ID: 1084810254

View in Genome Browser
Species Human (GRCh38)
Location 11:71607611-71607633
Sequence GAGGAGGGAGGCTGAGTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084810254_1084810265 10 Left 1084810254 11:71607611-71607633 CCACGGACTCAGCCTCCCTCCTC No data
Right 1084810265 11:71607644-71607666 GTTTACCACTTCTTAGGTCGGGG 0: 1
1: 5
2: 2
3: 1
4: 36
1084810254_1084810264 9 Left 1084810254 11:71607611-71607633 CCACGGACTCAGCCTCCCTCCTC No data
Right 1084810264 11:71607643-71607665 AGTTTACCACTTCTTAGGTCGGG 0: 1
1: 5
2: 2
3: 7
4: 80
1084810254_1084810261 4 Left 1084810254 11:71607611-71607633 CCACGGACTCAGCCTCCCTCCTC No data
Right 1084810261 11:71607638-71607660 GCCTTAGTTTACCACTTCTTAGG 0: 1
1: 0
2: 5
3: 11
4: 111
1084810254_1084810263 8 Left 1084810254 11:71607611-71607633 CCACGGACTCAGCCTCCCTCCTC No data
Right 1084810263 11:71607642-71607664 TAGTTTACCACTTCTTAGGTCGG 0: 1
1: 0
2: 5
3: 5
4: 100
1084810254_1084810267 12 Left 1084810254 11:71607611-71607633 CCACGGACTCAGCCTCCCTCCTC No data
Right 1084810267 11:71607646-71607668 TTACCACTTCTTAGGTCGGGGGG 0: 1
1: 4
2: 1
3: 1
4: 32
1084810254_1084810266 11 Left 1084810254 11:71607611-71607633 CCACGGACTCAGCCTCCCTCCTC No data
Right 1084810266 11:71607645-71607667 TTTACCACTTCTTAGGTCGGGGG 0: 1
1: 5
2: 2
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084810254 Original CRISPR GAGGAGGGAGGCTGAGTCCG TGG (reversed) Intergenic
No off target data available for this crispr