ID: 1084815386

View in Genome Browser
Species Human (GRCh38)
Location 11:71642822-71642844
Sequence GACCCACAGCTCCTCCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1084815377_1084815386 21 Left 1084815377 11:71642778-71642800 CCAAACCTTTATTGACCGCTTGT No data
Right 1084815386 11:71642822-71642844 GACCCACAGCTCCTCCTGGAGGG No data
1084815375_1084815386 23 Left 1084815375 11:71642776-71642798 CCCCAAACCTTTATTGACCGCTT No data
Right 1084815386 11:71642822-71642844 GACCCACAGCTCCTCCTGGAGGG No data
1084815378_1084815386 16 Left 1084815378 11:71642783-71642805 CCTTTATTGACCGCTTGTGAATG No data
Right 1084815386 11:71642822-71642844 GACCCACAGCTCCTCCTGGAGGG No data
1084815374_1084815386 26 Left 1084815374 11:71642773-71642795 CCTCCCCAAACCTTTATTGACCG No data
Right 1084815386 11:71642822-71642844 GACCCACAGCTCCTCCTGGAGGG No data
1084815381_1084815386 6 Left 1084815381 11:71642793-71642815 CCGCTTGTGAATGATCCCAGGGT No data
Right 1084815386 11:71642822-71642844 GACCCACAGCTCCTCCTGGAGGG No data
1084815376_1084815386 22 Left 1084815376 11:71642777-71642799 CCCAAACCTTTATTGACCGCTTG No data
Right 1084815386 11:71642822-71642844 GACCCACAGCTCCTCCTGGAGGG No data
1084815382_1084815386 -9 Left 1084815382 11:71642808-71642830 CCCAGGGTGTGTCTGACCCACAG No data
Right 1084815386 11:71642822-71642844 GACCCACAGCTCCTCCTGGAGGG No data
1084815373_1084815386 27 Left 1084815373 11:71642772-71642794 CCCTCCCCAAACCTTTATTGACC No data
Right 1084815386 11:71642822-71642844 GACCCACAGCTCCTCCTGGAGGG No data
1084815383_1084815386 -10 Left 1084815383 11:71642809-71642831 CCAGGGTGTGTCTGACCCACAGC No data
Right 1084815386 11:71642822-71642844 GACCCACAGCTCCTCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1084815386 Original CRISPR GACCCACAGCTCCTCCTGGA GGG Intergenic
No off target data available for this crispr