ID: 1084815383

View in Genome Browser
Species Human (GRCh38)
Location 11:71642809-71642831
Sequence GCTGTGGGTCAGACACACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084815383_1084815392 18 Left 1084815383 11:71642809-71642831 CCAGGGTGTGTCTGACCCACAGC No data
Right 1084815392 11:71642850-71642872 AAAGTCTCTCCTTAGGTATTTGG No data
1084815383_1084815386 -10 Left 1084815383 11:71642809-71642831 CCAGGGTGTGTCTGACCCACAGC No data
Right 1084815386 11:71642822-71642844 GACCCACAGCTCCTCCTGGAGGG No data
1084815383_1084815391 11 Left 1084815383 11:71642809-71642831 CCAGGGTGTGTCTGACCCACAGC No data
Right 1084815391 11:71642843-71642865 GGAAAGAAAAGTCTCTCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084815383 Original CRISPR GCTGTGGGTCAGACACACCC TGG (reversed) Intergenic
No off target data available for this crispr