ID: 1084812705

View in Genome Browser
Species Human (GRCh38)
Location 11:71624456-71624478
Sequence CATTGTATGAAGGAACTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084812705_1084812710 5 Left 1084812705 11:71624456-71624478 CCCTGCAGTTCCTTCATACAATG No data
Right 1084812710 11:71624484-71624506 CTATTCAGCCTTAAAAAGGCAGG 0: 14
1: 61
2: 464
3: 1447
4: 2291
1084812705_1084812714 23 Left 1084812705 11:71624456-71624478 CCCTGCAGTTCCTTCATACAATG No data
Right 1084812714 11:71624502-71624524 GCAGGCACTTCTGGCAGGTGCGG No data
1084812705_1084812713 18 Left 1084812705 11:71624456-71624478 CCCTGCAGTTCCTTCATACAATG No data
Right 1084812713 11:71624497-71624519 AAAAGGCAGGCACTTCTGGCAGG No data
1084812705_1084812715 26 Left 1084812705 11:71624456-71624478 CCCTGCAGTTCCTTCATACAATG No data
Right 1084812715 11:71624505-71624527 GGCACTTCTGGCAGGTGCGGTGG No data
1084812705_1084812709 1 Left 1084812705 11:71624456-71624478 CCCTGCAGTTCCTTCATACAATG No data
Right 1084812709 11:71624480-71624502 AAGACTATTCAGCCTTAAAAAGG No data
1084812705_1084812712 14 Left 1084812705 11:71624456-71624478 CCCTGCAGTTCCTTCATACAATG No data
Right 1084812712 11:71624493-71624515 CTTAAAAAGGCAGGCACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084812705 Original CRISPR CATTGTATGAAGGAACTGCA GGG (reversed) Intergenic
No off target data available for this crispr