ID: 1084808365

View in Genome Browser
Species Human (GRCh38)
Location 11:71595957-71595979
Sequence CTTCTGTGTTTGAAGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 552
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 500}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084808363_1084808365 11 Left 1084808363 11:71595923-71595945 CCAGGCACAGAATAACAAATATT 0: 1
1: 62
2: 452
3: 1986
4: 4996
Right 1084808365 11:71595957-71595979 CTTCTGTGTTTGAAGAAAAAAGG 0: 1
1: 0
2: 2
3: 49
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084808365 Original CRISPR CTTCTGTGTTTGAAGAAAAA AGG Intronic
900384424 1:2403185-2403207 CTACTTTATGTGAAGAAAAAAGG - Exonic
900745046 1:4355347-4355369 CATCTGTGTTTGAATGAACAAGG - Intergenic
901897291 1:12325030-12325052 CTTCTCTTTTTGAAGAGAAAGGG - Intronic
902957970 1:19939627-19939649 CTACTGTGTTTCCAGAAACAAGG + Intergenic
905459009 1:38109162-38109184 CTTCTGAGTTTGAATAAATATGG + Intergenic
907348255 1:53802669-53802691 CTTCTGTATTTTAAGAGACAGGG - Intronic
907675892 1:56517723-56517745 CCTCTGTCTTTGGAGAAAAGAGG + Intronic
908219131 1:61985825-61985847 TTTGTTTGTTTTAAGAAAAATGG - Intronic
908375700 1:63537940-63537962 CTACAGTGTTCCAAGAAAAATGG + Intronic
908931452 1:69320892-69320914 GTGGTGTGCTTGAAGAAAAAGGG + Intergenic
909520853 1:76566050-76566072 ATTCTGTTTTTAAAGAAAAGAGG + Intronic
910276352 1:85453404-85453426 ATTGTGTGTTTGTAGGAAAAGGG - Intronic
910535007 1:88287736-88287758 ATTCTGTTTTTCTAGAAAAAAGG + Intergenic
910564587 1:88629175-88629197 CCTCTGTGGTTGAAGATCAAGGG + Intergenic
910665784 1:89724874-89724896 CTTCTGTGCTGGGATAAAAATGG - Intronic
911294349 1:96096130-96096152 TTTCTGTGTTTGAAGATATGTGG + Intergenic
911332872 1:96545639-96545661 CTTCTGTGTGCAAAGAGAAAGGG - Intergenic
911484253 1:98485841-98485863 CTTCTGTATTTAAAAAAAAAAGG + Intergenic
912255030 1:108049544-108049566 GCTCTGTGGTTGAAAAAAAATGG + Intergenic
912531475 1:110326909-110326931 TTTCTTTTTCTGAAGAAAAAGGG + Intergenic
912603385 1:110963168-110963190 GGTGTGTGATTGAAGAAAAAGGG - Intronic
912781928 1:112558808-112558830 TTACTGTGTTTTAAAAAAAATGG - Intronic
912854592 1:113155930-113155952 ATTCTGTCTCTAAAGAAAAAAGG - Intergenic
913563479 1:120047125-120047147 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
913634644 1:120746452-120746474 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
914284073 1:146206489-146206511 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914441810 1:147714291-147714313 CATCTGTGTTAGAAGCAGAAAGG - Intergenic
914545104 1:148657228-148657250 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914621462 1:149413460-149413482 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
915671081 1:157489593-157489615 TTTCTGGATTTGAGGAAAAAAGG + Intergenic
916756309 1:167773428-167773450 CTTCTGTATTTAATGAAAAAAGG + Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917668481 1:177248877-177248899 GCTCTGGGTTTGAAGCAAAAGGG - Intronic
918115764 1:181496343-181496365 ATTTTGTCTTTGAACAAAAATGG + Intronic
918615425 1:186539096-186539118 CTTCTGTGATTTGAGGAAAAGGG - Intergenic
919116373 1:193285162-193285184 ATCTTGTGTTTCAAGAAAAATGG - Intergenic
919797241 1:201328328-201328350 CTCCTGTGTTTGAGAAACAATGG + Intronic
920505151 1:206510370-206510392 CTTCTTTGTTTAAAAAAAATAGG + Intronic
923984867 1:239370119-239370141 CTTTTGTGCTTGTAAAAAAATGG - Intergenic
924334093 1:242969464-242969486 CTGCTGTGTTTTCAAAAAAAGGG + Intergenic
1062823832 10:554571-554593 CTTCTGTGTCTCAAGAACACGGG - Intronic
1063444704 10:6103956-6103978 CATGTGTGTTTTAAAAAAAATGG + Intronic
1064179059 10:13099711-13099733 CATCTGTGTTTTTTGAAAAAAGG - Intronic
1064332999 10:14411285-14411307 CTGCTTTCTTGGAAGAAAAAAGG - Intronic
1064372565 10:14765601-14765623 CTTCTGTGTTTGTGGAAGGAGGG + Intronic
1064667985 10:17677056-17677078 CTGCTGTGTTTGCACAAACAAGG + Intronic
1064843300 10:19621029-19621051 CTTCTGTCATTGTAGTAAAATGG - Intronic
1065154123 10:22852318-22852340 CTGCTGAGTTTGAGGAAGAAGGG + Intergenic
1068081816 10:52327930-52327952 TTTGTGTGTTTAAATAAAAAAGG + Intergenic
1068567344 10:58590607-58590629 CTTCTGTCTTTCAAATAAAAGGG - Intronic
1068903611 10:62298204-62298226 CTTCTCTTTTTAAAGCAAAATGG - Intergenic
1069403417 10:68074512-68074534 CCTCTGTGTTTTAAAGAAAAGGG - Intronic
1069492202 10:68870709-68870731 ATTCTGTGTTTGAAGATGAAGGG + Intronic
1069663054 10:70136560-70136582 TGTGTGTGTTTGAAGAAACAGGG + Intergenic
1070321354 10:75357116-75357138 CTCCTGTGCTTAAAAAAAAAAGG - Intergenic
1071178469 10:82955208-82955230 ATTCTGTGTCTGAGGAAAGATGG + Intronic
1071529040 10:86375112-86375134 TTTTTGTGTTTTAAGAAACAAGG - Intergenic
1072729926 10:97839031-97839053 CTTCTGTCACTGAAGAAAACAGG + Intergenic
1073165453 10:101445191-101445213 ATTCTGTTTTTCAAGAATAATGG + Intronic
1073690697 10:105805795-105805817 ATTCTGTGCTTGAAGTAAGAAGG - Intergenic
1073950719 10:108806155-108806177 CATATGTGTTTGAAGAGAAAAGG + Intergenic
1074586446 10:114771829-114771851 AGTCTGTGTTTGAAAAAAAGAGG + Intergenic
1075214982 10:120524473-120524495 CTGCTGTGTTTGCAGATAATTGG + Intronic
1075902519 10:126054610-126054632 CTTCAGAGTTGGAAGAACAAAGG + Intronic
1075939148 10:126373721-126373743 TTTCTGTGTTTGTAGTAGAAAGG - Intronic
1076051080 10:127333625-127333647 CTTTTGTTCTTGAACAAAAAGGG - Intronic
1076326890 10:129630971-129630993 GTTTTGTGTTTAATGAAAAAGGG + Intronic
1077604376 11:3598081-3598103 CTTCTATGTAGGAAGAAAAAAGG - Intergenic
1078400702 11:11023942-11023964 GTTGTATGTTTCAAGAAAAATGG + Intergenic
1079240753 11:18720870-18720892 CTTCTGTCTGTGGGGAAAAAAGG + Intronic
1079494892 11:21031043-21031065 CATCTATATTTGAATAAAAAGGG + Intronic
1080399751 11:31922836-31922858 ATTTTATGTTTGAAGAAATAAGG - Intronic
1081045462 11:38268675-38268697 CTTCTATGCCTGAAGAAAAGGGG - Intergenic
1081187159 11:40058029-40058051 CTCCTGTGTTCGCAGGAAAAGGG - Intergenic
1081365746 11:42232950-42232972 CTTCTGTGATTGTATTAAAATGG - Intergenic
1082014471 11:47474269-47474291 CTGATGTGTTTGAAAAAAACAGG - Intronic
1082041788 11:47691969-47691991 GTTATGGGTATGAAGAAAAATGG - Intronic
1082672475 11:56052490-56052512 CTGCTGTCTTTGAAGATAGAAGG + Intergenic
1082700882 11:56429026-56429048 CTTCAGCATTTGAAGAAAATTGG + Intergenic
1082734091 11:56837468-56837490 CTGAGGTGGTTGAAGAAAAAGGG - Intergenic
1082867663 11:57914447-57914469 GTTCAATGTTTGAAGAAAAAAGG - Intergenic
1083084225 11:60125815-60125837 CTCAAGTTTTTGAAGAAAAAAGG + Intergenic
1083946942 11:65928950-65928972 CTTAGCTGTTTGTAGAAAAAGGG + Intergenic
1084226824 11:67720897-67720919 CTTCTATGTAGGAAGAAAAAAGG - Intergenic
1084260268 11:67972678-67972700 CTTCTATGTAAGAAGAAAAAAGG - Intergenic
1084308255 11:68300455-68300477 CTTCAGTACTTGAAGCAAAATGG - Intergenic
1084351960 11:68608501-68608523 CTTCTTTGTAGGTAGAAAAATGG + Intronic
1084718239 11:70887620-70887642 CTTCTGTGTTTGGGAAACAAAGG + Intronic
1084808365 11:71595957-71595979 CTTCTGTGTTTGAAGAAAAAAGG + Intronic
1084812503 11:71622571-71622593 CTTCTATGTAGGAAGAAAAAAGG + Intergenic
1084845472 11:71895966-71895988 CTTCTATGTAGGAAGAAAAAAGG + Intronic
1085866560 11:80301666-80301688 ATTCTCTCTTTGAAGCAAAAAGG + Intergenic
1086003484 11:82007956-82007978 ATTCTGTGTTAAAAGAGAAAAGG - Intergenic
1086124928 11:83340616-83340638 ATTCTGGGTTTGGAGAACAATGG - Intergenic
1086449841 11:86905086-86905108 CATCTGTTTTTGAAAATAAATGG - Intronic
1086599550 11:88616061-88616083 TTTCTGTGCCTGAAAAAAAATGG + Intronic
1086996066 11:93357555-93357577 CTTCTTTGTGTGAAGATACAGGG - Intronic
1087397913 11:97625929-97625951 CTTCTGACTTTGAAGAAGTAAGG - Intergenic
1087888970 11:103514909-103514931 TTTCTCTTTTTGCAGAAAAAGGG - Intergenic
1088389819 11:109301559-109301581 CTTCTGTGTTGGAATTGAAAAGG - Intergenic
1088489836 11:110376083-110376105 TTTATGTGTTTGATGGAAAAAGG - Intergenic
1089234597 11:117012608-117012630 TTTCTATGTATGGAGAAAAATGG - Intronic
1089644695 11:119871081-119871103 TTTCTGTGTTTGAGGAGCAAAGG + Intergenic
1089917153 11:122169048-122169070 CTTCTGTATCTGAAGACAAAAGG - Intergenic
1092262355 12:6959496-6959518 CGTCAGGGTTTGAAGGAAAAGGG + Intronic
1092287670 12:7138263-7138285 CTTCTGGATTTAAAAAAAAAAGG + Intronic
1092431529 12:8413232-8413254 CTTCTATGTAGGAAGAAAAAAGG - Intergenic
1092434484 12:8435849-8435871 CTTCTATGTAGGAAGAAAAAAGG - Intergenic
1093095228 12:14964245-14964267 GTCCTGAGTTTGAAAAAAAATGG + Intergenic
1093190863 12:16073611-16073633 ATTTTGTGGTTGAAGAACAATGG - Intergenic
1093259987 12:16923931-16923953 ATACTGTGTTTCAAGGAAAATGG + Intergenic
1094290677 12:28845598-28845620 CTACTGAGCTTGAAGAAATATGG - Intergenic
1095425895 12:42074494-42074516 CTGCTTGGTTTGAAGAGAAAGGG + Intergenic
1095511871 12:42959913-42959935 CCTCTTTGTCTGAAGAACAATGG + Intergenic
1095913000 12:47447907-47447929 CTTATTATTTTGAAGAAAAAGGG - Intergenic
1096269034 12:50149025-50149047 CTACTGTTTTAGAAAAAAAATGG - Intronic
1098712971 12:73790461-73790483 CTTCATTTTTTGAAGGAAAATGG + Intergenic
1099594823 12:84647587-84647609 TTTCTAATTTTGAAGAAAAATGG + Intergenic
1100390576 12:94143067-94143089 CTTCTGGGTCTCAAGCAAAAGGG + Intergenic
1100891094 12:99126776-99126798 CTTCTTTGTTTTTAGAAATAAGG - Intronic
1100994322 12:100286458-100286480 TTTCTTTTTTTCAAGAAAAAAGG - Intronic
1101267016 12:103099721-103099743 CTTCTGTATTTCAAGCAAATAGG + Intergenic
1101482349 12:105110175-105110197 TTTATGTGGTTGAAGAATAAAGG + Intronic
1101950369 12:109169874-109169896 CTTCTGTGTTTGATAAACATAGG + Intronic
1102097071 12:110249400-110249422 CTGCTGTGTCTAAAGAAACACGG - Intergenic
1102892493 12:116571210-116571232 CTTCTGTGGTTGAGGAAAGGTGG + Intergenic
1103808750 12:123595854-123595876 TTTCTGTTTTTGTAGAGAAAGGG - Intronic
1104160012 12:126169070-126169092 CTGGTGTGTGTGTAGAAAAAAGG - Intergenic
1104166426 12:126234639-126234661 CTTTTTTGTATGAAGGAAAAAGG - Intergenic
1104402875 12:128491271-128491293 CTATTGTATTTCAAGAAAAATGG - Intronic
1104731955 12:131111803-131111825 ATTCTGTGTTTGATGAGACAGGG + Intronic
1105928018 13:25025356-25025378 CTTCTGTGGTCTAAGAAGAAAGG - Intergenic
1106886950 13:34197198-34197220 CTTCTGTGGTAGTTGAAAAAAGG + Intergenic
1107212917 13:37879226-37879248 CTGATGTGTCTGAAGAACAAAGG - Intergenic
1108198614 13:48020146-48020168 TTTCTGTGTATGCAGACAAAAGG - Intergenic
1109005551 13:56870880-56870902 GTTCTGTGTTTGGAAGAAAATGG - Intergenic
1109915000 13:68971941-68971963 CTTCTGTTTTTAAATAAGAATGG - Intergenic
1110146640 13:72199978-72200000 CTGCTGTTTTTGAAAAACAAAGG - Intergenic
1111339658 13:86866978-86867000 TTTGTATGTTTAAAGAAAAAGGG + Intergenic
1111576420 13:90160352-90160374 ATTCTGAATTTGAGGAAAAATGG - Intergenic
1111620812 13:90723088-90723110 CTTCTGTGTTTAAAAATAATAGG - Intergenic
1111840607 13:93445512-93445534 CTTCTCTATTTTAAGAGAAATGG + Intronic
1111865126 13:93758723-93758745 CTATGGTGTTTGAAGAGAAAGGG - Intronic
1112845154 13:103633560-103633582 ATTCTGTGTTTGAATAATATTGG - Intergenic
1113243447 13:108366637-108366659 CTTTTGTGTTTGAAATATAAGGG - Intergenic
1114309659 14:21455583-21455605 CTTCTGTATTTTAATAATAAAGG - Intronic
1115710474 14:36045193-36045215 CTTCTGTATTTTTTGAAAAATGG + Intergenic
1115880699 14:37914440-37914462 CTTTTGTTTTTCAAGGAAAAAGG + Intronic
1116510086 14:45734333-45734355 TTTCTGTGTTTGGACAAAATAGG + Intergenic
1116552097 14:46254039-46254061 CTACTCTGTTTCAACAAAAAAGG + Intergenic
1116614759 14:47120514-47120536 CTTCTGTTCCTGAAGAAAATAGG - Intronic
1117039787 14:51759521-51759543 CTTCTATGTAGGAAGAAAAAAGG + Intergenic
1117861850 14:60100244-60100266 CGTGTGTGTGTGCAGAAAAATGG - Intronic
1119358559 14:74028057-74028079 TATCTATTTTTGAAGAAAAAGGG - Intronic
1120085676 14:80269949-80269971 CTTCTTTGGTTGTAGCAAAAAGG - Intronic
1120211182 14:81635491-81635513 CTTATTTTTTTTAAGAAAAATGG - Intergenic
1120654633 14:87174988-87175010 CTTCTATTTTTAAAGAAATAGGG - Intergenic
1120727780 14:87964639-87964661 CTTTTGTGTTTCAATAAAAACGG + Intronic
1120823533 14:88934817-88934839 CCATTTTGTTTGAAGAAAAAGGG + Intergenic
1120944500 14:89981514-89981536 CTTCTGTGTTGGGAGAAACTCGG + Intronic
1122465330 14:101929685-101929707 CTTCTGCATTTAAAGGAAAAAGG + Intergenic
1123111479 14:105869580-105869602 CAACTGTTCTTGAAGAAAAAAGG - Intergenic
1124868127 15:33514145-33514167 CCTCTGTGATTGAAGAGGAAAGG + Intronic
1126393081 15:48179971-48179993 CTACTCTGTTTGAAGCATAAAGG - Intergenic
1126409591 15:48358591-48358613 CTGCTGTGTTTAAACAAAAATGG + Intergenic
1127153656 15:56105839-56105861 CTCATGTTTTTAAAGAAAAAAGG + Intronic
1127345042 15:58086263-58086285 CTTCTGTATTTCATGTAAAATGG + Intronic
1127968410 15:63941092-63941114 CTTCAGTGCTTTAAGAAACAGGG - Intronic
1128193010 15:65722180-65722202 ATTCTGTGTATGAAAAAAATAGG + Intronic
1128287912 15:66453689-66453711 CTTCTGTCCTTGAGGAAAAGTGG + Intronic
1128385690 15:67146774-67146796 GGTCAGTGTTTGTAGAAAAAAGG + Intronic
1130192595 15:81750751-81750773 CTGCTGTTTTTGCAGAACAAGGG - Intergenic
1130583106 15:85155954-85155976 CTTCTTTCTTTGAAGAAGATGGG - Intergenic
1131588615 15:93722856-93722878 CTGCTCAGTTTAAAGAAAAAAGG - Intergenic
1131936828 15:97515511-97515533 CTCCTTCTTTTGAAGAAAAAGGG + Intergenic
1132189975 15:99845975-99845997 GTTTTGTTTTTGTAGAAAAAGGG + Intergenic
1132261899 15:100433292-100433314 CTTCTGGGGCTGAAGAACAATGG + Intronic
1133044606 16:3080731-3080753 CTTATTATTTTGAAGAAAAAGGG - Intronic
1133231043 16:4366713-4366735 CTTCTATTTTTGTAGAAACAAGG + Intronic
1133365473 16:5205700-5205722 CTTGCATATTTGAAGAAAAAGGG + Intergenic
1134845047 16:17433107-17433129 CAGCTGTGTTAGAAAAAAAAAGG + Intronic
1135132099 16:19861648-19861670 ATTCTGTGTGTGGAGAAAAGGGG + Intronic
1135959340 16:26982822-26982844 CTTGGGTGTTAGAAGCAAAATGG - Intergenic
1137258752 16:46803066-46803088 TTTCTCTGTTAAAAGAAAAAGGG + Exonic
1137837671 16:51608667-51608689 CTTATCTGTTTGAATAAAAAGGG + Intergenic
1138574320 16:57897795-57897817 GATCTGTGTTTGGAGAAATAAGG - Exonic
1139261869 16:65601899-65601921 CTTTTGTGGCTGAAGAAAAGTGG + Intergenic
1139701518 16:68710835-68710857 ATTCTGTCTCAGAAGAAAAAAGG + Intronic
1140286776 16:73610360-73610382 CATATGTGTTTGAAGAAAAGGGG - Intergenic
1140580911 16:76230045-76230067 CTTCTGTGATCAAAGGAAAATGG + Intergenic
1140713809 16:77703506-77703528 ATTCTGTCTTTCAAGAAAAATGG + Intergenic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1143763784 17:9124153-9124175 CTGCTGATTTTTAAGAAAAATGG - Intronic
1144066829 17:11631819-11631841 CATGTGTGTGTGAAAAAAAAAGG - Intronic
1144188857 17:12824600-12824622 CTACTGTGTTAGAAGCAAAGTGG - Intronic
1144245918 17:13364468-13364490 CTTGCGTGCTTTAAGAAAAATGG - Intergenic
1144537985 17:16110569-16110591 CTTCTGTGTTTGCAGACCCAGGG + Intronic
1145201163 17:20946072-20946094 CTTGTGAGTTTGCAGAGAAAAGG - Intergenic
1146250768 17:31341855-31341877 CTTTTGTCTTTGGATAAAAATGG + Intronic
1146297665 17:31662263-31662285 CTTCTATCTGTGAACAAAAAAGG - Intergenic
1146342566 17:32033451-32033473 TTACTCTGTATGAAGAAAAAAGG - Intronic
1146525052 17:33560038-33560060 CTTTGGTGATTGAAAAAAAATGG - Intronic
1146774903 17:35605252-35605274 CTCCTGTGTCTAAAAAAAAAAGG - Intronic
1149303151 17:55324135-55324157 CTGTTGTATTTGAAGACAAAAGG - Exonic
1149744251 17:59079679-59079701 ATTCAGTCTTTGAAGAATAAGGG - Intronic
1150603598 17:66672164-66672186 CTTCTCTGTTTCTAGAAGAATGG + Intronic
1152308946 17:79537623-79537645 TTTCTGCCTTTGAACAAAAACGG + Intergenic
1153686237 18:7548558-7548580 ATTCTGTGTTTGAAAAGTAAAGG + Intergenic
1153837300 18:8975632-8975654 CTTCTTTGGATGAAGAAAGAGGG - Intergenic
1154253120 18:12760819-12760841 CTTCTCTTTTTTAAAAAAAATGG - Intergenic
1156075474 18:33273104-33273126 CATCTGTATTTGCAGATAAAAGG + Intronic
1156730093 18:40183153-40183175 CTTCTTTTTTTTAAAAAAAAAGG - Intergenic
1156883242 18:42105455-42105477 CTAGTGTTTTTGCAGAAAAATGG + Intergenic
1158796563 18:60853285-60853307 ATTACGTGTTTCAAGAAAAATGG + Intergenic
1159548113 18:69866372-69866394 CTTCTGGGTTTGCAGATAAGAGG - Intronic
1161841518 19:6684432-6684454 CTTCTGTGTTTCTAGAAAAGAGG - Exonic
1165285744 19:34839982-34840004 GATCTGAGTTTGAAGCAAAAAGG - Intergenic
1165659703 19:37566424-37566446 CTTGTGCCTTTAAAGAAAAATGG - Intronic
1165906251 19:39196579-39196601 CTTCTGGGTCTGAAGAAGGAGGG + Intergenic
1168280386 19:55302452-55302474 CTTCTGGGTCTGAAGAAGGAGGG + Intronic
925803377 2:7624722-7624744 CTTCTCTGTCTAAAGAAAACAGG + Intergenic
926014758 2:9440634-9440656 CTAATGTGTTTGAAAACAAAGGG - Exonic
926278846 2:11427848-11427870 TTTCTTTTTTTGAAGAAAAATGG + Intergenic
927085249 2:19668863-19668885 ATGCTGTGGTTGGAGAAAAAAGG + Intergenic
927672843 2:25083288-25083310 CTTCTGTTTTAGAAATAAAATGG + Intronic
928287825 2:30008776-30008798 CTAGTGTCTTTGGAGAAAAAGGG - Intergenic
929305618 2:40357959-40357981 CTGATGTGTTTGTATAAAAAGGG + Intronic
930317030 2:49810564-49810586 CCACTGTGTTTAATGAAAAATGG - Intergenic
930364815 2:50425886-50425908 TTTCTGTTTTTGAAGAATACCGG - Intronic
930816517 2:55603896-55603918 CTAATATGTTTGAAGTAAAAAGG + Intronic
931323255 2:61193421-61193443 ATTCTATCTTTGAAGAAAGAAGG - Intronic
931614786 2:64144540-64144562 GTTCTCCGGTTGAAGAAAAAAGG + Intergenic
931959968 2:67471425-67471447 CTTGTGTGTTTGAAGACTAGGGG - Intergenic
932174451 2:69586735-69586757 TTTCTGTGTCTAAAGAACAATGG - Intronic
932292296 2:70592782-70592804 CTTATGTGTTTTAAGTGAAAAGG + Intergenic
932492530 2:72131342-72131364 CTTCTGTGAGTGAAGAGGAAGGG - Exonic
934760689 2:96854677-96854699 CTTCTGTGTTTGAAGTGGGATGG - Intronic
935384883 2:102489490-102489512 CTTCTGAACTTGAAGAAAGATGG - Intronic
936114482 2:109691172-109691194 CAAGTGTGTTTAAAGAAAAATGG + Intergenic
936806594 2:116340106-116340128 TTTCTGAGTGTGAAGAAAGAGGG + Intergenic
937468685 2:122156747-122156769 CTTCTCTTTTTGAAGATAATTGG + Intergenic
937880435 2:126860320-126860342 GTTCTGTTGTTAAAGAAAAAGGG - Intergenic
938746455 2:134282946-134282968 CTTCTGTATTAGAATTAAAAGGG - Intronic
939007076 2:136801612-136801634 CATCTGTATTAGAAGAAAAATGG + Intronic
939418252 2:141929473-141929495 CTTCTGTCTTTTAAAAAAAATGG - Intronic
939488383 2:142846425-142846447 CCTCTGTGTTTGGTGAAATATGG - Intergenic
939693931 2:145300227-145300249 CTTCTTTGTTTAAAGTAACATGG - Intergenic
939910934 2:147982136-147982158 CTTCTTTCTTAGAAGAAAAGTGG + Intronic
940190373 2:151034604-151034626 CTTTGGTGTTTTAAAAAAAAGGG + Intronic
940870476 2:158856120-158856142 CTTCTATGTAGAAAGAAAAAAGG + Intronic
940927886 2:159387634-159387656 TTCCTGTGGTTCAAGAAAAAGGG - Intronic
940992128 2:160108360-160108382 CTTCTGTCTATAAAGAAAGAAGG - Intronic
941062558 2:160864550-160864572 CTAATTTGTTTGAAGAATAAGGG + Intergenic
941398345 2:164999533-164999555 GTTCTGGATTTGAACAAAAATGG + Intergenic
941638887 2:167966387-167966409 CTTTTATGTTTTAAGAAAATGGG - Intronic
942481009 2:176388117-176388139 CTTCTTTGTTTGCAGGAACATGG + Intergenic
943720356 2:191197795-191197817 CTTTTGTGTCTGAAGCAAATGGG + Intergenic
943757955 2:191577100-191577122 CTTCTGTATTTTAAAATAAATGG + Intergenic
944981087 2:205120734-205120756 CTTCTGAGTTTCAAGAAATAGGG + Intronic
945571906 2:211478815-211478837 GTTTTGTTTCTGAAGAAAAAAGG - Intronic
946133635 2:217627702-217627724 CTTCTGCCTTTGAAATAAAATGG + Intronic
946198195 2:218051790-218051812 CTTCTATGTTTGAAACAGAAAGG + Intronic
947111682 2:226725423-226725445 ATTCTGTGATTGCAGAGAAATGG - Intergenic
947430855 2:230026416-230026438 ATTCAGAGTTTAAAGAAAAAAGG + Intergenic
947783808 2:232796232-232796254 CTTCAGTATTTAAAGGAAAAAGG - Intronic
947862381 2:233369863-233369885 CTTCTGTGTCTGAGGGTAAAGGG + Intronic
948156279 2:235785218-235785240 CTTCTCACTTTTAAGAAAAATGG - Intronic
1168769109 20:402958-402980 CCTCTGTATTTGAAGAAATCCGG + Intergenic
1170046122 20:12087338-12087360 CTTCTGTGTATTAAAAAGAAAGG + Intergenic
1170133507 20:13048930-13048952 CTTTTGTGTTTTCAGCAAAATGG + Exonic
1170278388 20:14618710-14618732 CTTCTGTGGTTGCAGAAATCTGG - Intronic
1170800341 20:19585086-19585108 CTTCACTGTCTGAAGGAAAAGGG + Intronic
1171144437 20:22769303-22769325 CATCTGTGTGTGAAGAAGCATGG + Intergenic
1172925069 20:38526483-38526505 CTGATGTGTTTGAGAAAAAAAGG - Intronic
1173993573 20:47321022-47321044 CTTCTGGGTTTGCAGAGACATGG + Intronic
1174004908 20:47402866-47402888 CTTCTGTTATTAAAGAAAGAAGG - Intergenic
1174436323 20:50509912-50509934 CTCCTGAGTTTCATGAAAAAAGG + Intergenic
1174946133 20:54987749-54987771 CTTTTTTGTTTTAAGAAACAGGG - Intergenic
1175026481 20:55907858-55907880 TTTCTGTGTTTGTTGGAAAAGGG - Intergenic
1175089664 20:56491827-56491849 TTTCTGTGTGTGAATAAAATGGG - Intronic
1175301043 20:57942932-57942954 TTTCTGTGTTAGAAATAAAAAGG + Intergenic
1176990783 21:15493923-15493945 CTTGTGTGGTTGAGGTAAAATGG - Intergenic
1177287201 21:19066869-19066891 CTCCTTTTTTTGAAGCAAAAGGG - Intergenic
1177917819 21:27112618-27112640 CTTCTTTGTGTGAGGAGAAAAGG + Intergenic
1178049655 21:28733650-28733672 CTCCTGTGTGTGAAAAAAATGGG - Intergenic
1178085710 21:29110153-29110175 ATTTTGTGTTTAAAGAAAAATGG - Intronic
1178609750 21:34070741-34070763 CTTCTGTGCTTGTTAAAAAAAGG + Intergenic
1181312724 22:21953975-21953997 CCTCTGTGTTGGCAGAAAAATGG - Intergenic
1182289969 22:29269093-29269115 CCTCGGCGTTTGCAGAAAAAGGG - Intronic
1182394857 22:30027912-30027934 CTTCTGTGTGAGAGGGAAAAGGG - Intronic
1183174737 22:36214570-36214592 CTTATGTATTTAAAGCAAAATGG + Intergenic
1184924959 22:47630348-47630370 CCTCTGTGGCTGAAGAAGAAGGG - Intergenic
949210587 3:1494932-1494954 CCTCTGTGCTTCATGAAAAAAGG + Intergenic
949259631 3:2090425-2090447 ATTCTGTATTTGAAGCAACATGG + Intergenic
951362005 3:21736537-21736559 CTTCTGGTTTTGAAGCAGAAGGG + Intronic
951380724 3:21981201-21981223 CTTGTGAGGTTGCAGAAAAATGG - Intronic
952324847 3:32311963-32311985 CTTCAGCTTTTAAAGAAAAAAGG + Intronic
952719288 3:36515456-36515478 CTTCAGTGTTTGAAGGGGAAAGG + Intronic
953036497 3:39216184-39216206 CATTTATATTTGAAGAAAAAGGG - Intergenic
953508260 3:43507814-43507836 GGTCTGGTTTTGAAGAAAAAGGG + Intronic
953619286 3:44518964-44518986 CTGCTCTGTATGCAGAAAAAAGG - Intergenic
955651712 3:61201878-61201900 TTTCTGTGTTTGAAGTGGAAAGG - Intronic
955747775 3:62157049-62157071 CTTCTCTGTTTGGGGAAAAAGGG - Exonic
955858645 3:63302293-63302315 CTTCTCTGTCTGAAGGATAATGG - Intronic
956657135 3:71563301-71563323 CTTCTGAGTTTAACAAAAAAGGG + Intronic
956703429 3:71979156-71979178 CTAGTGTTTTTAAAGAAAAAAGG + Intergenic
957075223 3:75597092-75597114 CTTCTATGTAGGAAGAGAAAAGG - Intergenic
957264948 3:77951101-77951123 CTTCTGCATTTGAGTAAAAAAGG + Intergenic
957351162 3:79023436-79023458 CTACTGTGTTTCAAGAAACGAGG + Intronic
958040615 3:88221902-88221924 ATTCTTTGTTGGAAGAACAAAGG + Intergenic
958183761 3:90092254-90092276 CTTCTGTCTATGGAGAAAGAAGG + Intergenic
958564353 3:95789144-95789166 ACACTGTGTTTGAAGAAACATGG - Intergenic
958726892 3:97916863-97916885 CTTGTCTGTTGGAGGAAAAATGG + Intronic
958785175 3:98590088-98590110 CTTCTATGTTGGAGGAAATATGG + Intronic
959597564 3:108144555-108144577 CTTTTTTGTTTTAAGAATAAGGG - Intergenic
961090599 3:124107888-124107910 CTTCTGTGTTTGGACAGAATGGG + Intronic
961275966 3:125727053-125727075 CTTCTATGTAGAAAGAAAAAAGG + Intergenic
961278878 3:125749631-125749653 CTTCTACGTAGGAAGAAAAAAGG + Intergenic
961731124 3:128965618-128965640 CTTCTGTTTTTAAAGTCAAAAGG + Intronic
961800201 3:129441748-129441770 CGGCTGTGTTTCAAGAAAAATGG - Intronic
961875517 3:130019987-130020009 CTTCTATGTAGAAAGAAAAAAGG - Intergenic
962433248 3:135339793-135339815 CTTCTGGCTTTGAAGATGAAGGG + Intergenic
963407744 3:144889339-144889361 CTTCTATGTTTAGAAAAAAAGGG + Intergenic
963866320 3:150365632-150365654 ATTCTGTCTTTTAAAAAAAATGG - Intergenic
963903695 3:150756372-150756394 CTTATGGGTTTGAATAAGAACGG + Intronic
964466390 3:156997797-156997819 CTTCTGAATTTGGAGAAATAAGG + Intronic
965173841 3:165303880-165303902 CATCTCTCTTTAAAGAAAAATGG - Intergenic
965258626 3:166449775-166449797 CTTTTGTGTTTGTAGAAATATGG - Intergenic
965331187 3:167376791-167376813 TTTCCTTGTATGAAGAAAAAGGG + Intronic
966139352 3:176737294-176737316 CTTATGAGTTTAAAGAAACATGG - Intergenic
967631330 3:191745578-191745600 CTTCTGGGACTGAACAAAAATGG + Intergenic
967684004 3:192398696-192398718 TTTCTGTCTTTGAAAAACAAGGG - Intronic
968987875 4:3887745-3887767 CTTCTATGTAGGAAGAAAAAAGG - Intergenic
969018819 4:4124731-4124753 CTTCTATGTAGGAAGAAAGAAGG - Intergenic
969023514 4:4154928-4154950 CTTCTATGTAGGAAGAAAAAAGG - Intergenic
969730299 4:8952153-8952175 CTTCTATGTAGGAAGAAAGAAGG + Intergenic
969786475 4:9461783-9461805 CTTCTATGTAGGAAGGAAAAAGG + Intergenic
969789901 4:9486265-9486287 CTTCTATGTAGGAAGAAAAAAGG + Intergenic
969794385 4:9515431-9515453 CTTCTATGTAGGAAGGAAAAAGG + Intergenic
970586674 4:17521050-17521072 CTACTGTGTCTGAAACAAAAAGG + Intronic
971297573 4:25411369-25411391 CTTACGTGTTTGAATAAGAAAGG + Intronic
971350020 4:25847136-25847158 CTTTGGAGTTTGAAGACAAAAGG - Intronic
972010617 4:34176487-34176509 CTTGTGTGGTTGCAGAGAAAAGG + Intergenic
972121019 4:35702753-35702775 CTGCTGTGTTTGCATAAACATGG - Intergenic
972168197 4:36312698-36312720 CTTGTGTGTATGAGGAACAATGG + Intronic
972438720 4:39062264-39062286 CATTTGTGGTTTAAGAAAAAGGG + Exonic
974212884 4:58804664-58804686 ATTCTGTTTTCTAAGAAAAAAGG - Intergenic
977282187 4:95054600-95054622 CTACTATGTTTGGAGAATAAAGG - Intronic
977742778 4:100506470-100506492 CATATATGTTTGTAGAAAAAAGG + Intronic
978162061 4:105560883-105560905 CTTCTGTGTTTGTTGTGAAATGG + Intronic
978332536 4:107630040-107630062 CTTTTTTGACTGAAGAAAAATGG - Intronic
978352108 4:107830894-107830916 CTTCTGTGTTTGGAGAAGCTTGG - Intronic
978725574 4:111965541-111965563 CCTATGTTTTTGAAGAAAAGAGG + Intergenic
979243016 4:118465816-118465838 CTGCTGTGTTTTCAGTAAAAGGG - Intergenic
979298342 4:119057690-119057712 CTTCTGGGTTTGAGGAATATAGG - Exonic
979428905 4:120603076-120603098 TTTCTGTGTTTGAAGATGGAAGG - Intergenic
979618205 4:122768512-122768534 CTTCAGTGCATGAAAAAAAATGG + Intergenic
980161871 4:129174074-129174096 CTTCTGAATTTGAAGATTAAGGG - Intergenic
980169273 4:129268367-129268389 CTTCTGAGTTGGAATAAAGATGG - Intergenic
980341806 4:131559839-131559861 TATATATGTTTGAAGAAAAATGG + Intergenic
980576835 4:134693910-134693932 CTTCTATGCCTGAAGAAAGAGGG - Intergenic
981471507 4:145140798-145140820 CTTCTGTGTTTTTACATAAATGG - Intronic
981640565 4:146939107-146939129 CTTCTGTTTTGGAAGAAGGAGGG - Intronic
982059559 4:151591182-151591204 CTTATGTGGTTGATGAAGAAAGG + Intronic
982943766 4:161592077-161592099 CTACCAGGTTTGAAGAAAAAAGG + Intronic
983512384 4:168622519-168622541 CTTCTGGGCTGAAAGAAAAAAGG - Intronic
985071650 4:186171503-186171525 TTTCTGTGATAGAAAAAAAAAGG + Intronic
985096326 4:186416334-186416356 CTCCTGTTTTTGAGGAGAAAAGG + Intergenic
985254047 4:188052340-188052362 CTTCAATATTTCAAGAAAAAGGG + Intergenic
985255172 4:188062984-188063006 GTTGTGTGTTTGAAGAACAGGGG + Intergenic
986050146 5:4082587-4082609 CTTCAGTGTGGGAAGAAACATGG + Intergenic
986085990 5:4447453-4447475 TTACTGGGTTTGAAGATAAAAGG + Intergenic
986102729 5:4629019-4629041 AGTTTGTGTTTGAAGAAAGAAGG - Intergenic
986159260 5:5210212-5210234 CTTCTGTTTGTTAAGGAAAATGG + Intronic
989107132 5:37873787-37873809 CTTCTCTGGTTGAAGCAAAATGG + Intergenic
989147455 5:38262823-38262845 CTTCTGTTTATCAAGAGAAATGG - Intronic
990335777 5:54771186-54771208 CCTCTGTGTTTGAACGGAAATGG + Intergenic
990460626 5:56027997-56028019 CTCCAGTTTTTAAAGAAAAAAGG + Intergenic
990824929 5:59888295-59888317 CTTCTGTGTTTCATGGAAATGGG - Intronic
990939958 5:61192040-61192062 CTGCTGTGTTTTGAGAAATATGG - Intergenic
991254103 5:64595862-64595884 TTTCTGTGTTTATAGAAAATTGG + Intronic
991696857 5:69281081-69281103 CTGCTGTGTATGAAAACAAATGG - Exonic
992839831 5:80677391-80677413 TTTCTCTGATTAAAGAAAAAGGG + Intronic
993145888 5:84093421-84093443 CTTCTACCTTTGAAGATAAAAGG + Intronic
993920767 5:93798317-93798339 CTTTTTTGTTTGAGGAGAAAGGG - Intronic
994129601 5:96210273-96210295 ATTCTGTGTTAGAAAAAAATTGG - Intergenic
994150888 5:96446404-96446426 TTTCTGTGTTTGCAGAAAGGAGG + Intergenic
994240454 5:97413740-97413762 CTTCTGTTTGTAAAGAACAAAGG - Intergenic
994491851 5:100457875-100457897 CTACTGTCTTGGAAGAAATAAGG + Intergenic
994519849 5:100819594-100819616 CTTCTGCGTCTGAAGAATACTGG - Intronic
995655051 5:114416992-114417014 CTCCTGTTTTTGAACAAAACTGG + Intronic
995663356 5:114511172-114511194 CTTCCATGTTTAAATAAAAAAGG + Intergenic
995842963 5:116462109-116462131 CTTCTGTGTTGGGAGAACCAGGG + Intronic
996140130 5:119896963-119896985 CTGCTGTCTTTGAAGACAGAAGG - Intergenic
996376037 5:122808316-122808338 CCACTGAGTTTGTAGAAAAACGG + Exonic
996597309 5:125220184-125220206 CTTTTGTGCTTGATGAAAGAAGG - Intergenic
997757497 5:136413273-136413295 TTACTGTGTCTGATGAAAAAAGG + Intergenic
998535298 5:142924807-142924829 CTTGAGTATTGGAAGAAAAAGGG + Intronic
998773651 5:145573918-145573940 ATTCTGTGTGGGCAGAAAAAGGG + Intronic
999110160 5:149112560-149112582 CTTCAGCGTTTTAAGAAAATGGG - Intergenic
999225868 5:150023910-150023932 CTTCTGTGTGTCTAGAAAGAGGG - Intronic
999342825 5:150787818-150787840 ATCCTGTGTTTGAGGAAATAAGG + Intronic
999936957 5:156497216-156497238 CTTCTGTTATTGAGGAAAGATGG + Intronic
999991892 5:157057616-157057638 CCTTTGTGTTTAAACAAAAAGGG - Intronic
1000381256 5:160631589-160631611 CATGTGTGTTTGAAGAAAAATGG - Intronic
1002157358 5:177293817-177293839 CTTCTGTGTTTTCAGGGAAATGG + Exonic
1003859920 6:10313299-10313321 TTTCTGTGCATGAAGAGAAAAGG - Intergenic
1004254641 6:14051752-14051774 CTTCTGTGTTTTGAGAAGCAGGG - Intergenic
1004804613 6:19189184-19189206 CTTCAGTGTCTGAAGATAACAGG - Intergenic
1005161848 6:22873132-22873154 ATTCTGTATATGAAGTAAAAAGG - Intergenic
1005532395 6:26721271-26721293 CTTCAGTGTTTCACGACAAAGGG + Intergenic
1005538400 6:26780394-26780416 CTTCAGTGTTTCACGACAAAGGG - Intergenic
1005608663 6:27501838-27501860 GTTATCTGTTTGAAGAAATAAGG - Intergenic
1006796738 6:36736986-36737008 CTTGTGTGTTTGAAACAGAATGG + Intergenic
1008275761 6:49542467-49542489 CTTCAGGGATTGAAGAAGAAGGG + Intergenic
1008812401 6:55519297-55519319 GTTCTGTGGTAGAAAAAAAATGG + Intronic
1008906814 6:56686813-56686835 CTTCTGTTTCTGGAGAAAAGAGG - Intronic
1009009255 6:57822744-57822766 CTTCAGTGTTTCATGACAAAGGG - Intergenic
1009317753 6:62243027-62243049 CCTCTGTGTCTGAAGCTAAAAGG + Intronic
1010398604 6:75422020-75422042 TTTCTGTGATTGAAGTAAAAAGG - Intronic
1011581518 6:88871976-88871998 CTTCAGTGTAAGAAAAAAAATGG - Intronic
1012512259 6:100015546-100015568 TCTCTGTGTTTGAAGCAACAAGG + Intergenic
1012544147 6:100397231-100397253 CTTCTGAGTTTGAAGGATAATGG + Intronic
1012848441 6:104418904-104418926 TTTATGTGTTTGCATAAAAATGG - Intergenic
1012961475 6:105626670-105626692 CTTGTGTGTCTGAAGTAAGAAGG + Intergenic
1013365475 6:109434381-109434403 TTTCTTTGTTTGTAGAAACAGGG - Intronic
1014042286 6:116842540-116842562 TTACTGTCTTTGAAGACAAATGG - Intergenic
1014304239 6:119720488-119720510 CTTATGTATGTTAAGAAAAATGG - Intergenic
1014604730 6:123458852-123458874 TTTCTGTGATTAAAAAAAAAGGG + Intronic
1014790637 6:125668170-125668192 CTTCAGTGTTGGAAGTACAAGGG - Intergenic
1014823572 6:126021608-126021630 GTTCTGCTTTTGGAGAAAAATGG - Intronic
1015068670 6:129061915-129061937 CTACTGTGTGTGTAGAAGAAGGG + Intronic
1015334326 6:132020173-132020195 CTTCTGTGTCTGAGGACACACGG - Intergenic
1015834624 6:137406784-137406806 CTTCTGAGGTTGCAGAGAAAAGG - Intergenic
1015855945 6:137624803-137624825 CTTCTCTGCTTGAAGAGAAAGGG - Intergenic
1016231581 6:141812008-141812030 CTTCTGTGATTGAAGCAGAGGGG + Intergenic
1016429920 6:143972834-143972856 CTTCTGTGTTTAAAAAAAGAGGG + Intronic
1016525557 6:144998149-144998171 CTTCTGAGCTTAAAGAAAAAAGG + Intergenic
1016603000 6:145884322-145884344 TATCTGGGTTTGAAGCAAAAAGG + Intronic
1016774110 6:147885415-147885437 ATTTTGTTTTTAAAGAAAAAAGG - Intergenic
1016964214 6:149703313-149703335 CATCTGTTTTTGAAGCATAAAGG - Intronic
1017685741 6:156912569-156912591 CTTTTGGGTTTGAAGACAGAGGG - Intronic
1020310619 7:6865097-6865119 CTTCTATGTAGGAAGAAAAAAGG - Intergenic
1021288967 7:18820491-18820513 TTTATGTGTTTTAAGAAAGAAGG + Intronic
1021591586 7:22269484-22269506 CTTCTGTCTTTGTATAAATAGGG - Intronic
1022341773 7:29475221-29475243 CTTCTTTTTTTGATGAATAAAGG - Intronic
1023044360 7:36198186-36198208 TTTGTGTGTTTTGAGAAAAATGG + Intronic
1023104871 7:36754017-36754039 TTTCTGTTTTTGATGAAAATTGG - Intergenic
1023452202 7:40298977-40298999 CTTTTGTGCTTGAATAACAATGG + Intronic
1024430674 7:49284794-49284816 CTTATGTTTTCTAAGAAAAAGGG - Intergenic
1024689316 7:51782018-51782040 CTTCTGAATTTGGGGAAAAAAGG + Intergenic
1026230741 7:68481415-68481437 ATTCTGTCTCTGAAGAAAGAAGG + Intergenic
1026812225 7:73477832-73477854 CTTCTATGTCTGAAGAACAACGG - Exonic
1028356154 7:89912290-89912312 CTTCTGTGTTTCAGGACACAAGG + Intergenic
1028701362 7:93784537-93784559 CTTGTGAGTTTGTAGAAAAGAGG + Intronic
1030237009 7:107274962-107274984 CTTCTGTTTTTGTAGACACAGGG + Intronic
1030341546 7:108386321-108386343 CCTCAGTGTTGGAAGATAAAAGG - Intronic
1030776889 7:113544609-113544631 CTTTTGGGTTTGAAGAAACTGGG - Intergenic
1031015569 7:116572584-116572606 CTTGTGTGTTTGAGGGAAAGTGG - Intergenic
1031255463 7:119442042-119442064 TTTCTTTGTTTTAAGAAACACGG + Intergenic
1032378165 7:131445381-131445403 CTTCTTTTTTTGAAAAACAAAGG - Intronic
1032505521 7:132431556-132431578 CTCCTGTGTTCTAAGAAAGAAGG - Intronic
1032592603 7:133206026-133206048 CTTCTGTTTTAGAGGAAAAGTGG + Intergenic
1032738805 7:134718054-134718076 ATTCTGTGTTTAAAAACAAAAGG - Intergenic
1033449736 7:141451748-141451770 TTTATGTGTTTTAAGACAAACGG + Intronic
1033481127 7:141741858-141741880 CTTCTGTGTTTGCACACAAAAGG - Intronic
1033959254 7:146893132-146893154 TTTCTGTGTCAGAAGAAAGAAGG + Intronic
1035436259 7:158862274-158862296 CTTGAGTGTTTAAAGAGAAAAGG + Intronic
1035532381 8:363416-363438 TTTCTGTCTTTGAATAGAAATGG - Intergenic
1035822341 8:2606627-2606649 CTACTGAGTTTGAAGAAGACAGG - Intergenic
1036024769 8:4893858-4893880 TTTCTGTTTTTGGGGAAAAAAGG - Intronic
1036261595 8:7245041-7245063 CTTCTACGTAGGAAGAAAAAAGG - Intergenic
1036292790 8:7509191-7509213 TTTCTGTTTTTGCAGCAAAATGG - Exonic
1036305000 8:7594515-7594537 CTTCTACGTAGGAAGAAAAAAGG + Intergenic
1036313635 8:7703585-7703607 CTTCTACGTAGGAAGAAAAAAGG - Intergenic
1036329772 8:7811818-7811840 TTTCTGTTTTTGCAGCAAAATGG + Exonic
1036355850 8:8042511-8042533 CTTCTACGTAGGAAGAAAAAAGG + Intergenic
1036549932 8:9806830-9806852 CAGCTGTGTTTAATGAAAAAGGG - Intergenic
1036667241 8:10755190-10755212 ATTCTGGGTATGAAAAAAAATGG - Intronic
1036832490 8:12032061-12032083 CTTCTATGTAGGAAGAAAAAAGG - Intergenic
1036902662 8:12682586-12682608 CTTCTATGTAGGAAGAAAAAAGG - Intergenic
1038064151 8:23944676-23944698 CTTTTGTATATGATGAAAAATGG + Intergenic
1038239473 8:25795427-25795449 CATTTGTGTTTGAGGAAAAGAGG + Intergenic
1041477873 8:58285717-58285739 ATTCTGTGTAAGCAGAAAAAAGG + Intergenic
1041498934 8:58518644-58518666 CTTTTGTGTTTGATTAAAAATGG + Intergenic
1041550766 8:59098313-59098335 CTTCTATGTGTGAACCAAAAAGG + Intronic
1042367845 8:67956952-67956974 CTTCTACGAATGAAGAAAAAGGG - Intronic
1044067557 8:87717593-87717615 CTTCTTTGTTAAAAAAAAAAAGG - Intergenic
1044200646 8:89431646-89431668 TTTATGTGTTTGAAGGGAAAAGG + Intergenic
1045039528 8:98208856-98208878 CTTGTGTGATTGATAAAAAATGG - Intronic
1045064559 8:98434158-98434180 CGTCTGTGTATGCAGCAAAAGGG + Intronic
1045104223 8:98875635-98875657 CTTCTTTGTTGGAAGAGACATGG + Intronic
1045315075 8:101036841-101036863 CTTCTATCATTGTAGAAAAAGGG - Intergenic
1046531787 8:115455701-115455723 ATTCTGTCTTTGGAGGAAAAAGG - Intronic
1047371537 8:124260082-124260104 TTTCTATGTTTGGGGAAAAAGGG + Intergenic
1047826440 8:128581592-128581614 CTTCCTTGTTTGTAGAAAAGGGG + Intergenic
1048051499 8:130821416-130821438 AATCTCTGTTGGAAGAAAAAAGG + Exonic
1048054886 8:130853726-130853748 CTTCTGGGTTTGCTGTAAAAGGG + Intronic
1049988868 9:974645-974667 TTTCACTGTTTGAAGAAAATCGG + Intergenic
1051761087 9:20465440-20465462 CCTCTGCATTTGGAGAAAAAGGG - Intronic
1054754011 9:68938834-68938856 ATTCTGTGTTTGAAGACAGAGGG - Intronic
1055396895 9:75885386-75885408 CTAATGTGATTCAAGAAAAAGGG - Intergenic
1055409511 9:76013954-76013976 TTTTTGACTTTGAAGAAAAAAGG + Intronic
1055672795 9:78624129-78624151 TTTCTGTGTTTGTAGAGACAGGG + Intergenic
1057791939 9:98130437-98130459 CTTCTGTCTTAGAGGAAAAAGGG - Intronic
1058302055 9:103387674-103387696 TTTGTGTGGTTGAAGAAAATAGG - Intergenic
1059288348 9:113197773-113197795 CTTCAGTTATTGAAGTAAAATGG - Intronic
1059562661 9:115350397-115350419 CTTCTGGGTGGGAGGAAAAAGGG + Intronic
1059777108 9:117487173-117487195 CTTCTGTGAATGCAGATAAAGGG - Intergenic
1059816666 9:117924175-117924197 CTTCCCTAATTGAAGAAAAAGGG + Intergenic
1060336402 9:122727263-122727285 CTTCTGTTTTTTAAGAGACAGGG + Intergenic
1060944490 9:127561916-127561938 CTTCTGTGCTGGAGGAAGAAGGG - Intronic
1061529829 9:131201969-131201991 ATCCTGTGTCTAAAGAAAAAAGG - Intronic
1185964840 X:4588923-4588945 CTTCTGTGTTTGAGGTTTAAAGG + Intergenic
1185985997 X:4834426-4834448 AGTTTGTGTTTGGAGAAAAAGGG + Intergenic
1186494516 X:10001531-10001553 CCTATGTGTTTGGAGAAATATGG + Intergenic
1186608616 X:11116526-11116548 TTTCTGTGTTAGAAGTATAAAGG - Intronic
1187480010 X:19646846-19646868 CTTCTGTATTGGATAAAAAATGG + Intronic
1187533252 X:20115496-20115518 CTTGAGTGTTTCAAGCAAAAAGG + Intronic
1188120052 X:26293794-26293816 CTTTTGAGTGAGAAGAAAAAAGG + Intergenic
1188273268 X:28169977-28169999 CTTCTTGGCTTAAAGAAAAAAGG - Intergenic
1188471233 X:30542003-30542025 CTTCGGTATTTGAAGCAAATCGG + Intergenic
1188793583 X:34435484-34435506 CTTCTGTCTTTCAACAAAAGAGG + Intergenic
1189263104 X:39692057-39692079 CTTCGGTTTTTGAAGACACAGGG + Intergenic
1189958644 X:46304064-46304086 CTGCTGTGATGGAAGTAAAATGG + Intergenic
1191995435 X:67090026-67090048 CTTCTAAGTTTTAAGGAAAAAGG - Intergenic
1192070643 X:67936838-67936860 CTTGTCTTTTTGATGAAAAAGGG + Intergenic
1192585057 X:72312829-72312851 CTTCTGTGTTTAAAAAAAAAGGG + Intergenic
1193016441 X:76738981-76739003 CTTCTGTCTTTGGAGAAAGGAGG + Intergenic
1193748135 X:85309023-85309045 CTTATTTCTTTAAAGAAAAATGG + Intronic
1194113863 X:89872469-89872491 CTTCCGGGTTAGAAGACAAAAGG + Intergenic
1194652838 X:96535880-96535902 CTTATGAATCTGAAGAAAAAAGG - Intergenic
1196115207 X:111991830-111991852 CTCCTGTGTATTAGGAAAAATGG - Intronic
1196534924 X:116832641-116832663 ATTCTGTTTTTGAATAATAAAGG + Intergenic
1196674408 X:118404599-118404621 TTTATGAGTGTGAAGAAAAATGG + Intronic
1196700308 X:118660786-118660808 CTACTTTATTTGAACAAAAATGG + Intronic
1196910376 X:120478816-120478838 CTTCTTTGTCTGAAGAATATTGG + Intergenic
1197004198 X:121475491-121475513 TTTCTGTGTTTAAAAAAGAATGG + Intergenic
1197721378 X:129747088-129747110 CTTCTGAGTTTAAAAAAAAAAGG + Intronic
1197819212 X:130529117-130529139 CTTCTATGTTTGCAGAAGATGGG - Intergenic
1198574885 X:137999039-137999061 CTTCTGGGTTAGAAGAAAGGAGG - Intergenic
1198655785 X:138911944-138911966 CTTCCTGGTTTGAAGTAAAAGGG + Intronic
1198770831 X:140128194-140128216 TTTCTGTACTTAAAGAAAAATGG + Intergenic
1199314654 X:146363061-146363083 CTCCTGTGCCTGAAAAAAAAGGG - Intergenic
1199846689 X:151696684-151696706 ATTTTTTGCTTGAAGAAAAATGG - Intronic
1199895812 X:152127246-152127268 ATGCTCTGATTGAAGAAAAAGGG - Intergenic
1200466600 Y:3527824-3527846 CTTCCGGGTTAGAAGACAAAAGG + Intergenic
1200738765 Y:6830559-6830581 CTTCTATTTTTCTAGAAAAAGGG + Intergenic
1200783415 Y:7237344-7237366 CTTCTGTGTGTGAGAAAAGAGGG - Intergenic
1201520973 Y:14873288-14873310 CTTTTGTGTATGATGAAAATGGG + Intergenic
1201574914 Y:15452745-15452767 CTTCTGTTTTTAAAGAAACTAGG + Intergenic
1202143513 Y:21753879-21753901 GTTCTATGTGTGAAGAAAGAAGG + Intergenic