ID: 1084811532

View in Genome Browser
Species Human (GRCh38)
Location 11:71614761-71614783
Sequence AAGGGCCTATTGGACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084811525_1084811532 8 Left 1084811525 11:71614730-71614752 CCTTCACGTGCATGGAGCGTGAT No data
Right 1084811532 11:71614761-71614783 AAGGGCCTATTGGACTCTGGGGG No data
1084811524_1084811532 9 Left 1084811524 11:71614729-71614751 CCCTTCACGTGCATGGAGCGTGA No data
Right 1084811532 11:71614761-71614783 AAGGGCCTATTGGACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084811532 Original CRISPR AAGGGCCTATTGGACTCTGG GGG Intergenic
No off target data available for this crispr