCTGCCTCTTTTTTGTCAGG - Intergenic
1100609159 12:96176878-96176900 GATACAGCCCCTTTTATATCTGG + Intergenic
1106014746 13:25858009-25858031 CTTACAGCCTATTTTATGCCAGG - Intronic
1106569042 13:30910307-30910329 CAGGCAGCCTCTTTCATGCTAGG - Intronic
1107851252 13:44575848-44575870 CCTGCAGCATCTTCTACGTCGGG - Exonic
1113558240 13:111255548-111255570 CCTGCAGCCTCTGTTCTGCCAGG + Intronic
1113979821 13:114265128-114265150 CATGCTGAATCTTTTATGGCAGG + Exonic
1119747284 14:77053305-77053327 CAACCAGCCTGTTTTATGTCAGG - Intergenic
1120036972 14:79708932-79708954 AATGCAACCTCTTATATCTCTGG + Intronic
1121819145 14:96951981-96952003 AATGAAGACTCTTGTATGTCTGG + Intergenic
1126563916 15:50075147-50075169 CATCCAGTCTCCTTTATCTCTGG - Intronic
1127549994 15:60027674-60027696 CCTGCAGCATCTTTTATTTTGGG + Intronic
1128235169 15:66062058-66062080 CTTGCAGCCTCTTTTTGGTCAGG + Intronic
1129513996 15:76145405-76145427 CATCCTTCCTCTTTCATGTCTGG + Intronic
1129522426 15:76194330-76194352 CGTTCAGCCTTTGTTATGTCTGG + Intronic
1132370749 15:101296004-101296026 CATGGAGTCTATATTATGTCTGG + Intergenic
1133234406 16:4381195-4381217 CATGCAGCCTGTTGGCTGTCAGG - Exonic
1139049285 16:63103380-63103402 CTTGCAACCTATTTTAGGTCAGG - Intergenic
1141015212 16:80442611-80442633 CAAGCAGCTTCTTCTATGTCAGG + Intergenic
1142907279 17:3052505-3052527 CATGAAGCCTCTTTTATAAAGGG - Intergenic
1142927287 17:3251736-3251758 CATGAAGCCTCTTTTATAAAGGG + Intergenic
1143628189 17:8122708-8122730 GAGCCAGCCTCTGTTATGTCGGG - Intronic
1147730587 17:42598466-42598488 CATGAAGGCCCTTTTATGACGGG - Intronic
1149143448 17:53461204-53461226 CATGCTTCCTCTTATCTGTCAGG - Intergenic
1152073946 17:78147391-78147413 AAGGCAGCCTCGTGTATGTCAGG - Intronic
1154095922 18:11414636-11414658 CATGCTGCCTCCTCTGTGTCTGG + Intergenic
1158739815 18:60127524-60127546 CAGGCAACCTCTTCTATGGCTGG + Intergenic
1159509732 18:69380578-69380600 GATGCAACCACTTCTATGTCTGG + Intergenic
1159813177 18:73041576-73041598 CAAGCAGCCACTTTTATTTGAGG + Intergenic
1159965604 18:74592586-74592608 TCTGAAGCCTCCTTTATGTCTGG + Intergenic
1168205614 19:54848406-54848428 GAGGCAGCCTCTTGTATGTTTGG - Intronic
929329880 2:40669530-40669552 CATGCAGCCTCATTTCTTTGAGG + Intergenic
930039746 2:47111949-47111971 CATGCAGCCTTCTTTGTGTCAGG - Intronic
942511878 2:176710985-176711007 CATGCAGCTTCATTTATCTTAGG - Intergenic
944701800 2:202252534-202252556 CATGCTGCCCTTTTTATGTTTGG - Intergenic
945338854 2:208626926-208626948 CATCCAACTTCTTTTGTGTCAGG - Intronic
945804523 2:214474263-214474285 CATGCTGCCTCTTTGCTTTCAGG - Intronic
946188794 2:217996374-217996396 CATCCAGCGTCGTTTATGTGGGG + Intronic
946963565 2:225011381-225011403 CTTGCAACCTCTTTTCTCTCTGG - Intronic
948051021 2:234979455-234979477 CATGCAGTATCTTTTGTGGCTGG + Intronic
948309967 2:236977755-236977777 CATGCATCCTCCTTTATGGACGG + Intergenic
1172700919 20:36853139-36853161 CAGGCAGCCTCTGTGTTGTCTGG - Intronic
1174328345 20:49797486-49797508 CGGGCATCCTCTTTCATGTCTGG + Intergenic
1175688469 20:61048413-61048435 GATGCATCCTCTTTTATTTATGG + Intergenic
1182015209 22:27033363-27033385 CATCCATCCTCTTCTATTTCAGG - Intergenic
949516671 3:4813782-4813804 CATGAAGGATCTTCTATGTCAGG + Intronic
949605763 3:5651699-5651721 CAGACAGGCTCTTTTAAGTCTGG - Intergenic
951064738 3:18250697-18250719 TATACAGCCTCCTTTATGGCAGG + Intronic
952977517 3:38708842-38708864 CATGTAGCCCCTTTTCTCTCGGG + Intronic
954622995 3:52006315-52006337 CAGGCAGCCTCTCATCTGTCTGG + Intergenic
954891734 3:53936880-53936902 CATTTTGCCTCTTTTAGGTCTGG + Intergenic
957773535 3:84725204-84725226 CATGCAGATTGTTTTATTTCTGG + Intergenic
960003966 3:112763033-112763055 CATTCAGTCTCTTTTGTCTCTGG + Intronic
960165959 3:114401577-114401599 CATGCAGACTATGTAATGTCAGG + Intronic
961129554 3:124453322-124453344 CATGGAGCCTCTCCTATCTCAGG - Intronic
961493090 3:127269001-127269023 CAGGCAGCCTCTTTAAAATCAGG + Intergenic
962734084 3:138308683-138308705 CATGCAGCTTTTTTGATGCCTGG + Intronic
967367881 3:188708338-188708360 CATACAGCATCTTTTTGGTCAGG - Exonic
968181741 3:196600181-196600203 CAGGCATCCTGTATTATGTCTGG - Intergenic
969183580 4:5459789-5459811 CAGGCTGCCTCTCTGATGTCTGG - Intronic
974541217 4:63238964-63238986 CATGAAGGTTCTTTCATGTCAGG + Intergenic
977100991 4:92814839-92814861 CATGCAGCTTCTTTAATACCTGG - Intronic
979124216 4:116947123-116947145 CATCCATCCTCTTTTATGGGTGG + Intergenic
983135539 4:164075092-164075114 AAAGCAGCCTCTGTTATCTCAGG + Intronic
987424914 5:17762251-17762273 CCTGCAGCCTCTTATCTGTTAGG - Intergenic
990875621 5:60481700-60481722 CACCCATCCTCTTCTATGTCAGG - Intronic
991590044 5:68241701-68241723 CATGCAGCCTCTCTCACTTCAGG + Intronic
993102242 5:83554845-83554867 CATGCATCCTCTTTACTGGCTGG - Intronic
995046259 5:107651990-107652012 AATGCAGCCTCGTGTATGTGTGG + Intronic
998015855 5:138731644-138731666 CATGCAGCATACTTTATGACGGG - Intronic
999824481 5:155260920-155260942 CAAGCAGCTTCTTCAATGTCTGG - Intergenic
1001957800 5:175860193-175860215 CATACAGCCTCCTTTTGGTCAGG + Intronic
1003638084 6:7852927-7852949 CATGCAGCCCCCTTTTTTTCTGG + Intronic
1008194375 6:48500034-48500056 CAAGAAGCCTCTCTCATGTCTGG - Intergenic
1010327766 6:74585576-74585598 CATGTAGCCTCCTTTATTTAAGG - Intergenic
1011724368 6:90194259-90194281 AATGTACCCTCTTTTATGACAGG + Intronic
1013238606 6:108222105-108222127 TATGCAGCCACTTTTATCTTAGG + Intronic
1018080797 6:160258170-160258192 CATGCAGCTTCTAATTTGTCTGG - Intronic
1018272891 6:162099526-162099548 CCTGTTGCCTCTTTTATGCCAGG - Intronic
1018843273 6:167533934-167533956 CATGCAGCCTTTTCTATGTTTGG - Intergenic
1019122433 6:169813941-169813963 CCTGTAGCCTCTTTAGTGTCTGG + Intergenic
1021385301 7:20022175-20022197 CATGAAGAATCTTTTATGTTAGG - Intergenic
1021545196 7:21805120-21805142 GATGAAGGCTCTTTTATGTAGGG - Intronic
1022317731 7:29261246-29261268 CATGCAGCCTACTTAATGACCGG + Intronic
1026980457 7:74523774-74523796 CTTCCAGCCTCCTGTATGTCTGG + Intronic
1027254601 7:76423145-76423167 CATGCTGCCTCCTTTATGTCTGG - Intronic
1030146866 7:106365833-106365855 CATGCAGCTTCTCTTAGTTCTGG - Intergenic
1037638383 8:20720685-20720707 CATGCAGCCTGGTTTGTGTTGGG - Intergenic
1038609935 8:29051248-29051270 CTTGCAGTTTCTTGTATGTCAGG + Exonic
1040559653 8:48513335-48513357 CATGCACATACTTTTATGTCTGG + Intergenic
1043342115 8:79252614-79252636 AATGCAATCTCTGTTATGTCAGG - Intergenic
1046836454 8:118806907-118806929 CAGTCAGCCTCTTCTATGTGGGG - Intergenic
1047775996 8:128070979-128071001 CATGCTGCCTCTTCTATATAAGG + Intergenic
1047808128 8:128380107-128380129 AAGGCAGCCTCTTTTTTGTTGGG + Intergenic
1047863771 8:128998699-128998721 CATGAAGCCATTTATATGTCTGG + Intergenic
1047950413 8:129929164-129929186 CATACAGTATCTTTTATGTCTGG - Intronic
1048784524 8:138036390-138036412 CTTGCAGGCACTTTTATGTTAGG - Intergenic
1050271381 9:3949436-3949458 CATGTTGACTCTTTTATGCCAGG - Intronic
1050856371 9:10362248-10362270 CATGGAGCTTATTATATGTCAGG + Intronic
1051830318 9:21268610-21268632 CATGCTGCTTCTTTTCTTTCAGG + Intergenic
1052460994 9:28762689-28762711 ATTTCAGCCTCTTTTATGTTAGG - Intergenic
1055333709 9:75210024-75210046 CCTGCAGCATCTTTTATTTGAGG - Intergenic
1059317251 9:113436381-113436403 CATGTCCCCTCTTTTATATCTGG + Intergenic
1059985526 9:119816867-119816889 AAAGCAGCATCTTTTATGGCTGG - Intergenic
1061826959 9:133264190-133264212 GATACATGCTCTTTTATGTCTGG + Intronic
1062024535 9:134334187-134334209 CATCCAGCCTCTTTTTTCCCAGG + Intronic
1187419835 X:19124272-19124294 CATGCAGTCTCATTGCTGTCTGG - Intergenic
1189078310 X:37941482-37941504 CAAGCAGCCTTTTGCATGTCCGG - Intronic
1190284497 X:48953293-48953315 CAAGCAGCCTGTTTTGTGTGAGG - Intronic
1191044971 X:56126558-56126580 CATGCAGATTCTTTTATGTCAGG - Intergenic
1192323260 X:70109590-70109612 CTTACAGTCTCTTTTAAGTCTGG + Intergenic
1202103833 Y:21340287-21340309 CATGCATGCTCTTTTATTTCAGG + Intergenic