ID: 1084814631

View in Genome Browser
Species Human (GRCh38)
Location 11:71639113-71639135
Sequence CTGTGTCTTGCATGATTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084814631_1084814636 -1 Left 1084814631 11:71639113-71639135 CCTCCAAATCATGCAAGACACAG No data
Right 1084814636 11:71639135-71639157 GGGTAAGAGCAAAGACAAGGTGG No data
1084814631_1084814638 24 Left 1084814631 11:71639113-71639135 CCTCCAAATCATGCAAGACACAG No data
Right 1084814638 11:71639160-71639182 GTGGCCGATGTCCACCCTCTCGG No data
1084814631_1084814635 -4 Left 1084814631 11:71639113-71639135 CCTCCAAATCATGCAAGACACAG No data
Right 1084814635 11:71639132-71639154 ACAGGGTAAGAGCAAAGACAAGG No data
1084814631_1084814640 26 Left 1084814631 11:71639113-71639135 CCTCCAAATCATGCAAGACACAG No data
Right 1084814640 11:71639162-71639184 GGCCGATGTCCACCCTCTCGGGG No data
1084814631_1084814639 25 Left 1084814631 11:71639113-71639135 CCTCCAAATCATGCAAGACACAG No data
Right 1084814639 11:71639161-71639183 TGGCCGATGTCCACCCTCTCGGG No data
1084814631_1084814637 5 Left 1084814631 11:71639113-71639135 CCTCCAAATCATGCAAGACACAG No data
Right 1084814637 11:71639141-71639163 GAGCAAAGACAAGGTGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084814631 Original CRISPR CTGTGTCTTGCATGATTTGG AGG (reversed) Intergenic
No off target data available for this crispr