ID: 1084810981

View in Genome Browser
Species Human (GRCh38)
Location 11:71611046-71611068
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084810976_1084810981 9 Left 1084810976 11:71611014-71611036 CCGGGAATATTAGGAGGAATATC No data
Right 1084810981 11:71611046-71611068 ATGCACACCCACTGCTATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084810981 Original CRISPR ATGCACACCCACTGCTATCT TGG Intergenic
No off target data available for this crispr