ID: 1084811525

View in Genome Browser
Species Human (GRCh38)
Location 11:71614730-71614752
Sequence ATCACGCTCCATGCACGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084811525_1084811532 8 Left 1084811525 11:71614730-71614752 CCTTCACGTGCATGGAGCGTGAT No data
Right 1084811532 11:71614761-71614783 AAGGGCCTATTGGACTCTGGGGG No data
1084811525_1084811534 14 Left 1084811525 11:71614730-71614752 CCTTCACGTGCATGGAGCGTGAT No data
Right 1084811534 11:71614767-71614789 CTATTGGACTCTGGGGGAAAAGG No data
1084811525_1084811529 5 Left 1084811525 11:71614730-71614752 CCTTCACGTGCATGGAGCGTGAT No data
Right 1084811529 11:71614758-71614780 GAAAAGGGCCTATTGGACTCTGG No data
1084811525_1084811531 7 Left 1084811525 11:71614730-71614752 CCTTCACGTGCATGGAGCGTGAT No data
Right 1084811531 11:71614760-71614782 AAAGGGCCTATTGGACTCTGGGG No data
1084811525_1084811530 6 Left 1084811525 11:71614730-71614752 CCTTCACGTGCATGGAGCGTGAT No data
Right 1084811530 11:71614759-71614781 AAAAGGGCCTATTGGACTCTGGG No data
1084811525_1084811528 -2 Left 1084811525 11:71614730-71614752 CCTTCACGTGCATGGAGCGTGAT No data
Right 1084811528 11:71614751-71614773 ATAGAAAGAAAAGGGCCTATTGG No data
1084811525_1084811527 -10 Left 1084811525 11:71614730-71614752 CCTTCACGTGCATGGAGCGTGAT No data
Right 1084811527 11:71614743-71614765 GGAGCGTGATAGAAAGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084811525 Original CRISPR ATCACGCTCCATGCACGTGA AGG (reversed) Intergenic
No off target data available for this crispr