ID: 1084810976

View in Genome Browser
Species Human (GRCh38)
Location 11:71611014-71611036
Sequence GATATTCCTCCTAATATTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084810976_1084810981 9 Left 1084810976 11:71611014-71611036 CCGGGAATATTAGGAGGAATATC No data
Right 1084810981 11:71611046-71611068 ATGCACACCCACTGCTATCTTGG No data
1084810976_1084810982 10 Left 1084810976 11:71611014-71611036 CCGGGAATATTAGGAGGAATATC No data
Right 1084810982 11:71611047-71611069 TGCACACCCACTGCTATCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084810976 Original CRISPR GATATTCCTCCTAATATTCC CGG (reversed) Intergenic
No off target data available for this crispr